ID: 920172789

View in Genome Browser
Species Human (GRCh38)
Location 1:204082061-204082083
Sequence CTGGTGGTGGGGTGTGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1495
Summary {0: 1, 1: 1, 2: 23, 3: 152, 4: 1318}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920172772_920172789 26 Left 920172772 1:204082012-204082034 CCTTCAGCCCCTGCTGTTTCTCA 0: 1
1: 0
2: 6
3: 44
4: 500
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172775_920172789 18 Left 920172775 1:204082020-204082042 CCCTGCTGTTTCTCAGGCTTGCC 0: 1
1: 1
2: 7
3: 44
4: 389
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172776_920172789 17 Left 920172776 1:204082021-204082043 CCTGCTGTTTCTCAGGCTTGCCC 0: 1
1: 0
2: 4
3: 21
4: 318
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172783_920172789 -10 Left 920172783 1:204082048-204082070 CCTCTTTTCTTGGCTGGTGGTGG 0: 1
1: 0
2: 11
3: 72
4: 404
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172779_920172789 -3 Left 920172779 1:204082041-204082063 CCCGGCTCCTCTTTTCTTGGCTG 0: 1
1: 0
2: 4
3: 47
4: 477
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172771_920172789 27 Left 920172771 1:204082011-204082033 CCCTTCAGCCCCTGCTGTTTCTC 0: 1
1: 0
2: 1
3: 59
4: 417
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172770_920172789 28 Left 920172770 1:204082010-204082032 CCCCTTCAGCCCCTGCTGTTTCT 0: 1
1: 0
2: 13
3: 591
4: 15755
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172780_920172789 -4 Left 920172780 1:204082042-204082064 CCGGCTCCTCTTTTCTTGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 378
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318
920172774_920172789 19 Left 920172774 1:204082019-204082041 CCCCTGCTGTTTCTCAGGCTTGC 0: 1
1: 0
2: 4
3: 33
4: 309
Right 920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG 0: 1
1: 1
2: 23
3: 152
4: 1318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920172789 Original CRISPR CTGGTGGTGGGGTGTGTGTG GGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900122856 1:1056350-1056372 CGTGTGGGGGTGTGTGTGTGTGG + Intergenic
900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG + Intronic
900432399 1:2609114-2609136 CTGGGGTTGGGGTGTGAGTGAGG + Intronic
900563716 1:3322042-3322064 TTGGAGGTCGTGTGTGTGTGGGG + Intronic
900647871 1:3717244-3717266 CTGGTGCGGGGGTGGGTGAGGGG - Intronic
900737271 1:4306868-4306890 CTGGTGGTGGGGCATTTGTCTGG + Intergenic
900751919 1:4403334-4403356 CTGGTGGAGGAGTGTTTGTCAGG - Intergenic
900773811 1:4566517-4566539 GTGGTGGGGGAGTGTGTGGGTGG - Intergenic
900995542 1:6121452-6121474 CTGGGCCTGTGGTGTGTGTGGGG - Intronic
901002362 1:6155086-6155108 TTGGGGGTGGGCTGTGGGTGTGG - Intronic
901002374 1:6155126-6155148 TTGGGGGTGGGCTGTGGGTGTGG - Intronic
901002386 1:6155166-6155188 TTGGGGGTGGGCTGTGGGTGTGG - Intronic
901163865 1:7201050-7201072 CTGGCGGTGGGGAGTGTGGATGG - Intronic
901312065 1:8276970-8276992 GTGTTTGTGTGGTGTGTGTGTGG - Intergenic
901759825 1:11463472-11463494 CTAGTGGTGGGGAGGGCGTGAGG - Intergenic
902336154 1:15756128-15756150 AAGGGGGTGGGGTGGGTGTGGGG - Intergenic
902664060 1:17925201-17925223 CTTGTGGGGAGGTGTGTGTTTGG + Intergenic
902768371 1:18631452-18631474 GTGGGGGTAGGGAGTGTGTGTGG + Exonic
902809553 1:18880384-18880406 TTGGGGTTGGGGTGCGTGTGGGG - Intronic
903002166 1:20274086-20274108 TTGGTGGATGGGTGTGTGGGTGG + Intergenic
903162477 1:21499114-21499136 CTGGTGGTGGAGGGGGTATGGGG - Intergenic
903224026 1:21884975-21884997 CAGGTGGTGGGGTGGGAATGAGG - Intronic
903255158 1:22092593-22092615 CTGGGGGTAGGGTGGGGGTGGGG + Exonic
903965555 1:27087000-27087022 CGGGGGGTGGTGTGTGTCTGTGG - Intergenic
903969107 1:27107596-27107618 GTTGTGGTGTGGGGTGTGTGTGG - Intronic
904009532 1:27381963-27381985 CTGGTGGAGGGAACTGTGTGGGG - Intronic
904032354 1:27541082-27541104 CTGGGGGTGGGGTGCGTGCTTGG + Intronic
904266296 1:29320206-29320228 GTGGATTTGGGGTGTGTGTGGGG + Intronic
904394872 1:30213331-30213353 ATGGGGGTGGGGTGGGTGGGTGG - Intergenic
904826945 1:33280207-33280229 CTGGTGGTGGTGGGTGTGGACGG - Exonic
904941220 1:34165891-34165913 GTGGAGGGGGGTTGTGTGTGGGG + Intergenic
904978990 1:34480474-34480496 CTGGTGGAGCAGTGTGTGTTGGG - Intergenic
905237232 1:36558595-36558617 CTGGGGGTGGGTTGGGTCTGAGG + Intergenic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905874697 1:41424292-41424314 TACGTGGTGTGGTGTGTGTGTGG + Intergenic
905892936 1:41528447-41528469 GTGAGGGTGGGGTGTGTGTGAGG - Intronic
906107851 1:43305434-43305456 CTGGAGGTCGGGTGTGTCAGGGG - Intronic
906117667 1:43367034-43367056 CTGGAGGTGAGGGGTGTGCGGGG - Intronic
906138834 1:43521097-43521119 GTGTTGGTGGCATGTGTGTGGGG + Intergenic
906530426 1:46520663-46520685 CTGGGGGTGGAGCGGGTGTGTGG - Intergenic
906706611 1:47899693-47899715 GTGGTGGTGGTGTGTGTGGTGGG + Intronic
906783237 1:48591072-48591094 GGGGTGGGTGGGTGTGTGTGGGG - Intronic
907097001 1:51791176-51791198 CTGGAGGTGGGGTGAGGGGGAGG - Intronic
907332807 1:53682290-53682312 CTGGTGGCAGGTTGTGTGTTAGG + Intronic
907440676 1:54476196-54476218 GTGGGGGTTGTGTGTGTGTGTGG - Intergenic
907547422 1:55274411-55274433 GTGGGGGTGGGCTGTGTGTGTGG + Intergenic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
909076820 1:71058927-71058949 ATGGTAGTGGGGTATGTGTAGGG + Intergenic
909935669 1:81547400-81547422 CTGGTGGTGGGGGTTGAGTGAGG - Intronic
910239333 1:85069534-85069556 GTGGTGATGGTGTGTGCGTGGGG + Intronic
910401700 1:86843732-86843754 GTGGGGGTGGGGTGTATGGGTGG + Intergenic
910450175 1:87335609-87335631 TTGGTGGTGGAGGGTGTGTTTGG + Intronic
910680006 1:89853311-89853333 GTGGAGTTGGGGTGTCTGTGGGG + Intronic
911141051 1:94502870-94502892 CTGGTGGTGGGGGCTTTGTCAGG + Intronic
911750448 1:101490596-101490618 GTGGGGGTGGGGTGGGGGTGGGG + Intergenic
912156605 1:106928743-106928765 CTGGGGATGGGGAGTGAGTGGGG + Intergenic
912245703 1:107959850-107959872 ATGGTGTTGGGGTGTATGTGGGG - Intronic
912502013 1:110128997-110129019 CTGGGGGTGGGGAGTGAGTGGGG + Intergenic
912535897 1:110370306-110370328 CTGGAGGTTGGGGGTGAGTGGGG - Intronic
912699238 1:111864138-111864160 GTGGTGGAGGGGTGGGCGTGTGG + Intronic
912796429 1:112696246-112696268 CGGCAGGTGGGGAGTGTGTGTGG + Exonic
912947794 1:114099037-114099059 CTGGTGCTGGAGTGGGAGTGAGG + Intronic
913240595 1:116826298-116826320 CTGGGTGTGTGGGGTGTGTGAGG - Intergenic
913364478 1:118021393-118021415 TTGGTGGGGTAGTGTGTGTGTGG + Intronic
913452207 1:119000055-119000077 GCGGTGGTGGGGTGGGGGTGGGG + Intergenic
913975540 1:143451740-143451762 CTGGGGGTGGGGGGGGTGGGGGG - Intergenic
914202586 1:145499334-145499356 GGGGTGGTGGTGTGTGTCTGTGG - Intergenic
914236516 1:145817262-145817284 GGGGTGGTGGTGTGTGTCTGTGG - Intronic
914440296 1:147699843-147699865 CTAGCGGTGGGGTATGAGTGTGG - Intergenic
914481709 1:148072485-148072507 GGGGTGGTGGTGTGTGTCTGTGG - Intergenic
915101997 1:153507395-153507417 CTGTTCCTTGGGTGTGTGTGTGG - Intergenic
915164727 1:153942175-153942197 CTGGTGATAAGGTGGGTGTGTGG - Exonic
915214592 1:154331332-154331354 TTTGTGATGGGGTGTGTATGAGG + Intronic
915984177 1:160447028-160447050 ATGGTGGTGGGGTGTTTACGAGG + Intergenic
916368564 1:164061861-164061883 GTGGCAGTGGGGGGTGTGTGTGG - Intergenic
916674868 1:167056794-167056816 CGTGTGGTGTGGTGTGTATGTGG + Intronic
917014302 1:170512102-170512124 GTGGTGGGGGGGTGGGTGGGGGG - Intergenic
917408750 1:174736573-174736595 CTGGTGGAGGACTCTGTGTGGGG + Intronic
917573589 1:176296242-176296264 CTGGAGGTGGGGTTTTAGTGTGG + Intergenic
917690523 1:177463549-177463571 CTGATGGTGGAGTGAGTGGGAGG - Intergenic
917750299 1:178047114-178047136 CTGGTGGAGGGCTGAGGGTGGGG + Intergenic
918034234 1:180851343-180851365 CTGGAGGTGGGGTGTGGTGGAGG + Intronic
918115856 1:181496956-181496978 CTGGAGGTGGGGTGAGTAGGTGG + Intronic
918474276 1:184906141-184906163 GTGGGGGTGGGGTGAGGGTGAGG + Intronic
919008238 1:191927599-191927621 TTGGCAGTGGGGTGTGTGGGCGG + Intergenic
919950602 1:202359671-202359693 CTGGCGGTGGGGGGTGGGGGTGG + Intronic
919972566 1:202590572-202590594 CTGGGGGTGGGGGGTGTCTCTGG - Exonic
919977902 1:202624694-202624716 CGTGTAGTAGGGTGTGTGTGTGG + Intronic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
920201472 1:204262253-204262275 CTGGTGGTGGAGAGTGAGTCAGG + Intronic
920216878 1:204367294-204367316 CTGGGGGTGGTTTGTGTGGGCGG - Intronic
920838338 1:209532819-209532841 GGGGGGGTGGGGTGTGTGGGGGG + Intergenic
920850523 1:209625222-209625244 CTGCTGGTGGGATGGGGGTGTGG + Intronic
922243317 1:223771217-223771239 CTGTTGGTGGCATGTGTTTGTGG - Intronic
922620166 1:226984016-226984038 CTGGTTGGGGGGTGTGTGTGGGG + Intronic
922770951 1:228182672-228182694 GTGGGGACGGGGTGTGTGTGGGG + Intergenic
922866299 1:228863996-228864018 TTGGGGGTGGGGTGTGTCTAAGG + Intergenic
922872036 1:228910733-228910755 GTTGTGGTGGTGTGTGTCTGTGG - Intergenic
922874242 1:228927434-228927456 CAGGAGGTGGGGTGGGGGTGGGG - Intergenic
923216135 1:231849525-231849547 ATGATGGTGGTGTGTGTGTGTGG + Intronic
923223593 1:231918438-231918460 CTGGTTGTGGGTTGTGTTTGAGG + Intronic
923230669 1:231983526-231983548 CCGGGGGTGGGGTGGGGGTGGGG + Intronic
923317248 1:232793003-232793025 GTGGAGGTGCAGTGTGTGTGAGG + Intergenic
923395753 1:233560958-233560980 GTCCTGGTGGGGTGTGCGTGGGG - Intergenic
923622024 1:235587411-235587433 GGGGTGGGGGTGTGTGTGTGAGG + Intronic
923658474 1:235938674-235938696 CTGGTGGTGGTGTTTACGTGAGG - Intergenic
923782905 1:237042127-237042149 GTGGGGGTGGGGTGTGGGGGCGG - Intergenic
924331749 1:242946647-242946669 CTGGTGGTGGTGTGAGCATGGGG - Intergenic
924377199 1:243424295-243424317 CTGGTGGGGGAGGTTGTGTGTGG - Intronic
924414827 1:243849376-243849398 TGGGGGGGGGGGTGTGTGTGTGG - Intronic
924524006 1:244830330-244830352 TTGTATGTGGGGTGTGTGTGTGG - Intergenic
1062831358 10:608170-608192 GTGTGTGTGGGGTGTGTGTGGGG - Intronic
1062831443 10:608429-608451 GTGTGGGGGGGGTGTGTGTGGGG - Intronic
1062831476 10:608499-608521 TGTGTGGGGGGGTGTGTGTGTGG - Intronic
1062831486 10:608525-608547 TGTGTGGGGGGGTGTGTGTGGGG - Intronic
1062831492 10:608539-608561 GGGGGGGGGGGGTGTGTGTGGGG - Intronic
1063206627 10:3838211-3838233 CTGGGGTGGGGGTGTGGGTGGGG + Intergenic
1063354017 10:5381344-5381366 GTGTGTGTGGGGTGTGTGTGGGG - Intergenic
1063354020 10:5381355-5381377 GTGTGTGTGGGGTGTGTGTGGGG - Intergenic
1063354047 10:5381492-5381514 GTGTGTGTGGGGTGTGTGTGTGG - Intergenic
1063379792 10:5577226-5577248 GTGTGTGTGGGGTGTGTGTGTGG - Intergenic
1063379826 10:5577392-5577414 GTGTGTGTGGGGTGTGTGTGTGG - Intergenic
1063379838 10:5577446-5577468 GTGGGTGCGGGGTGTGTGTGCGG - Intergenic
1063588965 10:7377959-7377981 GTGGGGGGGGGTTGTGTGTGTGG + Intronic
1063589129 10:7378714-7378736 GTGGCTGTGGGGTGGGTGTGTGG + Intronic
1063923197 10:10951779-10951801 CTGGGGGTGGGTTGTGTAGGTGG - Intergenic
1064294521 10:14066301-14066323 CTCTTGGTGGGGGGTGTGGGGGG + Intronic
1065723135 10:28644834-28644856 CTGGGGGAGGGGAGTGTCTGTGG + Intergenic
1066087948 10:31989302-31989324 CTGTGGGTGGGGAGTGGGTGGGG + Intergenic
1066393299 10:34996119-34996141 CTGGTGGTGGGGAATGTGGAGGG + Intergenic
1067013048 10:42732379-42732401 GTGGGCATGGGGTGTGTGTGTGG - Intergenic
1067013067 10:42732472-42732494 TGGGGGGTGTGGTGTGTGTGTGG - Intergenic
1067023012 10:42818537-42818559 CTGAATGTGGGGTGTGTGAGAGG + Intronic
1067087191 10:43249237-43249259 CTGGCAGTGGTGTGGGTGTGGGG - Intronic
1067177824 10:43962541-43962563 CTGGTGCTTGGGTTTGTGTGGGG + Intergenic
1067233185 10:44426089-44426111 CTGGTGGTGTGGTGTTTGTGGGG + Intergenic
1067288793 10:44926787-44926809 CTGGGGGTGGGGGGTGGGAGGGG - Intronic
1067318790 10:45198408-45198430 CTGGTGTTGGAGCGGGTGTGGGG - Intergenic
1067414567 10:46093727-46093749 CTGTGAGTGTGGTGTGTGTGGGG - Intergenic
1067434630 10:46268283-46268305 CTGTGAGTGTGGTGTGTGTGGGG - Intergenic
