ID: 920170609

View in Genome Browser
Species Human (GRCh38)
Location 1:204070134-204070156
Sequence AGAGCAGCCAGTGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920170600_920170609 17 Left 920170600 1:204070094-204070116 CCAGGATGGAGGAGGGAACATAA No data
Right 920170609 1:204070134-204070156 AGAGCAGCCAGTGAGGTGGGAGG No data
920170594_920170609 29 Left 920170594 1:204070082-204070104 CCCACCTGGAGACCAGGATGGAG No data
Right 920170609 1:204070134-204070156 AGAGCAGCCAGTGAGGTGGGAGG No data
920170597_920170609 25 Left 920170597 1:204070086-204070108 CCTGGAGACCAGGATGGAGGAGG No data
Right 920170609 1:204070134-204070156 AGAGCAGCCAGTGAGGTGGGAGG No data
920170595_920170609 28 Left 920170595 1:204070083-204070105 CCACCTGGAGACCAGGATGGAGG No data
Right 920170609 1:204070134-204070156 AGAGCAGCCAGTGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920170609 Original CRISPR AGAGCAGCCAGTGAGGTGGG AGG Intergenic
No off target data available for this crispr