1067439104 10:46298381-46298403 CTGTGAGTGTGGTGTGTGTGGGG + Intronic
1067523328 10:47023975-47023997 TTTGTGGTGTGGAGTGTGTGTGG - Intergenic
1067523516 10:47025401-47025423 CTGGTGGAGGAGGGTGTGTTGGG + Intergenic
1067552508 10:47245599-47245621 GCTGTGGTGGGGTGGGTGTGGGG - Intergenic
1067581348 10:47448148-47448170 TTTGTTGTGTGGTGTGTGTGAGG + Intergenic
1067581386 10:47448664-47448686 CTGGGTGTGTAGTGTGTGTGGGG + Intergenic
1067688400 10:48481762-48481784 CTAGTGTTGGTGTGTATGTGGGG - Intronic
1067691972 10:48507904-48507926 GTGGGGGTGGGGTGGGGGTGGGG + Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1068114730 10:52724374-52724396 CAGGTGGTGGGGGGTGGGGGTGG - Intergenic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1068779943 10:60908774-60908796 CTAGAGGTGGGGTCTGTGTCAGG + Intronic
1068821641 10:61383662-61383684 CAGGGGTTGGGGTGTGTGGGTGG - Intergenic
1068936572 10:62640680-62640702 CTGGTGATGGAGTGTGGGAGAGG + Intronic
1070195212 10:74150743-74150765 CAGGTGTTGGGGTGAGTGTGAGG - Exonic
1070300764 10:75202140-75202162 CTGTTTGCTGGGTGTGTGTGGGG + Intergenic
1070337908 10:75471214-75471236 GGGGGGGTGGGGTGTGAGTGGGG + Intronic
1070507459 10:77126721-77126743 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1070567218 10:77613078-77613100 CTGGTGGTGGGGTTTTGGGGAGG - Intronic
1070711461 10:78686189-78686211 CTGGATTTGGTGTGTGTGTGGGG - Intergenic
1070769113 10:79071963-79071985 CTGGGGGTGGGGGCTGGGTGGGG + Intronic
1070771448 10:79084859-79084881 AGGGTGGTGGGGTGGGGGTGGGG + Intronic
1071269365 10:83992496-83992518 GGGGTGGTGGGGTGGGGGTGGGG - Intergenic
1071430366 10:85602225-85602247 CTGCTGGTCGGGTGGGTGGGAGG + Exonic
1071706144 10:88000953-88000975 CTGTTGGTGGGGTGTGGGAAAGG + Intergenic
1071871944 10:89805820-89805842 CTGTGGGGGGTGTGTGTGTGTGG - Intergenic
1071954029 10:90737277-90737299 CTGGTGCAGGGGTGGGGGTGAGG - Intergenic
1072026849 10:91467956-91467978 GTGGTGGTGTGGTAGGTGTGGGG - Intronic
1072120051 10:92398160-92398182 GTGGTGGTGAGGTGTGGGGGAGG - Intergenic
1072637629 10:97187786-97187808 CAGGTGCTGGGGTGTGTGTCTGG - Intronic
1072682650 10:97517860-97517882 CTGGTGGTGCTGTGTGTGTGTGG + Intronic
1072717022 10:97759129-97759151 CTGGGTGGGGGGTCTGTGTGGGG + Intronic
1072939093 10:99743514-99743536 TTTGGGGTGGGGTGTATGTGTGG + Intronic
1073119173 10:101111192-101111214 CTGGGAGTGGGGTGGGTGGGAGG - Intronic
1073125365 10:101145927-101145949 CTTGTGGTGGGGTGTGGGGTGGG - Intergenic
1073382877 10:103094109-103094131 CTGGTGGTGGGGGGTGGGATGGG - Intronic
1073982356 10:109169064-109169086 GTGGTGGTGGGGGGTGGGGGTGG - Intergenic
1074046937 10:109848058-109848080 TGGGCGGTGGGGTGGGTGTGGGG - Intergenic
1074126957 10:110536191-110536213 CTGAGGTGGGGGTGTGTGTGTGG - Intergenic
1074966483 10:118495340-118495362 CAGGAGGCAGGGTGTGTGTGGGG - Intergenic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1075550767 10:123390868-123390890 CTGGGGGTGAGGTGGGTGTAAGG + Intergenic
1075637436 10:124038853-124038875 GTGGAGGTGGGGTGTGGCTGTGG - Intronic
1075649924 10:124120675-124120697 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1075793890 10:125105285-125105307 CAGGTGGTGGTGTGTATCTGTGG - Intronic
1076059254 10:127400772-127400794 CTGGGGGTGGGAGGTGGGTGAGG - Intronic
1076481875 10:130790017-130790039 GTGGTGGGGGTGTCTGTGTGTGG - Intergenic
1076584637 10:131537250-131537272 CTGGGGGTGGGGGCTGGGTGGGG - Intergenic
1076687515 10:132204704-132204726 CTGGTGGTGGCAGGTGTGCGGGG + Intronic
1076778769 10:132712308-132712330 TTGCTTGTGGGGTTTGTGTGGGG + Intronic
1076900971 10:133337217-133337239 GTGTTTGTGAGGTGTGTGTGTGG - Intronic
1076996873 11:301662-301684 CTGGGGGTGGGGGGGGTGGGGGG + Intergenic
1077088168 11:765126-765148 CAGGCGGTGGGTTGTGTCTGGGG - Intergenic
1077167108 11:1148662-1148684 CTGTGTGTGGGGTGAGTGTGGGG + Intergenic
1077394852 11:2315800-2315822 CTGGTGGAGGGGTGTGAGGGGGG - Intronic
1077442835 11:2576717-2576739 CTGGTGCAGGGGTGTGCGTGAGG + Intronic
1077543808 11:3160147-3160169 CAGGGGGTGGGGTGGGGGTGAGG + Intronic
1078159575 11:8828945-8828967 GTGTGTGTGGGGTGTGTGTGTGG + Intronic
1078290382 11:10004999-10005021 CTGGTGGTGGCATGGGGGTGGGG - Intronic
1078310983 11:10241951-10241973 CTGGTGGTGTGGTCTGTAGGTGG - Intronic
1078338030 11:10478886-10478908 GAGGTTGTGGGGTGTGGGTGTGG + Intronic
1078930263 11:15907038-15907060 CTGGTGTGTGGGTGTGTGTGTGG - Intergenic
1078930326 11:15907466-15907488 CCAGGTGTGGGGTGTGTGTGGGG - Intergenic
1078930343 11:15907596-15907618 TATGTGGTGTGGTGTGTGTGTGG - Intergenic
1079133599 11:17763535-17763557 GTGGTGTGGGGGTCTGTGTGTGG - Intronic
1079133643 11:17763756-17763778 GTGGTGTGGGGGTTTGTGTGTGG - Intronic
1079480991 11:20879570-20879592 CTGATGGCCAGGTGTGTGTGTGG + Intronic
1079617560 11:22513890-22513912 TTGGTGGTGGGGTGGTTGAGCGG - Intergenic
1079628192 11:22641493-22641515 CCTGTCGTGGGGTGTGTGGGGGG - Intronic
1079781784 11:24616438-24616460 TTGGTGGTATTGTGTGTGTGTGG + Intronic
1080244549 11:30164517-30164539 CAGGTGGTGGGGTGGGGGTGAGG + Intergenic
1080621183 11:33988493-33988515 CGGGGGGTGGGGGGTGGGTGGGG - Intergenic
1080858326 11:36131184-36131206 CTGGTGGTGGGGTGAGAGCTGGG - Intronic
1080979166 11:37379360-37379382 AGGGTGGTGGGGTGTGTCAGGGG + Intergenic
1080979649 11:37385892-37385914 CTGGTGGTGGGGGGCGGGGGGGG + Intergenic
1081176863 11:39938078-39938100 TTGGTGGTGGGGGGTGGGTAAGG + Intergenic
1081401860 11:42653144-42653166 CTGGTGGTGGGGTGGGGGGGCGG - Intergenic
1081528976 11:43944941-43944963 CTGGTGGTGGGGCTGGTGCGTGG + Intergenic
1081597053 11:44466656-44466678 CTGGAGCAGGTGTGTGTGTGTGG + Intergenic
1081631123 11:44690716-44690738 CTGGTGGTGGGGTGGTAGTTGGG - Intergenic
1081670934 11:44942335-44942357 GTTGTGGGGGTGTGTGTGTGTGG - Intronic
1081773403 11:45663288-45663310 CTGATAGAGGGGTGTGTGTCAGG - Intronic
1081797594 11:45832087-45832109 TGGGTGCTGGGGTGTCTGTGTGG - Intergenic
1081999694 11:47387347-47387369 GTGGTGGTGGTGTGTGCCTGTGG + Intergenic
1082084912 11:48041975-48041997 CTTGAGGTGGGGGGTGGGTGGGG + Intronic
1082870813 11:57942828-57942850 TTGGAGATGGGGTATGTGTGGGG + Intergenic
1083161599 11:60857792-60857814 CTGGTGCTGAGATGTGTCTGTGG - Intergenic
1083200190 11:61116432-61116454 TTTGTGGTGGTGTGTGTGTGTGG - Intronic
1083200196 11:61116486-61116508 GTGGTGTGGTGGTGTGTGTGGGG - Intronic
1083200201 11:61116505-61116527 TGTGTGGTGGTGTGTGTGTGTGG - Intronic
1083200228 11:61116759-61116781 GTGGTGGTGCGTGGTGTGTGTGG - Intronic
1083200231 11:61116778-61116800 GTGCAGGTGGTGTGTGTGTGTGG - Intronic
1083213899 11:61206651-61206673 CTGGTGCTGGGGAGTGAGAGTGG - Intronic
1083216783 11:61225480-61225502 CTGGTGCTGGGGAGTGAGAGTGG - Intronic
1083219665 11:61244306-61244328 CTGGTGCTGGGGAGTGAGAGTGG - Intronic
1083289980 11:61684474-61684496 GTGGACGTGGGTTGTGTGTGTGG + Intronic
1083339432 11:61949620-61949642 CTGGTGGAGGGGGGTGAGTCTGG - Intergenic
1083552250 11:63598744-63598766 CAGGTGTTGGGGAGTGTCTGTGG - Intronic
1083581238 11:63826872-63826894 CTCGTGGTGGGGTGTCTGGGGGG + Intronic
1083878704 11:65537892-65537914 CTGGTGGGGAGGTGTGTGTATGG + Intronic
1084319721 11:68366529-68366551 CAGCGGCTGGGGTGTGTGTGTGG + Intronic
1084334528 11:68448946-68448968 CTGGCTGTGGGGCGTGGGTGGGG - Exonic
1084381705 11:68817008-68817030 GTGGGGGGTGGGTGTGTGTGTGG + Intronic
1084408417 11:68992123-68992145 TTGGAGGTGGGGCGTGTGTTAGG + Intergenic
1084413074 11:69015075-69015097 GGAGTGGTGGGCTGTGTGTGTGG + Intergenic
1084432699 11:69120358-69120380 CTGCTGGTGGGGCTGGTGTGAGG + Intergenic
1084519130 11:69652442-69652464 GTGGAGGTGGGGTGTTTGGGAGG + Exonic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084576222 11:69989595-69989617 CAGGTGGTGGGGAGGGGGTGGGG - Intergenic
1084604684 11:70165611-70165633 CAGGCGGAGGGGTGTGTGGGTGG + Intronic
1084671959 11:70612147-70612169 CTGGTGGTGGGGCCCCTGTGGGG + Intronic
1084956183 11:72692857-72692879 GTGGGGTTGGGGTGTGTGTATGG + Intronic
1085064140 11:73476444-73476466 CTGATGGTGGGGTGGGGGTGGGG + Intronic
1085064145 11:73476455-73476477 GTGGGGGTGGGGTGGGTGGGTGG + Intronic
1085284701 11:75352008-75352030 GTGGTGGTGTGGTGTATGTGAGG + Intergenic
1085296278 11:75433441-75433463 CTGGAGTTGGGGTGTGGGAGGGG + Intergenic
1085329537 11:75636526-75636548 CTAGTCCTGGGGTGTATGTGGGG - Intronic
1085672224 11:78477928-78477950 TTGAGGGCGGGGTGTGTGTGTGG - Intronic
1086338543 11:85824315-85824337 CTGACTGTTGGGTGTGTGTGAGG + Intergenic
1086563643 11:88198224-88198246 GTGGGGGTAGGGTGTTTGTGGGG + Intergenic
1087025883 11:93649541-93649563 GTGGTGGGGAGGTGTATGTGTGG + Intergenic
1087421397 11:97929632-97929654 TTGAGGGAGGGGTGTGTGTGTGG + Intergenic
1087757732 11:102073137-102073159 TTAGTGGTGGGCTGGGTGTGTGG + Intronic
1088164713 11:106920159-106920181 CTGGTGTGTGCGTGTGTGTGTGG - Intronic
1088176082 11:107054386-107054408 CTGGTGGGGGAGAGGGTGTGGGG - Intergenic
1088319982 11:108545575-108545597 CTGGGGTGGGAGTGTGTGTGGGG + Intronic
1088425016 11:109693276-109693298 CTGTTGCTGGGGTGGGGGTGAGG - Intergenic
1088838135 11:113596836-113596858 CTGGAGATGGGGTGGGGGTGGGG + Intergenic
1088962141 11:114679310-114679332 GTGGGGGTGGGGTGGGGGTGGGG + Intronic
1089013464 11:115148329-115148351 GTGGTGCTGTGGAGTGTGTGGGG + Intergenic
1089203236 11:116738192-116738214 CTGGCACTGGGGTGAGTGTGAGG + Intergenic
1089301592 11:117502202-117502224 CAGGAGCTGGGCTGTGTGTGAGG - Intronic
1089334972 11:117716999-117717021 CTGGTGCTGGGGTGCATCTGGGG - Intronic
1089797366 11:120992365-120992387 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1089855190 11:121537377-121537399 CTGATGCTGGGGTGTGTTTGAGG + Intronic
1090067752 11:123518113-123518135 CTGGTTGTGGGGTTTCTCTGAGG + Intergenic
1090441007 11:126725706-126725728 CTGCTGCTGGGGTGGATGTGCGG + Intronic
1090846497 11:130534044-130534066 CTGGGTTTGGGGTGGGTGTGAGG + Intergenic
1091061729 11:132469771-132469793 TGTGTGGAGGGGTGTGTGTGTGG + Intronic
1091077456 11:132633702-132633724 CTGGTGGTAAGGGGTGTGTATGG + Intronic
1091236649 11:134026704-134026726 CTGGTGTAGGAGTGTGTGGGAGG - Intergenic
1091316283 11:134616167-134616189 GTGGTGGTTGTGTGTGTGTAGGG + Intergenic
1091479362 12:810867-810889 CTGGGGGTGGGGTGGGGGTCAGG - Intronic
1091971200 12:4788459-4788481 CTGGTCTTGGGGTGGGTGGGAGG + Intronic
1092282568 12:7108939-7108961 CTGCTGCTGGTGTGTGTATGTGG + Intronic
1092386453 12:8039024-8039046 CTGGTGTTGGTGTCTGTGGGCGG + Intronic
1092920573 12:13228088-13228110 TTGGGGGTGGGGTGGGTGTAGGG - Intergenic
1094105131 12:26803139-26803161 CTGGAGGATGGGTGAGTGTGGGG - Intronic
1094224813 12:28033187-28033209 CAGCTGGTGTGGGGTGTGTGGGG - Intergenic
1094295074 12:28896748-28896770 CTGGTAGAGGGGTGTGGGAGAGG - Intergenic
1094625003 12:32115019-32115041 CTTTTGGTGGGGGGTGTGGGCGG + Intronic
1095207165 12:39451442-39451464 GTGGTGGTGGTGTGTGTGTTGGG - Intergenic
1095873526 12:47056167-47056189 GTGGGGCGGGGGTGTGTGTGGGG - Intergenic
1095967568 12:47879209-47879231 CTGGTGGTGGGGGGTGGGGGCGG - Intronic
1096639012 12:52979542-52979564 CTGGATGTGGGGTGTGGATGGGG - Intergenic
1096787682 12:54026995-54027017 AGGGTGGTGGGGAGTGTGCGGGG - Intronic
1097014056 12:55973045-55973067 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
1097134218 12:56837899-56837921 CTGGTGGTGGGGGCTGAGAGTGG + Intergenic
1097221132 12:57451820-57451842 CTGGGGGTCGGGGATGTGTGGGG - Intergenic
1097265177 12:57740201-57740223 CTGGTGGGGGGCTGAGGGTGGGG + Intronic
1097323102 12:58246850-58246872 GTGGTGGTGGGGGGTGGGAGGGG + Intergenic
1097768993 12:63558445-63558467 CTGTTGGTGGGGGGTGGGGGTGG - Intergenic
1098096208 12:66958911-66958933 CTGATGCTGGAGAGTGTGTGGGG - Intergenic
1098410355 12:70175657-70175679 ATGGTGGTAGGGTATGTGGGAGG - Intergenic
1100007422 12:89911039-89911061 GTGTTTGTGGGGTGTGTGTTTGG + Intergenic
1100060088 12:90564980-90565002 CTTGTGATGGGTTCTGTGTGGGG + Intergenic
1100811506 12:98343214-98343236 TTGGGAGTGGGGTGTGGGTGGGG + Intergenic
1100815135 12:98379632-98379654 CTGGTGGTGGGGTGGGAGTGGGG - Intergenic
1101547519 12:105730320-105730342 GTGGTGGTGGTGTTAGTGTGTGG + Intergenic
1101709143 12:107248812-107248834 ATGCAGGTGGGGTGGGTGTGGGG - Intergenic
1101970527 12:109309395-109309417 CTGGGGGGGGGGTGTGTGTGAGG + Intergenic
1102494007 12:113306710-113306732 CTGGTGGGGTGCTGTGTGAGGGG + Intronic
1102495556 12:113316671-113316693 CGGGTGGTGAGGTGTGCCTGCGG + Intronic
1102547175 12:113665556-113665578 ATGGAGATGGTGTGTGTGTGTGG - Intergenic
1102954841 12:117052751-117052773 CTGGGGGTGGGTTGGGTGTGGGG - Intronic
1103039832 12:117685764-117685786 CTGGTGGTGGGTTGGGGGTGGGG - Intronic
1103447874 12:121006074-121006096 GGGGTGGTGGTGTGTGTCTGTGG + Intronic
1103607074 12:122095013-122095035 GTGTTGGTGTGTTGTGTGTGTGG + Intronic
1103662077 12:122528252-122528274 CTGGTGTTTGGGTGGGAGTGAGG - Intronic
1103761231 12:123251610-123251632 CCAGTGGGGGGGTGTGTGTTCGG + Intronic
1103797138 12:123511234-123511256 CTGTGTGTGGTGTGTGTGTGAGG + Intronic
1103797168 12:123511594-123511616 CTGTGTGTGTGGTGTGTGTGAGG + Intronic
1103797240 12:123512540-123512562 CTGTGTGTGGTGTGTGTGTGAGG + Intronic
1103986922 12:124773581-124773603 CTTGTGTTTGTGTGTGTGTGGGG - Intergenic
1103989702 12:124790694-124790716 GTTGTGGGGGGGTCTGTGTGGGG - Intronic
1104039995 12:125123468-125123490 TTGGTGGCAGGGTGTGTCTGGGG + Intronic
1104089494 12:125503269-125503291 CTGGTGGTGGTGAGTGTACGGGG + Intronic
1104586925 12:130055084-130055106 TTTGTGGTGGTGTGTGTTTGTGG - Intergenic
1104586931 12:130055136-130055158 TTGGTTGTGGTGTGTGTGTGTGG - Intergenic
1104849084 12:131862690-131862712 ATGGCGGGGGGCTGTGTGTGCGG - Intergenic
1104878863 12:132055474-132055496 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104878869 12:132055514-132055536 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104878877 12:132055555-132055577 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104878885 12:132055591-132055613 GTGGTATAGGGGTGTGTGTGAGG + Intronic
1104878893 12:132055632-132055654 GAGGTGTAGGGGTGTGTGTGAGG + Intronic
1104892713 12:132148139-132148161 CGGGTTTGGGGGTGTGTGTGGGG + Intronic
1104893966 12:132152925-132152947 ATGGGGGGGTGGTGTGTGTGGGG + Intergenic
1104907717 12:132223079-132223101 TAGGGTGTGGGGTGTGTGTGTGG - Intronic
1104907726 12:132223122-132223144 GTGTGTGTGGGGTGTGTGTGGGG - Intronic
1104907731 12:132223135-132223157 TGGGTTGTGTGGTGTGTGTGTGG - Intronic
1104908046 12:132225824-132225846 TGGGTTGTGTGGTGTGTGTGAGG - Intronic
1105611247 13:21971438-21971460 GTGGGTGTGGGGTGTGTGTGGGG + Intergenic
1106110271 13:26771036-26771058 GTGGGGGTGGGGGGTGTGGGGGG + Intergenic
1106560788 13:30844290-30844312 GTGTGGGTGTGGTGTGTGTGTGG + Intergenic
1106778923 13:33036399-33036421 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
1107291999 13:38865274-38865296 CTGATGATGGGGTGGGGGTGAGG - Intronic
1108218840 13:48212408-48212430 TTGGTGGTGGAGGCTGTGTGTGG - Intergenic
1108741000 13:53338343-53338365 CTGGTGGTGAGGAGAGGGTGTGG + Intergenic
1108966658 13:56314632-56314654 GTAGAGGTGAGGTGTGTGTGTGG - Intergenic
1109254411 13:60061610-60061632 GTGGGGGTGGGAGGTGTGTGTGG - Intronic
1109954967 13:69553674-69553696 CTGTTTGTGGGGTGGGAGTGAGG + Intergenic
1110306130 13:73988653-73988675 CTGGTGTTGGGGTCTGACTGGGG - Intronic
1110383911 13:74886066-74886088 GTGGTGGTGGTGGGTGGGTGGGG + Intergenic
1110442288 13:75538879-75538901 GGGGTGGTGGGGTTTGGGTGGGG + Intronic
1111222947 13:85228497-85228519 GGGGTGGTGGGGGGTGTGTATGG - Intergenic
1111981915 13:95025371-95025393 GGGGTGGGAGGGTGTGTGTGGGG - Intronic
1111981923 13:95025391-95025413 GTGGTGGGGGTATGTGTGTGGGG - Intronic
1112680801 13:101762951-101762973 CTGGAGGCAGGGTGTGTGTTTGG - Intronic
1113076775 13:106474828-106474850 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1113126979 13:106990189-106990211 CTGGTGCTGGGCTGGGGGTGAGG + Intergenic
1113263523 13:108592335-108592357 CTGTGTGTGGGATGTGTGTGTGG + Intergenic
1113361994 13:109640287-109640309 CTGGGGATGGGCTGGGTGTGAGG - Intergenic
1113374355 13:109750395-109750417 CTGGTGGTGGGGTGGCTCTGGGG + Intergenic
1113406269 13:110043314-110043336 CTGTGTGTGGGGTGTATGTGTGG - Intergenic
1113406283 13:110043547-110043569 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1113406285 13:110043573-110043595 CTGAGTGTGTGGTGTGTGTGTGG - Intergenic
1113542140 13:111116558-111116580 CGGGGGGTGGGGTGGGGGTGGGG + Intronic
1113607550 13:111621271-111621293 CTGTGTGTGTGGTGTGTGTGTGG + Intronic
1113645803 13:111994720-111994742 GTGGGCCTGGGGTGTGTGTGTGG - Intergenic
1113798570 13:113074722-113074744 CTGTGGGTGGGGTGTGGGAGGGG - Intronic
1113856227 13:113447439-113447461 CTCATGGTGGTGTGTGTGTATGG + Intronic
1113966428 13:114155859-114155881 CTGGGGGTGGAGGGTGGGTGTGG + Intergenic
1113975985 13:114227731-114227753 GTGTCTGTGGGGTGTGTGTGTGG + Intergenic
1114191182 14:20440501-20440523 CTAGGGGTGGTATGTGTGTGGGG + Intergenic
1114570888 14:23667510-23667532 CTGGTGGTGGAGTGGGGGGGTGG - Intergenic
1114573524 14:23692729-23692751 CTGGAGCTGGGGGGTGTCTGGGG - Intergenic
1114574713 14:23701350-23701372 CTGGTGGAGTGGTGGGAGTGAGG + Intergenic
1114978644 14:28133797-28133819 CTGGGGGTGGGGTGGGGGTTGGG + Intergenic
1115528130 14:34301835-34301857 CTGGTGGCTGTGTGGGTGTGGGG - Intronic
1115545170 14:34459261-34459283 TTGGGGGTGGGGTGGGGGTGGGG - Intronic
1115848180 14:37561109-37561131 TTGGTGGTGGGGTGAGGGTGGGG - Intergenic
1115961477 14:38838644-38838666 AAGGTGCAGGGGTGTGTGTGGGG - Intergenic
1116035892 14:39626882-39626904 CGGGTGTTGGGGGGTGTGGGGGG - Intergenic
1116078896 14:40147508-40147530 TTGGAGATGGGGTCTGTGTGAGG + Intergenic
1116110134 14:40568392-40568414 GTGGTGTGGGTGTGTGTGTGTGG - Intergenic
1116234337 14:42258487-42258509 CTGGTTGTGGGGTGGGGGAGGGG + Intergenic
1116984293 14:51203426-51203448 CAGGTTGTGGGGTATGTCTGTGG + Intergenic
1117127968 14:52651938-52651960 CTGGGGGTGGGGAGTGGATGGGG - Intronic
1117754133 14:58956589-58956611 TGTGTGGTGTGGTGTGTGTGGGG + Intergenic
1118205853 14:63722830-63722852 CTGGTGGTAGTGTGTGCCTGTGG + Intronic
1118259918 14:64236886-64236908 GTGGCTGTGGGGTGTGTGTGGGG - Intronic
1118315801 14:64725376-64725398 ATGGTGGTGGTGGGTGGGTGGGG + Intronic
1118348209 14:64955088-64955110 AAGATGGTGGGGTGTGTGTGAGG - Intronic
1118708840 14:68503240-68503262 TTGGTGGAGGAGGGTGTGTGTGG + Intronic
1118764166 14:68899072-68899094 GTGGGTGTGAGGTGTGTGTGTGG - Intronic
1119269417 14:73288908-73288930 GTGGTGGTGGTGTGTGTCTGTGG + Intronic
1119443515 14:74645766-74645788 GTGGTGGTGGTGTGTATGTTAGG - Intergenic
1119717069 14:76866977-76866999 GGGGGGGTGGGGTGTGTGTGTGG + Intronic
1119717110 14:76867110-76867132 GGGGGGATGGGGTGTGTGTGTGG + Intronic
1120483509 14:85082322-85082344 CAGGTGGTGGGGAGGGTGGGTGG - Intergenic
1120524986 14:85567550-85567572 CTGCTGTTAGGGTGTTTGTGAGG + Intronic
1120876372 14:89379733-89379755 CTGGTGGTGGGGAGGGAGGGCGG - Intronic
1121117140 14:91351799-91351821 GTGGTGCTGGGGTATCTGTGGGG - Intronic
1121339537 14:93097073-93097095 CTGGTGCTGGGCTGGGTATGGGG - Intronic
1121546633 14:94768168-94768190 CTGATGGTGGTGGGTGGGTGGGG + Intergenic
1121563268 14:94889868-94889890 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1121630677 14:95419704-95419726 ATGGTGGTGGGGTGGGGGTGGGG + Intronic
1122176904 14:99927793-99927815 TTGGTGGTGGGGGGGGTGGGGGG + Intronic
1122209901 14:100167283-100167305 TAGGGGGTGGGGTGTGTGTTGGG - Intergenic
1122244946 14:100395826-100395848 CTGGAGGTGAGGGGTGGGTGGGG - Intronic
1122281828 14:100628053-100628075 GGGGTGGTGGGGTGGGTGGGGGG + Intergenic
1122295147 14:100701248-100701270 CTGGGGGTGGGGTGGATGGGTGG + Intergenic
1122403025 14:101478683-101478705 CTGGAGGTGGGGGGTGGGTGTGG - Intergenic
1122885683 14:104709393-104709415 CTGGGGGTGGGGTGTGGGGGTGG - Intronic
1122901672 14:104784650-104784672 GTGGTGGTGGGGTGGGTTGGGGG - Intronic
1124049825 15:26186654-26186676 CTGATGTTGGTGTGTGTGGGGGG + Intergenic
1124174985 15:27416235-27416257 ATGGTGGTAAGGTGTGGGTGGGG + Intronic
1124250833 15:28105655-28105677 GTGGGGGTGTGGTGTGTGTATGG + Intergenic
1124253137 15:28120664-28120686 CCAGTGGTGGGGAGGGTGTGAGG + Intronic
1124397850 15:29320201-29320223 GTGGTGGGAAGGTGTGTGTGTGG - Intronic
1124493557 15:30173111-30173133 CATGTAGTAGGGTGTGTGTGTGG + Intergenic
1124493566 15:30173201-30173223 CATGTAGTAGGGTGTGTGTGTGG + Intergenic
1124725528 15:32152895-32152917 CTGTTGGGGCTGTGTGTGTGTGG + Intronic
1124959094 15:34381919-34381941 GTGGGGGTGGGGTGGGGGTGTGG - Intronic
1124975720 15:34528140-34528162 GTGGGGGTGGGGTGGGGGTGTGG - Intronic
1125191801 15:37002254-37002276 CAGGTGATGGGGTGGGGGTGGGG - Intronic
1125457538 15:39875821-39875843 CAGGTGGTGGTTTGTGTATGTGG - Intronic
1125476348 15:40050528-40050550 GTGGGGGAGTGGTGTGTGTGGGG + Intergenic
1125476352 15:40050546-40050568 TGGGGGGTGTGGTGTGTGTGAGG + Intergenic
1125894859 15:43293724-43293746 CGGGTGGTGGGGCGTGCGGGGGG + Intronic
1126075969 15:44910011-44910033 CTAGGGCTGGGGTGTGTGTTGGG + Intergenic
1126090784 15:45049318-45049340 CTGGAGGTGGGGGTTGTGTGGGG + Intronic
1126704636 15:51396043-51396065 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1127274902 15:57433721-57433743 ATGGTGTTGGGGTGTTGGTGGGG + Intronic
1127331726 15:57946599-57946621 ATGTGTGTGGGGTGTGTGTGGGG + Intergenic
1127790496 15:62394216-62394238 GTGGTGTTGTGATGTGTGTGTGG + Intronic
1127821429 15:62659567-62659589 CTGTTGCTGGAGTGTGAGTGTGG - Intronic
1127890128 15:63242860-63242882 GTGGTGGTGGTGTGGGGGTGGGG + Intronic
1128306385 15:66601479-66601501 CTGCTGATGGGGTGGGGGTGGGG + Intronic
1128684506 15:69673819-69673841 ATGGGGTTGGGGTGTGTGGGAGG - Intergenic
1128875719 15:71199506-71199528 GTGTGTGTGGGGTGTGTGTGGGG + Intronic
1128892552 15:71343980-71344002 ATGGGGGTGGGGTGGGGGTGGGG + Intronic
1129225501 15:74168193-74168215 CTGGTGGCTGGGGGTGGGTGGGG + Intergenic
1129372280 15:75105096-75105118 GTGGTTGTGGGGTGTTTGTGAGG + Intronic
1129894309 15:79092145-79092167 TTGGGTGTGTGGTGTGTGTGTGG - Intergenic
1129934868 15:79439232-79439254 TAGGTTGTGGGGTGTGGGTGGGG + Intronic
1130599105 15:85264146-85264168 CTGGGGGTGGGGAGTTGGTGGGG + Intergenic
1130879705 15:88044569-88044591 GTGGTGGTGGGGTGGGGGGGCGG - Intronic
1130888582 15:88114028-88114050 TTGATGGTGGTGTGTGTGTGTGG - Intronic
1130996817 15:88908739-88908761 CTGGTGGAAGGGTGTGTGTATGG - Intronic
1131243490 15:90769682-90769704 ATGGGGGTGGGGTGGGGGTGGGG - Intronic
1131279585 15:91009704-91009726 CTGGTGGTGGGGGTGGGGTGGGG + Intronic
1131291702 15:91112118-91112140 CTGGGGGTGGGGTGAGGGTTGGG + Intronic
1131535381 15:93232859-93232881 GGGGTGGTGGGGGGTGTGGGGGG + Intergenic
1131646049 15:94345924-94345946 GTGGTGGTGGTGTGTGTGATCGG + Intronic
1131695328 15:94870925-94870947 GTTGTTGTTGGGTGTGTGTGTGG + Intergenic
1131779826 15:95844158-95844180 TTGGTGGTGGGGTGGGTGATGGG - Intergenic
1132334566 15:101037688-101037710 CTGGGGCTGAGGTGTGAGTGAGG - Intronic
1132552402 16:559026-559048 CTGGTTCTGGGGTGGGCGTGGGG - Intergenic
1132640912 16:977962-977984 TGTGTGGTGGGGTGTGTGTATGG - Intronic
1132691986 16:1185774-1185796 CCGGAGGCGGGGTGTGTATGGGG + Intronic
1132715967 16:1289954-1289976 CTGGTGCTGGGGGGTCAGTGGGG - Intergenic
1132932466 16:2465925-2465947 CTGGTGCTGGGGCAGGTGTGGGG + Intergenic
1133813798 16:9181198-9181220 GTGGTGGTGGGGAGTGTGAGAGG + Intergenic
1133922477 16:10165961-10165983 CTGGTGTTAGGGTGTGTGCATGG - Intronic
1133987052 16:10676577-10676599 GTGGTGGTGGTGTGGGTGTTAGG - Intronic
1133989868 16:10696418-10696440 GTGGTGGTAGGGTGGGGGTGGGG - Intergenic
1134222026 16:12362556-12362578 CTGGTGGGGGGGGGGGTGGGGGG - Intronic
1134287583 16:12875675-12875697 CTGCTTGGGGTGTGTGTGTGGGG - Intergenic
1135158559 16:20073975-20073997 CTGGAAGCGGAGTGTGTGTGGGG + Intergenic
1135394781 16:22122914-22122936 GTGGTATTGGGGTGTGTGTGTGG + Intronic
1135423938 16:22323027-22323049 CAGGTGGAGGCGGGTGTGTGAGG + Intronic
1135845388 16:25913846-25913868 GTGGAGGGAGGGTGTGTGTGGGG + Intronic
1136003214 16:27311933-27311955 CTGGAGGTGGCGTGGGAGTGTGG - Intergenic
1136114968 16:28088853-28088875 CGGGGTGTGGGGTGTGTGTGTGG - Intergenic
1136114977 16:28088894-28088916 GTGTGTGTGGGGTGTGTGTGGGG - Intergenic
1136114994 16:28088957-28088979 TGGGGTGTGGGGTGTGTGTGGGG - Intergenic
1136115007 16:28089005-28089027 GTGTGTGTGGGGTGTGTGTGGGG - Intergenic
1136115013 16:28089027-28089049 GTGGGGGTGTGGGGTGTGTGGGG - Intergenic
1136115040 16:28089113-28089135 GTGTGTGTGGGGTGTGTGTGGGG - Intergenic
1136115054 16:28089186-28089208 GTGGGTGTGTGGTGTGTGTGGGG - Intergenic
1136115075 16:28089281-28089303 TGTGTGGTGTGGTGTGTGTGGGG - Intergenic
1136115140 16:28089695-28089717 GTGTATGTGGGGTGTGTGTGTGG - Intergenic
1136115162 16:28089813-28089835 GTGTGTGTGGGGTGTGTGTGTGG - Intergenic
1136405677 16:30045282-30045304 TGTGTGGTGGGGTGTGTGTGGGG + Intronic
1136665859 16:31811937-31811959 TTGGTGTTTGTGTGTGTGTGAGG - Intergenic
1136860709 16:33700177-33700199 CTGAATGTGGGGTGTGTGAGAGG - Intergenic
1137070367 16:35899558-35899580 CTGTTGGTGTGGTGAGTGTGAGG + Intergenic
1137269600 16:46894534-46894556 CTGGCTGTGGGATGAGTGTGGGG + Intronic
1137892797 16:52180040-52180062 CTGGTGTGGATGTGTGTGTGTGG - Intergenic
1138191912 16:55020457-55020479 CTTTTTTTGGGGTGTGTGTGGGG + Intergenic
1138209602 16:55152341-55152363 CGGGGGGTGGGGTGGGTGGGTGG + Intergenic
1138505278 16:57475385-57475407 ATGGTGGTGTGGTGTGTGTGGGG - Intronic
1138567159 16:57841883-57841905 GTGGGGATGGGGTGTGTGGGGGG - Intronic
1138598788 16:58043152-58043174 CTGGGGCTGAGGGGTGTGTGCGG - Intronic
1138613510 16:58146168-58146190 CTGCATGTGGGATGTGTGTGAGG - Intergenic
1139428777 16:66900112-66900134 CTGGTGGAAGAGTGTGTGTGAGG - Intergenic
1139512694 16:67436400-67436422 CTGGGGGTGGGGTGGGGGTGGGG + Intronic
1139602250 16:67993751-67993773 CTGGTGCTGGGTTGTGTGGGTGG + Exonic
1140306110 16:73804871-73804893 TTGGTGTGGGTGTGTGTGTGTGG - Intergenic
1140768430 16:78181274-78181296 GTGGTGACGGTGTGTGTGTGGGG + Intronic
1141487396 16:84349817-84349839 TTGTAGGTGGGGAGTGTGTGCGG + Intergenic
1141624234 16:85253065-85253087 CTGGTGGGGGGGGGGGGGTGGGG - Intergenic
1141735767 16:85851564-85851586 GTGGTGATGGGGTGTGTGCAAGG - Intergenic
1141834355 16:86528825-86528847 CGTGTGGTGCGGTGGGTGTGCGG - Intergenic
1141858850 16:86703167-86703189 TGGGTGTGGGGGTGTGTGTGGGG - Intergenic
1141898328 16:86972764-86972786 CGGGTGGGTGGGTGGGTGTGTGG + Intergenic
1142214777 16:88825117-88825139 CTGGGGCTGGGGTGTCTGGGCGG + Intronic
1142214818 16:88825228-88825250 CTGGGGCTGGGGTGTCTGGGTGG + Intronic
1142234435 16:88915185-88915207 CAGGTGGTGGCGTGGGTGTGGGG + Intronic
1142248379 16:88980005-88980027 ATGGTGGATGGGTGTGTGGGTGG + Intergenic
1142248483 16:88980415-88980437 ATGGTGGATGGGTGTGTGGGTGG + Intergenic
1142253668 16:89003693-89003715 CTGATGGTGGGGCCTGGGTGTGG - Intergenic
1203122208 16_KI270728v1_random:1548360-1548382 CTGAATGTGGGGTGTGTGAGAGG - Intergenic
1142673636 17:1499734-1499756 CTGGAGGTGGGGTGTGTGTGTGG + Intronic
1143148930 17:4795121-4795143 ACGAGGGTGGGGTGTGTGTGTGG - Intergenic
1143283708 17:5773530-5773552 CTTGGGGTGGGGTGTGTGCGTGG + Intronic
1143576721 17:7798134-7798156 CTGGGGGTGGGGTGGGTGTGAGG - Intronic
1143758118 17:9081268-9081290 ATTGTTGTGGGGTGAGTGTGAGG + Intronic
1143762659 17:9116300-9116322 CTGGTGGGTGGGTGGGTGGGTGG - Intronic
1143846025 17:9773136-9773158 CTGGTGGTGTGATGTGATTGTGG + Intronic
1143864096 17:9911479-9911501 CTGGGGGTGGGGTGAGGTTGGGG - Intronic
1144008576 17:11123869-11123891 GTAGTGGTTGAGTGTGTGTGGGG - Intergenic
1144137769 17:12314687-12314709 CTGGTGGTGGTGGGAGTGTGGGG + Intergenic
1144753055 17:17663271-17663293 GTGGTGTTGAGCTGTGTGTGCGG - Intergenic
1144755967 17:17681133-17681155 CTAATGGTGGGGTGAGGGTGGGG + Intergenic
1145074250 17:19838179-19838201 GTGGGGGTGGGGTGGGGGTGGGG - Intronic
1145352341 17:22094222-22094244 CTGGTGTGTGTGTGTGTGTGTGG - Intergenic
1145792995 17:27639350-27639372 CTGGTGCTGGGGGGTGGGGGAGG - Intronic
1146572499 17:33964982-33965004 CTGGTGGCTGGGTGAGTGTTAGG + Intronic
1146661782 17:34669743-34669765 CTAGTGGTGGGGTGTTGGGGTGG - Intergenic
1146667719 17:34716004-34716026 GTGGTGGTGGGATGTGGGGGAGG - Intergenic
1146726918 17:35163926-35163948 CTGAGTGAGGGGTGTGTGTGAGG + Intronic
1147318446 17:39632181-39632203 CTTGTGGTGGGGGGAGTTTGGGG + Intronic
1147440533 17:40444433-40444455 ATGGTGGTGGGGTGTGTGTTGGG + Intronic
1147513694 17:41096036-41096058 CCAGGGGTGGGGTGTGTGGGAGG + Intronic
1147846399 17:43407064-43407086 ATGGGGGTGGGGTGTCTGTATGG - Intergenic
1148129866 17:45256229-45256251 CCGGTGAGGGGGTGTGTGTGTGG + Intronic
1148445471 17:47734454-47734476 GTGGTGGTGGTGTGTGTGTACGG + Intronic
1148454893 17:47805890-47805912 CAGGTGGTGGGGTGGGAGTGGGG + Intergenic
1149537836 17:57446146-57446168 AGTGGGGTGGGGTGTGTGTGAGG + Intronic
1149692251 17:58587849-58587871 CTGGTGGTGGAGCGGGGGTGGGG - Intronic
1149938675 17:60838401-60838423 GAGGTGGTGAGGTGGGTGTGGGG + Intronic
1150252397 17:63714146-63714168 CTGGGGGTGGGATGGGAGTGGGG + Intronic
1150814752 17:68384226-68384248 ATGAGGGTGGGGTGTGTGTGGGG + Intronic
1150855190 17:68745576-68745598 CAGGTCGTGGGGTGTGTTTTGGG - Intergenic
1151050547 17:70973630-70973652 GTGGTGGTGGGGTAGGTATGTGG - Intergenic
1151369724 17:73640247-73640269 GCGGGGGTGGGGTGTGTGTGTGG + Intronic
1151679801 17:75617228-75617250 CTGGTGGAGGTGGGGGTGTGTGG - Intergenic
1152068211 17:78122888-78122910 CTGGTGGTGGGGCAGGGGTGTGG - Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152343400 17:79737634-79737656 CCAGTGGGGAGGTGTGTGTGTGG - Intronic
1152436785 17:80281216-80281238 GTGTGAGTGGGGTGTGTGTGGGG - Intronic
1152436812 17:80281338-80281360 GTGTGAGTGGGGTGTGTGTGTGG - Intronic
1152503627 17:80730757-80730779 CTGGGGGTGGGGTTTGGGTGGGG + Intronic
1152670736 17:81604152-81604174 TTGGTGCTGAGGTGTGTCTGTGG + Intronic
1152671233 17:81608317-81608339 TTGCTGGGGTGGTGTGTGTGGGG + Intronic
1152695667 17:81792898-81792920 GTGTTTGTGGGGTGTGTGTGTGG - Intergenic
1152695673 17:81792958-81792980 GTGGGGGTGGGTGGTGTGTGTGG - Intergenic
1152695706 17:81793190-81793212 GTGTGTGTGGGGTGTGTGTGTGG - Intergenic
1152695707 17:81793201-81793223 GTGTTTGTGGGGTGTGTGTGGGG - Intergenic
1152699954 17:81813800-81813822 CTGGGGGTGGGGGGTAGGTGGGG - Exonic
1152726352 17:81948670-81948692 CGGATGGTGGTGTGTGTCTGGGG - Intergenic
1153061979 18:1004290-1004312 TTGGAGGTGGGGTTTGTGGGAGG - Intergenic
1153614297 18:6920452-6920474 GTGGTGGTGGCGTGTGGTTGTGG + Intergenic
1153709427 18:7783162-7783184 CTGGTAGTGGAGTGGGTGAGAGG + Intronic
1153838817 18:8988341-8988363 GTGCTGGTGGGCTGTGTGTGGGG + Intergenic
1153981309 18:10313037-10313059 GGGGTGGTGGGGTGTGTGGTGGG - Intergenic
1155221629 18:23690230-23690252 CTGGTGGAGGGGAAAGTGTGAGG + Intronic
1155347809 18:24875979-24876001 CTGAGGGAAGGGTGTGTGTGGGG - Intergenic
1156095820 18:33530877-33530899 CTGGTTGTGGGGTGCCTTTGTGG - Intergenic
1156506602 18:37599784-37599806 CTGGAGCTGGGGTTTCTGTGAGG - Intergenic
1157088334 18:44605241-44605263 AATGGGGTGGGGTGTGTGTGTGG - Intergenic
1157232022 18:45926312-45926334 CCGGGGGTGGGGTGAGTGGGAGG + Intronic
1157539075 18:48486415-48486437 ATGATGGAGGGGTGTGTCTGGGG + Intergenic
1157791446 18:50535238-50535260 GTGGTGTGGGGGTGTGTGTTGGG + Intergenic
1158063887 18:53381556-53381578 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1158560939 18:58513153-58513175 GTGGTGTGGGGGTGTGTGTGGGG + Intronic
1158722252 18:59935826-59935848 CTGGTGGTGGTGTGGCAGTGAGG + Intergenic
1159014746 18:63092164-63092186 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1159016190 18:63103365-63103387 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1159438409 18:68447117-68447139 CTGGTGGTCAGGGGTGTTTGGGG - Intergenic
1159905667 18:74089131-74089153 CCTGTCGAGGGGTGTGTGTGTGG - Intronic
1160380290 18:78449594-78449616 GTTGTGGTGGATTGTGTGTGTGG - Intergenic
1160400405 18:78606700-78606722 GTGGTGTGTGGGTGTGTGTGTGG - Intergenic
1160415045 18:78703895-78703917 TTGGAGGTGTGGTGTATGTGTGG + Intergenic
1160498469 18:79388974-79388996 CTGGTGGAGGGGGCAGTGTGTGG + Intergenic
1160605184 18:80044798-80044820 CAGGTCTTGGGGTGTTTGTGGGG + Intronic
1160632861 18:80258648-80258670 GTGTGGGTGGGGTGTGGGTGTGG + Intergenic
1160832302 19:1109611-1109633 GGGGTGGGGGGGTGTGAGTGTGG + Intronic
1161289957 19:3488354-3488376 CTGTTGGTGGGGTGTGCGGAAGG + Intergenic
1161291176 19:3494130-3494152 ATGTTGGTGGGGTGGATGTGTGG + Intronic
1161333414 19:3698957-3698979 ATGGTGGTGGGGTGGGAGAGCGG - Intronic
1161727154 19:5936169-5936191 CTGGAGCTGGGGTCTGTGCGTGG + Intronic
1161861528 19:6801690-6801712 CTGGTGCTGGGGTGGGGGTGGGG + Intronic
1161864197 19:6821905-6821927 CTGGGGGTGGAGGGTGTGGGGGG + Intronic
1161952466 19:7475546-7475568 CCAGTGGTTGTGTGTGTGTGTGG - Intergenic
1162120634 19:8464843-8464865 GTGTTGGAGGCGTGTGTGTGAGG - Intronic
1162182002 19:8876335-8876357 TTGGTGGTGCGCTGTGGGTGGGG + Intronic
1162373048 19:10290279-10290301 CTGGGGCTCGGGTGTGTGTTGGG - Intronic
1163205262 19:15797903-15797925 CTGGGTGTGGTGTGCGTGTGTGG + Intergenic
1163241923 19:16069673-16069695 TTTCTGTTGGGGTGTGTGTGTGG + Intronic
1163378072 19:16946352-16946374 CACGTGGGGGTGTGTGTGTGTGG + Intronic
1163475986 19:17526506-17526528 ATGGTGGTGGCGTGTGCCTGTGG + Intronic
1163490494 19:17614787-17614809 CTGGTGGCGGGGGGTGGGGGTGG - Intronic
1163642112 19:18467770-18467792 GTTGTGGGGGGTTGTGTGTGGGG - Intronic
1163779860 19:19240462-19240484 CTGGAGGTGGGCTGGGTGGGGGG - Intronic
1164130972 19:22361602-22361624 CTTGTTTTGTGGTGTGTGTGTGG - Intergenic
1164393599 19:27845708-27845730 GTGGTGGAGGGGGGTGTTTGAGG + Intergenic
1164449717 19:28350470-28350492 CTGGTGCTGGGGTGGATCTGGGG - Intergenic
1164571058 19:29374614-29374636 ACCCTGGTGGGGTGTGTGTGGGG - Intergenic
1164616928 19:29672885-29672907 CTGGTGGGCTGGTGTGTGTGTGG + Intronic
1164621432 19:29697958-29697980 CTGGTGGTGGGGTCTGTGGGTGG - Intergenic
1164758560 19:30709410-30709432 TTGGGGGTGGGGTGAGTGAGGGG - Intronic
1165096600 19:33413137-33413159 GTGGTGGTGGTGTGTCTATGTGG - Intronic
1165111770 19:33506774-33506796 TTTGTGATGGGGTGTGTGTGTGG - Intronic
1165246336 19:34500470-34500492 CTGGTGATGGGGTGGGTGGGAGG - Exonic
1165354827 19:35297327-35297349 TTTGTAGTGTGGTGTGTGTGTGG - Intronic
1165768871 19:38367049-38367071 CTGGTGGTGGTGTTTGTGGGAGG + Intronic
1165817189 19:38649345-38649367 GTGGTGAGTGGGTGTGTGTGGGG + Intronic
1165936807 19:39394264-39394286 TTGGTGGGGGGGTGTGGGGGAGG + Intronic
1166317071 19:41994982-41995004 GGGGTGGTGTTGTGTGTGTGAGG - Intronic
1166503571 19:43357695-43357717 CTTATTGTGGGCTGTGTGTGTGG - Intronic
1166506883 19:43377066-43377088 CTTATTGTGGGCTGTGTGTGTGG + Intergenic
1166627594 19:44373349-44373371 GTGGTGGTGCTGTGTGTGGGAGG - Intronic
1166659394 19:44636331-44636353 GTGGGGGTGAAGTGTGTGTGTGG - Intronic
1166677297 19:44747927-44747949 CTGGGGGTGGGGTGAGGGTGGGG - Intronic
1167013594 19:46825054-46825076 GTGGTGGTGGTGTTGGTGTGGGG - Intergenic
1167033400 19:46978497-46978519 GTGGTGGTGGCGTGTGTGATGGG + Intronic
1167033406 19:46978545-46978567 TGTGTGGTGAGGTGTGTGTGTGG + Intronic
1167033409 19:46978561-46978583 TGTGTGGTGGGATGTGTGTGTGG + Intronic
1167033439 19:46978676-46978698 TGTGTGGTGGGATGTGTGTGTGG + Intronic
1167033446 19:46978708-46978730 TGTGTGGTGGGATGTGTGTGTGG + Intronic
1167033473 19:46978840-46978862 TGTGTGGTGGGGTGTGTGTATGG + Intronic
1167033489 19:46978900-46978922 TGTGTGGTGGGGTGTGTGTGTGG + Intronic
1167483993 19:49749620-49749642 TTGGGGGAGGTGTGTGTGTGTGG + Intronic
1167649194 19:50720060-50720082 GTGGTCCTGAGGTGTGTGTGGGG - Intergenic
1167698145 19:51026712-51026734 CCCGGGGCGGGGTGTGTGTGAGG + Intronic
1168305798 19:55434519-55434541 GTGGTTGTGTGGTGTGTGTGTGG + Intronic
1168305850 19:55435030-55435052 GTGGCTGTGTGGTGTGTGTGTGG + Intronic
1168448423 19:56444468-56444490 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448457 19:56444634-56444656 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448473 19:56444717-56444739 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448489 19:56444800-56444822 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448506 19:56444883-56444905 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448522 19:56444966-56444988 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448538 19:56445049-56445071 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448555 19:56445132-56445154 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448570 19:56445215-56445237 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448621 19:56445466-56445488 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448707 19:56445885-56445907 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168448723 19:56445968-56445990 TTGGAGGTGGGGTCTGTGGGAGG - Intronic
1168578395 19:57533185-57533207 GTGGTGGTGAGGTGTGTCAGCGG + Intronic
1168717864 19:58539676-58539698 AGGGAAGTGGGGTGTGTGTGGGG - Intergenic
925001859 2:409597-409619 TTGCTGGTGGTGTTTGTGTGAGG - Intergenic
925025660 2:605181-605203 GTGGATGTGGTGTGTGTGTGTGG - Intergenic
925085594 2:1105212-1105234 GTGGGGGTGGGGTGAGTGTGGGG + Intronic
925104690 2:1281420-1281442 TGTGTGGTGTGGTGTGTGTGTGG + Intronic
925140705 2:1548114-1548136 GTGCAGGTGTGGTGTGTGTGTGG - Intergenic
925267058 2:2573324-2573346 CTCTAGGTGCGGTGTGTGTGTGG - Intergenic
925363486 2:3295565-3295587 CTGGATGGAGGGTGTGTGTGTGG - Intronic
925366471 2:3315237-3315259 GTGGTGGTAGGGGGTGTGTATGG - Intronic
925366483 2:3315274-3315296 ATGGTGGTAGGGGGTGTGTATGG - Intronic
925366495 2:3315311-3315333 GTGGTGGTAGGGGGTGTGTATGG - Intronic
925366649 2:3315756-3315778 ATGGTGGTAGGGGGTGTGTATGG - Intronic
925366660 2:3315790-3315812 ATGGTGGTAGGGGGTGTGTATGG - Intronic
925366672 2:3315827-3315849 GTGGTGGTAGGGGGTGTGTATGG - Intronic
925817505 2:7767878-7767900 GGTGTGGTGTGGTGTGTGTGTGG - Intergenic
925914758 2:8596768-8596790 ATGTTTGTGTGGTGTGTGTGTGG + Intergenic
925914763 2:8596804-8596826 GGTGTGGTGTGGTGTGTGTGTGG + Intergenic
926099201 2:10103296-10103318 CGGCTGGAGGGGTGGGTGTGGGG + Intergenic
926404486 2:12537078-12537100 CTGCTGGTGGTGTGTGTGTGGGG + Intergenic
926602898 2:14865186-14865208 GAGGTGGTGGGGTGAGTGGGGGG + Intergenic
926660306 2:15458376-15458398 CTGGAGGCGGGGTTTGGGTGGGG + Intronic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927245452 2:20953940-20953962 ATGTGTGTGGGGTGTGTGTGTGG + Intergenic
927475165 2:23408983-23409005 CTTGTTGGGGGGTGTGTGAGGGG + Intronic
927638582 2:24832951-24832973 TTGGTTGTGGGGCGTGAGTGTGG - Intronic
927686984 2:25178015-25178037 CTGGAGGTGGGGTGGGGGTGGGG - Intergenic
927803008 2:26118437-26118459 CCGGGGGTGGGGTGGGGGTGGGG + Intronic
927897187 2:26790671-26790693 CTGGTGGTGGGGAGGGAGGGAGG + Intronic
927912193 2:26907604-26907626 CTGATGGATGGGTGCGTGTGGGG - Intronic
928264566 2:29800740-29800762 TTGGTGGTTGGATGGGTGTGGGG - Intronic
928549717 2:32358031-32358053 GTGGGGGTGGGGTGGGGGTGGGG + Intronic
928914183 2:36454346-36454368 GTGGTGGTGAGGGGTGTGAGTGG - Intronic
929039496 2:37729862-37729884 GTGGTGGTGGTGTGTCTGTTAGG - Intronic
929558119 2:42938043-42938065 CTGTTGGTGGCGTGGGAGTGGGG - Intergenic
929664514 2:43823277-43823299 CTGGTGGTGGGGGCGGGGTGGGG - Intronic
929815260 2:45225576-45225598 CAGGGGGTGGGGTGGGAGTGGGG - Intergenic
931401122 2:61932607-61932629 TTGGTGGTGGGGTCTTTGGGAGG + Intronic
931580533 2:63767001-63767023 CTGGGGATGGGGTGAGGGTGGGG - Intronic
931794998 2:65700500-65700522 CTGGGGGTGGGGGGGCTGTGAGG - Intergenic
931807699 2:65823713-65823735 CTGGGAGTGGAATGTGTGTGAGG + Intergenic
931937403 2:67214355-67214377 CATGTGGAGGGGTGTGTGTGTGG - Intergenic
931979227 2:67676835-67676857 CTGGTGGTGGAGGTTTTGTGGGG - Intergenic
932140571 2:69273681-69273703 GGGGTGGAGGGGTGTGGGTGGGG - Intergenic
932187569 2:69712168-69712190 GTGGTGGTGGGGTGGGGTTGGGG - Intronic
932336156 2:70932627-70932649 GTGGGGGTGGGGTGTGAGGGTGG - Intronic
932423975 2:71617657-71617679 GCAGAGGTGGGGTGTGTGTGTGG + Intronic
932423985 2:71617705-71617727 GTAGAGGTGGGGTGTGTGTGTGG + Intronic
932424019 2:71617903-71617925 GTGGTAGAGGTGTGTGTGTGTGG + Intronic
932424039 2:71618059-71618081 GTAGAGATGGGGTGTGTGTGTGG + Intronic
932424043 2:71618081-71618103 GTAGAGATGGGGTGTGTGTGTGG + Intronic
932424048 2:71618103-71618125 GTAGAGGTGGGGTGTGTGTGTGG + Intronic
932424067 2:71618221-71618243 GTAGAGGTGGGGTGTGTGTGTGG + Intronic
932424072 2:71618258-71618280 GTGGTAGAGGTGTGTGTGTGTGG + Intronic
932424081 2:71618321-71618343 GTAGAGATGGGGTGTGTGTGTGG + Intronic
932424085 2:71618340-71618362 GTGGTAGAGGGGTGTGTGTGTGG + Intronic
932461326 2:71883752-71883774 CTGGTGGGAGGGGGTGTTTGTGG - Intergenic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
933525634 2:83434979-83435001 CTGGTGATCGTGTATGTGTGTGG - Intergenic
934459087 2:94201330-94201352 CTGAATGTGGGGTGTGTGAGAGG - Intergenic
934766097 2:96880943-96880965 CTGGGTTTGGGGTGGGTGTGAGG + Intronic
934768674 2:96894626-96894648 CTGTGGGTGGGGGGTCTGTGGGG - Intronic
934997141 2:98974248-98974270 CTGATGGAAGTGTGTGTGTGGGG - Intergenic
935218600 2:100993378-100993400 CTGTTGGCGGGGTGTGCGTCTGG - Exonic
935306784 2:101744588-101744610 CTTGGGTTGGGGGGTGTGTGAGG + Intronic
935319443 2:101871648-101871670 CTTGTCCTGGGGTGTCTGTGGGG - Intronic
935713281 2:105917879-105917901 TTGGCGGTGGGGAGTATGTGTGG - Intergenic
936114433 2:109690766-109690788 CTGGGGGTGGGGTGTGTTGGGGG + Intergenic
936656645 2:114496148-114496170 GTGGTGGTGGGGTGGGAGTGGGG + Intronic
937213290 2:120292240-120292262 AGGGTGGGGGAGTGTGTGTGGGG + Intronic
937373847 2:121321808-121321830 CTGCTCGTGGGGTGTTTGTGGGG - Intergenic
937390115 2:121478674-121478696 GTGTGTGTGGGGTGTGTGTGTGG - Intronic
937390124 2:121478729-121478751 GTGTGTGTGGGGTGTGTGTGTGG - Intronic
937390132 2:121478771-121478793 GTGTGTGTGGGGTGTGTGTGTGG - Intronic
937390137 2:121478800-121478822 TTGTGTGTGGGGTGTGTGTGTGG - Intronic
937390146 2:121478860-121478882 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
937437243 2:121890578-121890600 CTGGGGGTGGGGAGAGGGTGGGG - Intergenic
937825589 2:126365400-126365422 GAGGGGATGGGGTGTGTGTGTGG + Intergenic
937825592 2:126365413-126365435 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
937906040 2:127053301-127053323 CTGCGTGTGGGGGGTGTGTGGGG + Intronic
938066379 2:128284060-128284082 CTGGAAGTGGGGTGAGGGTGGGG - Intronic
939019284 2:136939873-136939895 CTGGTGGTGGTGTGTGTCGGGGG - Intronic
939096249 2:137836794-137836816 CTGGGGGTGGTGAATGTGTGAGG - Intergenic
939440687 2:142245353-142245375 CTCGGGGTGGGGTGAGTGTGGGG + Intergenic
939573593 2:143869337-143869359 TTGCTGGTGGGGTGGGGGTGGGG - Intergenic
940120468 2:150258882-150258904 CAAGTTGTGGGATGTGTGTGAGG + Intergenic
940312364 2:152292112-152292134 ATGGTGGTGGGGTGGGGGTGAGG - Intergenic
940394191 2:153168534-153168556 TGTGTGGAGGGGTGTGTGTGTGG + Intergenic
941551963 2:166927780-166927802 TTGGTGGGGATGTGTGTGTGGGG + Intronic
942077345 2:172368065-172368087 ATGGTGGGGGGGTGGGGGTGGGG - Intergenic
942243072 2:173981805-173981827 TTGGTAGTGGGGTGGGAGTGGGG - Intergenic
942277626 2:174334619-174334641 CTCGGGGTGGTTTGTGTGTGGGG + Intergenic
942546681 2:177072120-177072142 CTGTGGCGGGGGTGTGTGTGTGG + Intergenic
942546683 2:177072122-177072144 GTGGCGGGGGTGTGTGTGTGGGG + Intergenic
943515878 2:188885798-188885820 TTGGAGGTGGGGTGTTTGGGGGG + Intergenic
943656354 2:190512909-190512931 CTGGTGACTGTGTGTGTGTGTGG - Intronic
943745661 2:191460366-191460388 ATGGTAGTGGGGTGTGTGTGTGG - Intergenic
944045192 2:195403220-195403242 CCTGTGGTGGCGTGTGTTTGCGG - Intergenic
944053192 2:195495013-195495035 CTGTTGGGGGTGTGTGTGGGTGG - Intergenic
944298406 2:198093553-198093575 CTAGTGGTGTGGTTGGTGTGGGG + Intronic
944428567 2:199609315-199609337 CTGGGGGTGGGGTTTGGGGGAGG - Intergenic
944662121 2:201929876-201929898 CTGTGTGTGGTGTGTGTGTGTGG - Intergenic
944668026 2:201972907-201972929 CTGGAGGAGGGGTGGGGGTGGGG - Intergenic
946188299 2:217994136-217994158 CTGGGGCTGGGGTGAGGGTGGGG + Intronic
946312013 2:218887264-218887286 GTGGTGGCAGTGTGTGTGTGTGG + Intronic
946365445 2:219246075-219246097 CTGGGGGAGGGGTGAGTGTTTGG + Exonic
946431286 2:219628336-219628358 TTGGAGTTGGGGTGGGTGTGGGG + Intronic
947110624 2:226715544-226715566 TATGTGGTGGAGTGTGTGTGTGG + Intergenic
947180663 2:227408451-227408473 GTGGTGGTGGGTTGGGGGTGGGG + Intergenic
947552622 2:231057267-231057289 CTGGCGCTGGGGTGTGATTGGGG - Intronic
947592446 2:231393409-231393431 CTGATGGTGGGGTGGGGGTGGGG - Intergenic
947821668 2:233075757-233075779 GGGCTGATGGGGTGTGTGTGGGG + Intronic
947868687 2:233419870-233419892 TTTGTGGAGGGGTGTGTGTTGGG + Intronic
947994414 2:234515228-234515250 TTTGTGATGGGGTGTATGTGTGG + Intergenic
948079075 2:235190645-235190667 CTGGGGGTGAGGTGTGCGTTTGG + Intergenic
948111044 2:235456312-235456334 CTGGGGGTGGGGTCTGAATGAGG - Intergenic
948316566 2:237031880-237031902 CTGCTGGCGGTGTGTGTGTGAGG - Intergenic
948563768 2:238870819-238870841 GTGGGGGTGTGGTGTGTGTGGGG - Intronic
948563889 2:238871405-238871427 GTGGGGTTGTGGTGTGTGTGGGG - Intronic
948596820 2:239084791-239084813 TGGGGTGTGGGGTGTGTGTGGGG - Intronic
948818931 2:240528679-240528701 CTGGTGGGGGGATGTGGCTGGGG - Intronic
949072840 2:242036407-242036429 CAGGTCCTGGGGTGAGTGTGTGG + Intergenic
1169141820 20:3230902-3230924 CTGGCGGTGGGCGGTGGGTGGGG - Intronic
1169157019 20:3340434-3340456 GTGGGGGTGGGGTGGGTGGGGGG - Intronic
1169217090 20:3800222-3800244 CTGGTGCTGGGGTGGGTGATGGG + Intronic
1169331864 20:4722666-4722688 AGGGTGGTGGAGGGTGTGTGAGG + Intronic
1169404923 20:5315172-5315194 GTGGTGGTGGGGTGGGGGAGGGG + Intergenic
1169465843 20:5837459-5837481 TTGGAGGTGGGGGGTGTGTGGGG - Intronic
1169913058 20:10662740-10662762 GCCGTGGGGGGGTGTGTGTGGGG - Intronic
1170194838 20:13679408-13679430 CTGGTGGTGGGAGGTGGGGGTGG + Intergenic
1170428531 20:16258237-16258259 TTGGGGATGGGGTGTGTGTTTGG - Intergenic
1170762846 20:19265930-19265952 CTGGTGGTGCAGTGGGTGGGTGG + Intronic
1170765059 20:19282785-19282807 CTGTTGCTGGGGTGTGTTTTGGG + Intronic
1170863113 20:20127627-20127649 TTGGTGGTGGGGTCGGGGTGGGG + Intronic
1170979263 20:21195853-21195875 CTGCTGGTGGGGTGGGGCTGTGG - Intronic
1171071314 20:22071048-22071070 AAGGGGGTGGGGTGGGTGTGGGG - Intergenic
1171109983 20:22471891-22471913 GTGGTGGAGATGTGTGTGTGTGG - Intergenic
1171360840 20:24585313-24585335 GTGCTGGTGTTGTGTGTGTGGGG + Intronic
1171388174 20:24784254-24784276 CTGGTGGTCACGTCTGTGTGTGG - Intergenic
1171401575 20:24875941-24875963 CAGGGGCTGGGGTGGGTGTGAGG - Intergenic
1171414417 20:24967975-24967997 CTGTTGCTGGGCTGTGTGTCTGG - Intronic
1171755627 20:29105605-29105627 ATGGTGGTGGCGTGTGCCTGTGG + Intergenic
1171869378 20:30513394-30513416 CTGGTGGTGGCGTGTGGGGGAGG - Intergenic
1171993670 20:31715976-31715998 TTGGTGGTGGCGTGTGTCTGTGG - Intronic
1172020191 20:31908568-31908590 CTGGGGGTGGGGTGGGGGCGGGG - Intronic
1172082550 20:32353717-32353739 GGGGTGGTGGGATGTGTCTGTGG + Intergenic
1172106148 20:32518357-32518379 CTGGGGGTGGGGTGTGGTGGTGG + Intronic
1172144111 20:32744180-32744202 GTGGTGGTGAGGTGGGTGAGGGG + Intergenic
1172221142 20:33275956-33275978 CTGGAGATGGGGTGGGGGTGGGG + Intronic
1172457709 20:35091132-35091154 ATGGTGGTGGTGTGTGCCTGTGG - Intronic
1172597194 20:36157585-36157607 CAGGTGGAGAGGTGTGTGAGGGG + Intronic
1172620371 20:36314349-36314371 TGTGTGGTGTGGTGTGTGTGTGG + Intronic
1172777480 20:37415939-37415961 CTTGTGTTGGGGTGTGTGTGTGG + Intergenic
1172850060 20:37955397-37955419 GTGGTGGTGGGGTGGGGTTGAGG - Intergenic
1172904125 20:38356225-38356247 CTGTGTGTAGGGTGTGTGTGTGG - Intronic
1172937008 20:38627624-38627646 TGTGTGTTGGGGTGTGTGTGGGG + Intronic
1173150410 20:40562164-40562186 CTGGGGGTGGGGTCAGGGTGGGG + Intergenic
1173485567 20:43438568-43438590 GGGGTGTGGGGGTGTGTGTGTGG - Intergenic
1173596315 20:44260792-44260814 ATGGTCGTGGTGTGTGTCTGGGG + Intronic
1173974830 20:47179311-47179333 CTGATGGGTGGGTGGGTGTGTGG + Intronic
1174136821 20:48385529-48385551 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1174136890 20:48385944-48385966 GTGGCGGGGGGGTGTGTGTTGGG + Intergenic
1174276397 20:49407656-49407678 CTGGGTGGGGGTTGTGTGTGGGG + Intronic
1174354386 20:49988438-49988460 CTTGTGGGGGGGTGTGTGTGAGG - Exonic
1174390136 20:50213920-50213942 TGGGAGGTGGTGTGTGTGTGTGG + Intergenic
1174540130 20:51282728-51282750 ATGGGGTTGGGGTGTGTGAGGGG - Intergenic
1174541588 20:51293727-51293749 TTGGAGGTGGGGTGGGTGGGTGG - Intergenic
1174700689 20:52605388-52605410 CTTGTGGTGGTGTGTGCCTGTGG + Intergenic
1175172560 20:57090784-57090806 CGGGTGGAGGTGTGTGTGCGTGG - Intergenic
1175172612 20:57091009-57091031 CGGGTGGAGGCGTGTGTGGGTGG - Intergenic
1175172633 20:57091094-57091116 TGGGTGGAGGTGTGTGTGTGTGG - Intergenic
1175172651 20:57091180-57091202 CGGGTGGAGGTGTGTGTGTGTGG - Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175428070 20:58882705-58882727 ATGGTGGTGGGGTGGAGGTGGGG + Intronic
1175430776 20:58901567-58901589 TTAGTGGTGGGGGGTGTCTGGGG - Intronic
1175669528 20:60890102-60890124 CTGGGCTTGGGGGGTGTGTGGGG - Intergenic
1175793189 20:61755288-61755310 CTGTGTGTGTGGTGTGTGTGGGG - Intronic
1175804231 20:61818536-61818558 ATGGTGGTGGTGTGTGCCTGTGG + Intronic
1175817903 20:61893164-61893186 ATGGTGGTTGGGTGGGTGGGTGG + Intronic
1175817945 20:61893322-61893344 ATGGTGGTTGGGTGGGTGGGTGG + Intronic
1176039652 20:63058702-63058724 CTGTTGGTGTGGTGTGTTTGAGG - Intergenic
1176089744 20:63313523-63313545 CAGGTGGCGTGGTGTGGGTGTGG + Intronic
1176366868 21:6038559-6038581 GTGGTGTGTGGGTGTGTGTGTGG + Intergenic
1176426470 21:6551566-6551588 TAGGTGGTGGGGTGTGTGTGTGG - Intergenic
1176514450 21:7773785-7773807 CTGGTGATGGGGGCTGGGTGTGG + Intergenic
1176548366 21:8211552-8211574 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
1176556258 21:8255758-8255780 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
1176567297 21:8394587-8394609 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
1176575197 21:8438800-8438822 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
1176795412 21:13368263-13368285 CAGGTGGGGGTGTGTGGGTGGGG + Intergenic
1176795421 21:13368291-13368313 CAGGTGGGGGTGTGTGGGTGAGG + Intergenic
1178599712 21:33985106-33985128 TGTGTGGTGTGGTGTGTGTGTGG - Intergenic
1178648563 21:34404309-34404331 CTGGTGATGGGGGCTGGGTGTGG + Intronic
1179030678 21:37717316-37717338 CTGGAGGTGGGGTGGGTGTATGG + Intronic
1179030689 21:37717366-37717388 CTGGAGTTAGGGTGGGTGTGTGG + Intronic
1179030704 21:37717416-37717438 CTGGAGATGGGGTGGGTGTATGG + Intronic
1179043214 21:37823170-37823192 CTGGTGTTGGGGTGGCCGTGGGG - Intronic
1179105384 21:38395914-38395936 GTGGCGGTGTGGGGTGTGTGGGG - Intronic
1179231887 21:39511480-39511502 ATGTGTGTGGGGTGTGTGTGTGG + Intronic
1179304188 21:40139951-40139973 ATGTTTGTGAGGTGTGTGTGTGG + Intronic
1179358798 21:40686259-40686281 ATGTGTGTGGGGTGTGTGTGTGG - Intronic
1179360487 21:40703542-40703564 CTGTTGGGTGTGTGTGTGTGTGG - Intronic
1179391155 21:40992858-40992880 GTGTTTGTGTGGTGTGTGTGTGG - Intergenic
1179391160 21:40992941-40992963 GTGTTTGTGTGGTGTGTGTGTGG - Intergenic
1179391179 21:40993194-40993216 GTGTTCGTGTGGTGTGTGTGTGG - Intergenic
1179404378 21:41113128-41113150 TTGGTGGAGAGGTGTGTGGGGGG + Intergenic
1179412026 21:41168995-41169017 ATGGTGGTGGGGTGGGGGGGGGG - Intronic
1179504208 21:41829555-41829577 CTGTTTGTGGGTTGTGTATGTGG - Intronic
1179522628 21:41954748-41954770 CATGTGGTGTGGTGCGTGTGTGG + Intergenic
1179522647 21:41954963-41954985 CATGTGGTGTGGTGCGTGTGTGG + Intergenic
1179532063 21:42026430-42026452 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1179532191 21:42027457-42027479 GTGGTTGTGGTGTGTGTGTAGGG + Intergenic
1179556749 21:42183431-42183453 TATGTGGTGGGGTGTGTGTGTGG + Intergenic
1179556783 21:42183824-42183846 TGTGTGGTGGTGTGTGTGTGAGG + Intergenic
1179595434 21:42439983-42440005 GTGGTGTGTGGGTGTGTGTGGGG - Intronic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179663173 21:42891488-42891510 CTGGTGGTGGTGTGGAAGTGGGG + Intronic
1179701961 21:43159883-43159905 TAGGTGGTGGGGTGTGTGTGTGG - Intronic
1179756650 21:43499985-43500007 GTGGTGTGTGGGTGTGTGTGTGG - Intergenic
1179769592 21:43604657-43604679 TGTGTGGTGGTGTGTGTGTGTGG - Intronic
1179769650 21:43605290-43605312 CAGCTGGTGTGTTGTGTGTGGGG - Intronic
1179824956 21:43958899-43958921 GTGGTGGGGTGGTGTGTGTGTGG + Intronic
1179824987 21:43959222-43959244 TTTGTGATGTGGTGTGTGTGTGG + Intronic
1179886033 21:44314602-44314624 CTGGTGGGGAGGGGTGTGTCTGG + Intronic
1179929134 21:44555659-44555681 AGGGGGGTGGGATGTGTGTGTGG - Intronic
1179939539 21:44628732-44628754 CGGGCGGTGGGGGGTGGGTGTGG + Intronic
1180213087 21:46307448-46307470 CTGAGGTAGGGGTGTGTGTGTGG - Intronic
1180257717 21:46644359-46644381 TTGGTGGTGGGGTGAGCGTGCGG + Exonic
1180296005 22:10936531-10936553 ATGGTGGTGGCGTGTGCCTGTGG - Intergenic
1180606373 22:17061910-17061932 CAGGTGGTGGGGACGGTGTGAGG - Intergenic
1180666733 22:17519187-17519209 CTGGTGGTGGGGAGTGGGGAGGG + Intronic
1180840005 22:18954809-18954831 CTGGTGCTGGGGTGGGTGGCAGG - Intergenic
1181025110 22:20123424-20123446 GTGGTGTTGGGGGGGGTGTGTGG + Intronic
1181027369 22:20133804-20133826 CAGGAGATGGGGGGTGTGTGGGG - Intronic
1181061895 22:20285671-20285693 CTGGTGCTGGGGTGGGTGGCAGG + Intergenic
1181168484 22:20995527-20995549 TGGGTGGTGGGCTGTGCGTGGGG + Intronic
1181285927 22:21752483-21752505 ATGGTGCAGGGGTGGGTGTGTGG + Intergenic
1181338725 22:22161879-22161901 CTGCTGGTGGGGGCTCTGTGCGG + Intergenic
1181453332 22:23038348-23038370 CTGGTGGTGTGGTGTCGGGGAGG + Intergenic
1181458771 22:23074066-23074088 CTGGTGCAGGAGTGTGGGTGGGG + Intronic
1181911238 22:26239909-26239931 CGGGTGGAGGGGGCTGTGTGCGG - Intronic
1182069245 22:27452009-27452031 CAGGTGGTTGGATGTGTGGGTGG + Intergenic
1182094580 22:27617412-27617434 CTGGTGAATGGGTGTGTATGGGG - Intergenic
1182345229 22:29658602-29658624 ATGGGGGTGGGGTGTGTGTTGGG - Intronic
1182517432 22:30867042-30867064 CTTGAGGGGTGGTGTGTGTGTGG + Intronic
1182668343 22:31975031-31975053 CTGGTGGAGGGATGTGGGTAGGG + Intergenic
1182673277 22:32016219-32016241 CTGTTGGTGGGGAGTGGCTGGGG + Intergenic
1182894792 22:33850195-33850217 CTGGTGGTAGGGCCTGGGTGTGG - Intronic
1182951368 22:34379368-34379390 ATGGTGGGACGGTGTGTGTGGGG + Intergenic
1183021386 22:35030114-35030136 CTTCTGGTGGGGTTTTTGTGTGG + Intergenic
1183063527 22:35349266-35349288 CAGGCAGTGGGGTGTGGGTGGGG - Intergenic
1183247936 22:36708309-36708331 CAGGTTGGGGTGTGTGTGTGGGG + Intergenic
1183276558 22:36901651-36901673 CTGCTGGTGAGATGTGTGTTGGG + Intergenic
1183554064 22:38511437-38511459 GGTGTGGTGGTGTGTGTGTGTGG + Intergenic
1183606330 22:38868586-38868608 CAGAGGCTGGGGTGTGTGTGGGG + Intronic
1183667013 22:39252048-39252070 CTGATTGTGGGGAGTGTGTGCGG + Intergenic
1183723276 22:39574469-39574491 CTTGGGATGGGGTGCGTGTGTGG + Intronic
1184099937 22:42336665-42336687 ATGGTGGATAGGTGTGTGTGTGG - Intronic
1184148937 22:42627537-42627559 GTGGGGTTGGGGTGTGGGTGAGG - Intronic
1184239693 22:43205651-43205673 GTGGGTGTGTGGTGTGTGTGGGG - Intronic
1184239709 22:43205723-43205745 GTGGGCGTGTGGTGTGTGTGGGG - Intronic
1184239723 22:43205791-43205813 GTGGGTGTGTGGTGTGTGTGGGG - Intronic
1184239731 22:43205825-43205847 GTGGGTGTGTGGTGTGTGTGGGG - Intronic
1184239815 22:43206169-43206191 GTGGGGGTGTGGTGGGTGTGTGG - Intronic
1184279004 22:43426600-43426622 GGCCTGGTGGGGTGTGTGTGAGG + Intronic
1184382550 22:44154858-44154880 GTGGTGGGGGTGTGTGTGTGTGG + Intronic
1184399638 22:44266431-44266453 GTGTTGGGGGGTTGTGTGTGTGG + Intronic
1184457244 22:44618203-44618225 CTAGGTGTGTGGTGTGTGTGTGG - Intergenic
1184521222 22:44995394-44995416 CTGGGGCTGGAGTGTGTGGGGGG + Intronic
1184562995 22:45274181-45274203 CTGGAGGTGGGGTGAGAGTGAGG - Intergenic
1184664529 22:45980907-45980929 TTGTTTGTGTGGTGTGTGTGTGG + Intergenic
1184687498 22:46103283-46103305 CTGGCAGAGGGGTGTTTGTGGGG - Intronic
1184688681 22:46107777-46107799 CGTGTTGTGGGGTGTGTGCGGGG - Intronic
1184786305 22:46673581-46673603 CTTTTGGGGAGGTGTGTGTGCGG + Intronic
1184916722 22:47574541-47574563 CTCATGGTGGGGGGTGGGTGGGG + Intergenic
1184924620 22:47628245-47628267 ATGTTGTGGGGGTGTGTGTGTGG + Intergenic
1184946883 22:47810008-47810030 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1185056723 22:48583415-48583437 CTGTGTGTGTGGTGTGTGTGTGG - Intronic
1185056814 22:48584588-48584610 TGTGTGGTGTGGTGTGTGTGAGG - Intronic
1185117445 22:48945765-48945787 CACGTGGAGGTGTGTGTGTGAGG + Intergenic
1185151231 22:49164863-49164885 CTGGGGGAGGGCTGTGGGTGGGG - Intergenic
1185350933 22:50337684-50337706 TATGTGGTGTGGTGTGTGTGCGG + Intergenic
1185351137 22:50339749-50339771 GTGGTGGTGTGTGGTGTGTGTGG + Intergenic
1185351152 22:50339868-50339890 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1203253246 22_KI270733v1_random:127855-127877 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
949883352 3:8677819-8677841 CTGGTGGTGGAGTGGGTGTGTGG - Intronic
950116485 3:10453864-10453886 CAGGTGGATGGGTGGGTGTGTGG - Intronic
950136829 3:10586982-10587004 CTGGTGGTGCTAAGTGTGTGAGG - Intronic
950275712 3:11658950-11658972 CTGGAGGTGCTGTATGTGTGTGG - Intronic
950380820 3:12613421-12613443 CTGGGGGCGGGGTGTGGGGGGGG - Intronic
950429964 3:12945004-12945026 CTGATGGTTGGGGGTGAGTGAGG + Intronic
950473356 3:13199887-13199909 CTGTTTGTTGTGTGTGTGTGTGG - Intergenic
950553821 3:13683352-13683374 CTGGATGTGAGTTGTGTGTGTGG - Intergenic
950693575 3:14680518-14680540 CTGATGATGGGTTTTGTGTGGGG + Intronic
950758338 3:15196922-15196944 CTGTGCGTTGGGTGTGTGTGTGG - Intergenic
951274817 3:20672334-20672356 CTTTGGGTGGGGTGTGTGTTGGG - Intergenic
951543532 3:23805748-23805770 CTGGGGTGGGGGTGTCTGTGGGG + Intergenic
951645953 3:24891641-24891663 CTGATAGTGTGGAGTGTGTGGGG + Intergenic
951806193 3:26646789-26646811 CAGATGGTAGGGTGTGGGTGAGG + Intronic
951867657 3:27325634-27325656 CTTGGGGTGGAGTGTGAGTGGGG - Intronic
952043237 3:29285249-29285271 GTGGTGGTGGGGAGTAGGTGGGG + Intronic
952065656 3:29566737-29566759 CTGGTTGCTGGGGGTGTGTGTGG + Intronic
952155818 3:30642296-30642318 GTGGTGGTGGGGTGGGAGTGGGG + Intronic
952557235 3:34546578-34546600 GTGGTGGTGAGGGGTGTTTGAGG + Intergenic
952575573 3:34770111-34770133 CTGGAGGTGGGGTGGGGGTAGGG + Intergenic
954405869 3:50344810-50344832 CTGGTGGTGGGGAAGGGGTGGGG - Intronic
954886869 3:53882272-53882294 CTGGGGGCGGGGTGTGCATGCGG + Intergenic
954932272 3:54294556-54294578 CTGGTGGTGTGGGGAGTGTGTGG + Intronic
955042014 3:55327070-55327092 CTGGGGGCGGGGTGGGGGTGGGG - Intergenic
955225589 3:57057609-57057631 CTTGTGTGGGGGTGTGGGTGTGG - Intronic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
955562742 3:60209931-60209953 TTGGGGGTGGAGGGTGTGTGGGG + Intronic
955592474 3:60552475-60552497 CTGGGAGTGGGGTGTTGGTGAGG - Intronic
955897822 3:63719374-63719396 CTGATAGTGGGGTGAGTTTGAGG + Intergenic
955986005 3:64574742-64574764 GTGGTTGGGGTGTGTGTGTGGGG - Intronic
956749988 3:72337679-72337701 GTGATTGTGTGGTGTGTGTGTGG + Intergenic
957171461 3:76742784-76742806 TGGGTGGGTGGGTGTGTGTGTGG - Intronic
959024839 3:101229324-101229346 CTACTGCTGGTGTGTGTGTGGGG - Intronic
959051861 3:101532076-101532098 GTGGAGGTGGGGTGGGGGTGGGG - Intergenic
959259484 3:104057009-104057031 CTGGAGGTGGGGTGTGGTGGAGG + Intergenic
959733564 3:109631594-109631616 CAGGTGGTAGAGTGGGTGTGGGG + Intergenic
960551272 3:118978419-118978441 GCGGTGGTGGGCTGTGTGGGTGG - Intronic
960579943 3:119268158-119268180 CTTTTGGTGGGGTTTTTGTGTGG - Intergenic
961034932 3:123635527-123635549 AGGGAGGAGGGGTGTGTGTGTGG - Intronic
961393728 3:126571496-126571518 CTGGTGGTGGGGGCGGTGGGGGG + Intergenic
961635852 3:128331801-128331823 CAGGTGCTGGGGAGGGTGTGGGG + Intronic
961967957 3:130925801-130925823 CGGGGGGTGGGGTGAGGGTGTGG + Intronic
962143019 3:132810471-132810493 CTGGAGATGGGGTGTGGGTGAGG - Intergenic
962149933 3:132881834-132881856 GTGTTTGTGTGGTGTGTGTGGGG + Intergenic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962367759 3:134797080-134797102 CTGGTGGCGGCGTGGGGGTGCGG + Intronic
962455896 3:135565335-135565357 CTGGTGGTGTGGTTTGTTTGGGG - Intergenic
962626929 3:137235085-137235107 CTGGAAGTGGTATGTGTGTGTGG + Intergenic
962692488 3:137913276-137913298 CTGTTGGTGGGTTGGGGGTGAGG + Intergenic
962736272 3:138328344-138328366 CTGGGGGTGGGAGGGGTGTGGGG - Intronic
962949595 3:140205627-140205649 CAGGTGGCTGTGTGTGTGTGTGG - Intronic
963075858 3:141345699-141345721 GTGGTGCATGGGTGTGTGTGTGG + Intronic
964304494 3:155326052-155326074 GTGGAGGTGGGGTGGGGGTGTGG - Intergenic
964392591 3:156213095-156213117 CTGGTGATGGGCTGAGTATGGGG + Intronic
964917022 3:161851584-161851606 CTGATGGTGGAGAGTGAGTGAGG + Intergenic
964949586 3:162273387-162273409 TTGGAGGGGGTGTGTGTGTGTGG + Intergenic
965469936 3:169078307-169078329 CTGGTTCTGGGTTGTGTATGAGG + Intergenic
965597252 3:170421145-170421167 CTGGGGGTGGGGGGGGGGTGGGG + Intronic
965813584 3:172615067-172615089 CTTGAGGTGGGGTGGGGGTGTGG + Intergenic
966839526 3:184077364-184077386 CCAGAGGTGGGGTGTGGGTGAGG + Intergenic
966873844 3:184309999-184310021 TTGGTGGTGGAGGGTGAGTGTGG - Intronic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
967035565 3:185646261-185646283 CTGGGCGGGGGGTGCGTGTGTGG + Intronic
967089746 3:186125451-186125473 GTGGTGTGGGGGGGTGTGTGTGG + Intronic
967089838 3:186126099-186126121 ATGTTTGTGTGGTGTGTGTGTGG + Intronic
967089872 3:186126323-186126345 ATGTTTGTGTGGTGTGTGTGTGG + Intronic
967464585 3:189789358-189789380 GTGGTGGTGCGGTTTGTTTGGGG + Intronic
967884999 3:194327411-194327433 GTGGTTGTGTGTTGTGTGTGCGG - Intergenic
967885001 3:194327454-194327476 GTGGTTGTGTGGTGTGTGTGGGG - Intergenic
967988037 3:195110261-195110283 GTGGGTGTGTGGTGTGTGTGGGG + Intronic
969176223 4:5400901-5400923 ATGGTGTTGGGGAGAGTGTGGGG + Intronic
969299887 4:6291561-6291583 CTAGTGGTGAGGTGTGTGGGTGG + Intronic
969352019 4:6603530-6603552 GTGGGGAAGGGGTGTGTGTGGGG - Intronic
969523118 4:7690328-7690350 CGGGTGGGTGGGTGGGTGTGTGG + Intronic
969665708 4:8556308-8556330 GGTGTGGAGGGGTGTGTGTGTGG - Intergenic
969683041 4:8653653-8653675 CAGGTGGTGGGGGGTGTGACGGG + Intergenic
971327904 4:25658905-25658927 GTGGGGGTGGGGTGGGTGGGTGG - Intronic
971954153 4:33394283-33394305 TGGGGGGTGGGGGGTGTGTGGGG + Intergenic
972370319 4:38417211-38417233 CTGGAGGTGGAGTCTGTGGGAGG - Intergenic
972669826 4:41204532-41204554 TTGGGTGTGGGGAGTGTGTGGGG - Intronic
973320656 4:48807041-48807063 CTGTTGGTGGTGTGTGCCTGTGG - Intronic
973567128 4:52199790-52199812 GTGGTGTGGTGGTGTGTGTGTGG + Intergenic
973862327 4:55077778-55077800 GTGGGGGGTGGGTGTGTGTGGGG + Intergenic
974510550 4:62834789-62834811 CTGGTGGTGGGGGTTGAGGGAGG - Intergenic
975530872 4:75397846-75397868 GTGGTGGTGGAGGGAGTGTGTGG - Intergenic
975798761 4:78036452-78036474 ATGGAGGTGGGGTGAGGGTGGGG + Intergenic
975917561 4:79342832-79342854 CTGATTGTGGGGTGGGGGTGGGG - Intergenic
976053449 4:81033937-81033959 CAGGTGGTGTGCTGTGTATGGGG + Intronic
976114966 4:81716202-81716224 CTTGGGGTGGGGTTTTTGTGTGG - Intronic
976627639 4:87204227-87204249 ATGGTTGTGGGGTGTGTGTATGG - Intronic
976663735 4:87567808-87567830 CTGATTGGGGTGTGTGTGTGGGG - Intergenic
977563336 4:98556022-98556044 GTGGGGGTGCTGTGTGTGTGGGG - Intronic
977564623 4:98568528-98568550 TTGGTGGTGGGCTGGGGGTGGGG - Intronic
978407709 4:108397408-108397430 ATGAGTGTGGGGTGTGTGTGTGG - Intergenic
978582904 4:110249894-110249916 GTGGTGGTGGTTTGTGGGTGAGG + Intergenic
979523179 4:121691533-121691555 CTGGAGGTGGGGGGAGGGTGCGG - Intronic
979761901 4:124416463-124416485 GTGGTGATGGGGTGTGGATGGGG + Intergenic
979963852 4:127053679-127053701 CCTGTGGAGGGGTGTGGGTGAGG - Intergenic
980890978 4:138815300-138815322 ATGGTGGGGGGCAGTGTGTGTGG + Intergenic
981420031 4:144538881-144538903 ATGGTGGTGGAGTATGTGTAAGG - Intergenic
982062787 4:151621552-151621574 GGGGTGGTGGGGGGTGCGTGGGG + Intronic
982200804 4:152958099-152958121 CTGTTGGGTGGGTGTGTTTGTGG + Intronic
982484042 4:155945904-155945926 GGTGTGGTGTGGTGTGTGTGTGG - Intronic
982844054 4:160226875-160226897 GGGGGGGTGGGGTGTGTGTGGGG + Intergenic
983021042 4:162675674-162675696 CAGGTTGTGGGGTATGTCTGTGG - Intergenic
983410131 4:167385950-167385972 CTTGGGGTGGGGAGGGTGTGGGG - Intergenic
983518252 4:168679170-168679192 TGTGTGGTGGGGTGTGTGTGTGG + Intronic
983518264 4:168679231-168679253 GTGTGTGTGGGGTGTGTGTGTGG + Intronic
983642976 4:169960813-169960835 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
983861706 4:172715253-172715275 GTGGCGGCAGGGTGTGTGTGGGG + Intronic
983927439 4:173416973-173416995 TTGTGTGTGGGGTGTGTGTGTGG - Intergenic
984699636 4:182810420-182810442 GTGGTGAGGGTGTGTGTGTGTGG - Intergenic
984812535 4:183807609-183807631 CTGGGAGTGGGGTGGGTGTGGGG - Intergenic
985070277 4:186160712-186160734 GGTGTGGTGAGGTGTGTGTGTGG - Intronic
985070280 4:186160733-186160755 GGTGTGGTGTGGTGTGTGTGGGG - Intronic
985369721 4:189273141-189273163 CTGTTTGTGTGGTGTGTGTGTGG - Intergenic
985516010 5:344940-344962 GTGGGGGGGGTGTGTGTGTGAGG + Intronic
985631819 5:1017877-1017899 GTGGTGCTGGGGTGTGAGAGAGG + Intronic
985727083 5:1522255-1522277 CTGGTGGCTGGGTGGGGGTGAGG + Intronic
986296984 5:6447679-6447701 GTGTTTGTGGTGTGTGTGTGAGG - Intergenic
986603398 5:9496873-9496895 CTGGTAGCAGGTTGTGTGTGTGG - Intronic
986741301 5:10707712-10707734 TGGGTGGTGTGGTGTGTGGGTGG + Intronic
986793056 5:11182038-11182060 GTGTGTGTGGGGTGTGTGTGGGG + Intronic
986793075 5:11182142-11182164 GTGTGGATGGGGTGTGTGTGTGG + Intronic
986793081 5:11182170-11182192 GTGGGCGTGTGGTGTGTGTGGGG + Intronic
987051023 5:14146169-14146191 CTGTTGGATGGGTGGGTGTGGGG + Intronic
988466915 5:31500152-31500174 CTGGTTGAGGGGTGTGTGAAGGG - Intronic
988527990 5:32003092-32003114 GTGTTTGTGGGGTGTGTGTGTGG - Intronic
988528015 5:32003315-32003337 GTGGTGGGGGTGTGTGTGTGGGG - Intronic
988528032 5:32003410-32003432 GTGTGGGGGGGGTGTGTGTGTGG - Intronic
989011764 5:36878969-36878991 CGGGTGGGGGGGTGTGCGAGTGG + Intronic
989189974 5:38661134-38661156 GTGGGGGTGGGGTATGTGTATGG + Intergenic
989815123 5:45727051-45727073 CTTATGGGTGGGTGTGTGTGTGG + Intergenic
990438679 5:55821851-55821873 CTGGTGGGTGGCTGTGTGCGGGG + Intergenic
990480589 5:56206645-56206667 CTGCTGGTGGGGGTTGTGGGAGG - Intronic
990629412 5:57651481-57651503 CTGGTGCTGGGGAATGTCTGTGG + Intergenic
991128848 5:63097939-63097961 GTGGTGGTGGGGTGGGGGGGCGG + Intergenic
991443710 5:66678249-66678271 CTGGTGGGGGTGTGTATGGGGGG + Intronic
991582604 5:68172571-68172593 CTGGTGGTGGGGCCTTTGTCTGG + Intergenic
991729031 5:69564456-69564478 CTGGTGGTGAGATGGGTTTGTGG - Intronic
991805462 5:70419604-70419626 CTGGTGGTGAGATGGGTTTGTGG - Intergenic
991865923 5:71063419-71063441 CTGGTGGTGAGATGGGTTTGTGG + Intronic
992443454 5:76814442-76814464 AAGGAGGTGGTGTGTGTGTGTGG + Intergenic
992506871 5:77395727-77395749 CTGGTGAGGGGGTGGGGGTGGGG - Intronic
992559251 5:77933978-77934000 GTGGTGGTGGTGTGTGTGTGTGG - Intergenic
993017512 5:82551716-82551738 CCGGGGGTGGGGTGGGGGTGGGG + Intergenic
993501525 5:88672622-88672644 GTGGTGGTGGTGTGTTTGGGGGG - Intergenic
994159388 5:96538738-96538760 CTGAGGGAGCGGTGTGTGTGTGG - Intronic
994647272 5:102485476-102485498 CTTGTCATGGGGTGTGGGTGTGG + Intronic
994716486 5:103327883-103327905 ATGGTGGCTGGTTGTGTGTGTGG + Intergenic
995737370 5:115316145-115316167 CTGGTGGTGGGGTGAGGGAAGGG - Intergenic
995758862 5:115543805-115543827 TTGGGGGTGGGGGGGGTGTGTGG - Intronic
996076042 5:119195571-119195593 CTGGTGGTGGGGGGAGAATGGGG + Intronic
996191953 5:120555504-120555526 GGTGGGGTGGGGTGTGTGTGTGG + Intronic
996936613 5:128956857-128956879 CCTGTAGTGGGGTGTGGGTGGGG - Intronic
997259101 5:132451870-132451892 CAGTTGGTGGGGTGAGGGTGGGG - Intronic
997555485 5:134794241-134794263 CTGCTGTTGGGCTGTATGTGGGG + Intronic
997856748 5:137379525-137379547 GTGGTGGTGGGGTGGGGGGGTGG - Intronic
998012005 5:138702930-138702952 CTGCTGGTAGGGTGGGGGTGGGG - Intronic
998103242 5:139451566-139451588 TGTGTGGTGTGGTGTGTGTGTGG + Intronic
998103449 5:139453755-139453777 GTGTTTGTGGTGTGTGTGTGTGG + Intronic
998449430 5:142222883-142222905 CTGGGGGTGGGGTGTGGGGTGGG - Intergenic
998504216 5:142659043-142659065 CTGGTGTTGGCGTGTGTTGGGGG + Intronic
998994379 5:147854512-147854534 CTGGTGAAGGTGAGTGTGTGGGG - Intergenic
999179030 5:149655768-149655790 CTGGGTGTGTGGTGTGTGTGTGG - Intergenic
999275082 5:150324937-150324959 CTATTGGTGGGGGGTGGGTGGGG - Intronic
999384436 5:151144406-151144428 CTGGGGCAGGGGTGTGTGGGCGG + Intronic
999488611 5:152026172-152026194 CTTCTGGTGGGGTTTCTGTGTGG + Intergenic
999673543 5:153977673-153977695 CCTGTGGGGGGGTCTGTGTGCGG - Intergenic
999799496 5:155019790-155019812 CTGGGAGTGGGGTGGGGGTGGGG + Intergenic
999873516 5:155776636-155776658 CTGGAGGTGGGGCGGGGGTGGGG - Intergenic
999938639 5:156516224-156516246 CTATTGGGGGTGTGTGTGTGGGG - Intronic
1000254872 5:159527846-159527868 CTAGTGGTGTGATGTGGGTGGGG + Intergenic
1000262659 5:159602890-159602912 GTGGTGATGGGGTGGGTATGGGG - Intergenic
1000289556 5:159857970-159857992 GTGGTGATGATGTGTGTGTGTGG - Intergenic
1000367477 5:160505067-160505089 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1000367487 5:160505144-160505166 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1000548024 5:162625809-162625831 TTGGGGGTGGGGAGTGTGAGGGG - Intergenic
1000690801 5:164317910-164317932 CAGGTTTAGGGGTGTGTGTGCGG - Intergenic
1001008442 5:168075521-168075543 CTGGAGGTGAGGTTGGTGTGGGG - Intronic
1001117920 5:168955097-168955119 GTGGGGGTGGGGTGGGGGTGAGG + Intronic
1001289969 5:170450120-170450142 CAGGGGGTGGGGTGAGGGTGGGG - Intronic
1001464964 5:171955932-171955954 CTGGAGGTGGGGTGAGTGGGAGG - Intronic
1001558784 5:172655547-172655569 CTGGTGGTGTTGTGTGTGGATGG - Intronic
1001758006 5:174185697-174185719 CAGGGTGTGGGGTGTGTGGGGGG + Intronic
1002140082 5:177133053-177133075 GTGGTGGTGGTGTGGGTTTGGGG + Intronic
1002237444 5:177812516-177812538 TGGGTGGGGGGGTGTGGGTGAGG - Intergenic
1002304364 5:178274559-178274581 GTGGTGGTTGGCTGGGTGTGGGG + Intronic
1002458407 5:179359555-179359577 GTGTTGCTGGGGTGTGTGTGAGG - Intergenic
1002633321 5:180594966-180594988 GTGTGTGTGGGGTGTGTGTGAGG + Intergenic
1002639357 5:180623433-180623455 CTGGGGGTGGGGTGGGGGTGGGG - Intronic
1002714880 5:181220809-181220831 CTCGTGGTGTGGTGCGTATGCGG + Intergenic
1002724638 5:181286484-181286506 CGGGTGGGGGTGTGTGGGTGGGG - Intergenic
1002795987 6:471304-471326 CTGGGGGTTGGGTGTGGGAGAGG + Intergenic
1002980295 6:2129265-2129287 GTTGGGATGGGGTGTGTGTGGGG - Intronic
1003011143 6:2428578-2428600 CTGGAGGTGGGGTAGGAGTGGGG + Intergenic
1003079569 6:3010451-3010473 CTGGTGCTGGGTAGTTTGTGGGG - Intronic
1003173954 6:3741124-3741146 CTGCTGGTCGGTTGTGTCTGGGG - Intronic
1003456985 6:6292372-6292394 CTTGTGTTGGGGAGTCTGTGAGG - Intronic
1003463386 6:6353042-6353064 CAGGTGGTGTGCGGTGTGTGTGG - Intergenic
1003476034 6:6483851-6483873 GTGTTGGGGGGGAGTGTGTGTGG - Intergenic
1003484892 6:6567064-6567086 CTGGTGGTGTGGAGTGGCTGAGG + Intergenic
1003596862 6:7481737-7481759 CGGGTGGTGGGGAGGGGGTGGGG + Intergenic
1003879305 6:10465748-10465770 CTGGAGGTGGGGTGGGGGAGGGG + Intergenic
1003893897 6:10588741-10588763 ATGCTTGTGTGGTGTGTGTGTGG + Intronic
1003904463 6:10686411-10686433 AAGGAGGAGGGGTGTGTGTGGGG + Intronic
1003985111 6:11427648-11427670 GTGGTGTACGGGTGTGTGTGTGG - Intergenic
1004199323 6:13533142-13533164 CTGGTGGTGGTGTGTCTCTTGGG + Intergenic
1004301704 6:14464278-14464300 CTGGTGGTGGGTGGTGAGAGTGG - Intergenic
1005281286 6:24277270-24277292 GTGGTGGGGTGGGGTGTGTGAGG + Intronic
1005491875 6:26354601-26354623 AGGGTGGTGGGGTGAGGGTGTGG + Intergenic
1005809359 6:29504417-29504439 CTGGAGGTGGGGTCTTTGGGAGG - Intergenic
1005893153 6:30156405-30156427 GTGGTGGTAGGGTGTGGGGGAGG - Intronic
1006102025 6:31691537-31691559 CCAGAGGTGGGGTGAGTGTGAGG - Intronic
1006102222 6:31692741-31692763 GTGGGGGTGGGGTGGGGGTGGGG - Intronic
1006110873 6:31744361-31744383 GTGGGGGTGGGGTGTGGATGTGG + Intronic
1006136424 6:31898864-31898886 CTGGTGGAGGGCTGGGGGTGGGG + Intronic
1006173438 6:32108347-32108369 CTGGTGGTGGGGGGCGGGGGCGG + Intronic
1006428716 6:33982336-33982358 CTGGTGGTGGGGGGTGGTGGGGG - Intergenic
1006440587 6:34051421-34051443 ATGGTGGCTGGGGGTGTGTGGGG - Intronic
1006445206 6:34076266-34076288 GTGGCGGTGGGGTGGGTGGGAGG - Intronic
1006684520 6:35821335-35821357 CAGTTGGTGGGGTGGGTCTGGGG + Intronic
1006712770 6:36089374-36089396 CTGTTGGTGGGGTGGGGGTCAGG + Intronic
1006800727 6:36758039-36758061 CTGGTGGAGGTGAGTGTGAGGGG + Intronic
1007512312 6:42382927-42382949 TGGGGGGTGGGGTGGGTGTGGGG + Intronic
1007514489 6:42400540-42400562 CTGGTGGTGGTGGGTGATTGGGG - Intronic
1007719988 6:43879199-43879221 CTGGGGCTGGGGTGTGTGTAGGG - Intergenic
1007785599 6:44277542-44277564 CCAGAGGTGGGGTGTCTGTGGGG + Exonic
1008714597 6:54273624-54273646 GTGGTTGTGCAGTGTGTGTGTGG - Intergenic
1009687139 6:66976336-66976358 CTCATGGTGGGGAGTGTGTGGGG + Intergenic
1010189516 6:73180579-73180601 GTGGTGGTGGAGTGTGTTGGGGG - Intronic
1010196576 6:73245752-73245774 TGGGTGGTGGGGGGTGTGTCTGG - Intronic
1010902320 6:81442530-81442552 CTGTGGGTGGCATGTGTGTGTGG + Intergenic
1011808355 6:91099185-91099207 CTGATGGTGGTGGGTGGGTGAGG - Intergenic
1011930091 6:92700942-92700964 CAAGTGGAGGGGTGTGTTTGAGG + Intergenic
1012389943 6:98727058-98727080 CTGGTATTTAGGTGTGTGTGGGG - Intergenic
1013042951 6:106454363-106454385 GTGGTAGTGGGGTGTGTGTGTGG - Intergenic
1013050978 6:106534806-106534828 TTGGGGGCGGGGTGTGTGTAGGG + Intronic
1013141819 6:107344510-107344532 ATGCAGGTGGGATGTGTGTGTGG - Intronic
1013684698 6:112565820-112565842 CTGGTGTGTGTGTGTGTGTGTGG + Intergenic
1014035663 6:116764977-116764999 CTGGAGGCGGGGTGTGTGTGTGG + Intronic
1014078792 6:117265822-117265844 CTGGTGGTAGGGGGTGTAGGCGG - Exonic
1014543138 6:122700299-122700321 GTGGTGGTGGGGTGGTGGTGTGG + Intronic
1015063408 6:128996289-128996311 ATGATGGTGGGGAGTGTTTGAGG + Intronic
1015449120 6:133343570-133343592 AGGGTGGTGGGGTGGGTGGGGGG - Intronic
1015607401 6:134972906-134972928 CTAGTAGTGGGGTGTGGGAGAGG - Intronic
1015907095 6:138128714-138128736 GAGGTGGTGGGGTGGGGGTGGGG - Intergenic
1016386846 6:143537312-143537334 CTGGCGGCGGGGTGGGGGTGGGG + Intronic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1016827860 6:148404794-148404816 CTGGGGGTGGGGTGTTGGAGGGG - Intronic
1017162303 6:151377147-151377169 TTAGTGGTGGGGGGGGTGTGGGG + Intronic
1017598733 6:156058566-156058588 CTGTTGGTGGGGTGAGGTTGGGG + Intergenic
1017903014 6:158734525-158734547 CTGGAGGTGGGATGTGTCTGGGG - Intronic
1017918675 6:158853264-158853286 ATGTTGGAGGGGTATGTGTGTGG - Intergenic
1018115054 6:160574680-160574702 CCAGTTGTGGGGTGTGTTTGAGG + Intronic
1018554265 6:165034111-165034133 CTGGTGGTGGTGTGTGGGAGAGG - Intergenic
1018676074 6:166223344-166223366 CTGGGGGTGGGGTGGGGGTGGGG - Intergenic
1019020222 6:168911820-168911842 CTTGTGGTGGAGATTGTGTGAGG - Intergenic
1019190577 6:170248529-170248551 CTGATGGTGGGGTATGGCTGGGG - Intergenic
1019273735 7:164993-165015 GTGGTGGTGGGGTGGGTGTGGGG - Intergenic
1019319688 7:409951-409973 ATGGTGCTTTGGTGTGTGTGAGG + Intergenic
1019327366 7:445075-445097 CTGGAAGTGGAGTCTGTGTGTGG - Intergenic
1019348324 7:541354-541376 CTGTGGGTGGGGTGGGGGTGGGG - Intergenic
1019390632 7:784576-784598 CTCGTGGTGGTGTGTGTGATGGG - Intronic
1019405092 7:878966-878988 CTCGGGGGGGGGTGTCTGTGGGG - Intronic
1019423779 7:963667-963689 CTGGTTGTGAGGCGTGTGGGTGG - Intronic
1019608040 7:1919939-1919961 CTGGAGGAGGGGTGTGGGTAAGG - Intronic
1019711679 7:2520824-2520846 CAGGTTTTGGGGTCTGTGTGGGG + Intronic
1019756932 7:2777501-2777523 CTGGAGGTGGGGTCTTTGGGAGG + Intronic
1019763880 7:2835238-2835260 CTGGTGGTGGGGTGTGCCTCAGG - Intronic
1019993173 7:4706590-4706612 CAGCTGGTGGGGTGGGTGTCAGG - Intronic
1020016368 7:4834363-4834385 CTGAGGGTGGGGTTTGCGTGGGG - Intronic
1020127005 7:5538701-5538723 GTGTGTGTGGGGTGTGTGTGTGG - Intronic
1020127020 7:5538803-5538825 GTGGGTGTGGGGTGTGTGTGTGG - Intronic
1020155550 7:5720995-5721017 CTGGTCTTGGGGTGTGTTTCTGG - Intronic
1020214523 7:6179652-6179674 GTGTGTGTGGGGTGTGTGTGGGG - Intronic
1020214535 7:6179690-6179712 GTGTGTGTGGGGTGTGTGTGTGG - Intronic
1020214545 7:6179738-6179760 GTGGGGGTGTGGGGTGTGTGTGG - Intronic
1020997298 7:15280251-15280273 CTGGTGGAGCAGTGTGGGTGTGG + Intronic
1022048171 7:26639680-26639702 CTGTTTGTGGTGGGTGTGTGTGG - Intronic
1022099644 7:27161522-27161544 CTGGCGGCGGGGTGGGGGTGGGG + Intergenic
1022106649 7:27201671-27201693 CAGATGGTGGGGTGTGTGTGAGG - Intergenic
1022126994 7:27368053-27368075 CTGAGTGTGTGGTGTGTGTGTGG - Intergenic
1022209335 7:28193590-28193612 GTGGTGTTGGGGTGGGGGTGGGG - Intergenic
1022668488 7:32432755-32432777 CTGTTGGTGGGGTGTGTCTGTGG - Intergenic
1022961476 7:35430415-35430437 CTGGTTGTGGGGTATGTCTGTGG - Intergenic
1023233923 7:38064426-38064448 CTGGTGGAGGCTGGTGTGTGGGG - Intergenic
1023346017 7:39271970-39271992 GAGGAGTTGGGGTGTGTGTGTGG + Intronic
1023405916 7:39833750-39833772 CTCGTGGTGGTGTGTATTTGGGG + Intergenic
1023464476 7:40438760-40438782 CTGGTAGTGGTGTGTGTGCACGG + Intronic
1023540597 7:41261251-41261273 GTGGTGGTGAGGTGTGTGGGTGG + Intergenic
1023728491 7:43167985-43168007 TTGGTGGTGTGGTGTTGGTGAGG - Intronic
1023994918 7:45153582-45153604 GAGGTGATGGTGTGTGTGTGTGG - Intergenic
1024021209 7:45372721-45372743 CTTGTGGTGGGGGCAGTGTGAGG - Intergenic
1024524409 7:50336327-50336349 CTGGTGAAGGGGCGTGCGTGGGG + Intronic
1024543648 7:50499689-50499711 CTGGTGGTGGGGATGGAGTGGGG - Intronic
1026183779 7:68064973-68064995 CTGGTTGTAGGGTGCTTGTGGGG + Intergenic
1026364401 7:69633315-69633337 CTGTGGGGGGTGTGTGTGTGTGG - Intronic
1026821567 7:73553114-73553136 GGGGTGGTGGGGTGGGGGTGGGG + Intronic
1026907470 7:74070793-74070815 CTGTTCGTGGGGAGTGTGGGTGG + Intergenic
1027052260 7:75027834-75027856 TTCGGGGTGGGGTGTGAGTGTGG + Intronic
1027266752 7:76498800-76498822 GTGGAGGTGTGGGGTGTGTGGGG + Intronic
1027266774 7:76498893-76498915 ATGGAGGTGTGGAGTGTGTGTGG + Intronic
1027318160 7:76997034-76997056 ATGGAGGTGTGGAGTGTGTGTGG + Intergenic
1027318287 7:76997582-76997604 ATGTGTGTGGGGTGTGTGTGTGG + Intergenic
1027318340 7:76997780-76997802 GTGGAGGTGTGGGGTGTGTGTGG + Intergenic
1027318343 7:76997808-76997830 GTGGACGTGTGGTGTGTGTGTGG + Intergenic
1027945502 7:84739921-84739943 CTGGTGATGTGGTGTTTGGGTGG - Intergenic
1028041815 7:86062944-86062966 CTGGTAGGGGGGAGGGTGTGTGG - Intergenic
1028174223 7:87634480-87634502 GTGGTGGTGGGGGGTGGGGGGGG + Intronic
1028832363 7:95341931-95341953 CTGGTGGTGGGCAGTGGGAGGGG - Intergenic
1028898988 7:96075290-96075312 TGGGTGTTGGGGTGTGTGTGTGG - Intronic
1028993729 7:97076912-97076934 ATGGTGCTGGGGTGTGTGGAGGG + Intergenic
1029115246 7:98233352-98233374 CTGGGGGTGTGGGGTGTGGGAGG - Intronic
1029696452 7:102216619-102216641 CGTGTGTGGGGGTGTGTGTGTGG - Intronic
1029696474 7:102216806-102216828 GTGGTGGGAGAGTGTGTGTGGGG - Intronic
1029736173 7:102467150-102467172 TTGTTGCTGGGGTGTGTGTGGGG + Intronic
1030014598 7:105206144-105206166 TGGGTGGTGGGGTGGGGGTGGGG - Intronic
1031171905 7:118302769-118302791 CCTGTGGTGGGGTGTGGGGGAGG - Intergenic
1031534339 7:122914948-122914970 CTGGTGGTGGGGTCGGGGGGAGG + Intergenic
1032011260 7:128349697-128349719 CTGGTGGTTGGATGTGTTTGTGG + Intergenic
1032163920 7:129531121-129531143 GTGGTGGTGGTGTGTGGGAGGGG + Intergenic
1032264484 7:130361521-130361543 CTGGACTTGGGGTGTGAGTGTGG + Intronic
1032401924 7:131629716-131629738 CAGGTCTTGGGGTGTGGGTGGGG + Intergenic
1032513306 7:132489088-132489110 GAGGTTGTGGGGTGAGTGTGTGG - Intronic
1032659635 7:133969508-133969530 CTTCTGGTGGGGTTTCTGTGTGG + Intronic
1032871628 7:135991966-135991988 CTAGTGGTGGGGTGGGGGTGGGG + Intergenic
1032871898 7:135994736-135994758 GATGAGGTGGGGTGTGTGTGTGG + Intergenic
1033244017 7:139703787-139703809 TGGGGTGTGGGGTGTGTGTGTGG - Intronic
1033481394 7:141744794-141744816 CTGATTGATGGGTGTGTGTGTGG + Intronic
1034341448 7:150359206-150359228 TGTGTGGTGGGGTGTGTGTGTGG - Intergenic
1034341455 7:150359237-150359259 TGTGTGGTGGGTTGTGTGTGTGG - Intergenic
1034341479 7:150359430-150359452 TGTGTGGTGGGTTGTGTGTGTGG - Intergenic
1034341540 7:150359888-150359910 TGTGTGGTGGGTTGTGTGTGTGG - Intergenic
1034347881 7:150398133-150398155 ATGTTTGCGGGGTGTGTGTGGGG + Exonic
1034406881 7:150910166-150910188 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1034406884 7:150910177-150910199 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1034406887 7:150910188-150910210 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034749245 7:153553552-153553574 CTGGTTTTTGTGTGTGTGTGTGG - Intergenic
1034858327 7:154575214-154575236 TGTGTGGTGTGGTGTGTGTGTGG + Intronic
1034858348 7:154575492-154575514 GTGTTTGTGTGGTGTGTGTGTGG + Intronic
1035062521 7:156079935-156079957 CCGGGGGTGGGGTGGGGGTGGGG - Intergenic
1035062538 7:156079968-156079990 CTGGGGGTGGGGTTGGGGTGGGG - Intergenic
1035259760 7:157653880-157653902 GTGGAGTTGGGGTGGGTGTGGGG - Intronic
1035259806 7:157654032-157654054 GTGGAGTTGGGGTGGGTGTGGGG - Intronic
1035259831 7:157654108-157654130 GTGGAGTTGGGGTGGGTGTGGGG - Intronic
1035259855 7:157654182-157654204 GTGGAGTTGGGGTGGGTGTGGGG - Intronic
1035283209 7:157790243-157790265 CTGTGGTGGGGGTGTGTGTGTGG + Intronic
1035293551 7:157854901-157854923 CTGTTGCAGGGATGTGTGTGGGG + Intronic
1035293564 7:157854947-157854969 CCGTTGTAGGGGTGTGTGTGGGG + Intronic
1035293588 7:157855039-157855061 CTGTTGCAGGGGTGTGTGTGGGG + Intronic
1035309228 7:157954498-157954520 CTGTGTGTGGTGTGTGTGTGTGG + Intronic
1035309235 7:157954585-157954607 CTGTGTGTGGTGTGTGTGTGTGG + Intronic
1035317879 7:158008100-158008122 GTGGGGGTGTGCTGTGTGTGTGG + Intronic
1035779653 8:2217340-2217362 AGGATGGTGGGGTGTGGGTGAGG + Intergenic
1036392109 8:8332619-8332641 GAGGTGGTGGGGTGGGGGTGGGG - Intronic
1036648262 8:10625508-10625530 GTGGGGGTGGGGTGTGGGAGGGG + Intronic
1036671237 8:10789784-10789806 CACGTGGAGGTGTGTGTGTGTGG - Intronic
1036820396 8:11935297-11935319 CTGGTGGGGAGGTGTGTTTTTGG - Intergenic
1037174774 8:15933555-15933577 ATGGTTGGGGGGTGAGTGTGAGG + Intergenic
1037595720 8:20352585-20352607 CTGGTGGTGGTGTGGCAGTGAGG + Intergenic
1037764996 8:21767305-21767327 AGAGAGGTGGGGTGTGTGTGTGG - Intronic
1037886153 8:22597476-22597498 TGTGTGTTGGGGTGTGTGTGTGG + Intronic
1037976706 8:23219087-23219109 CTGGAGGTGGGGGGTGGGGGAGG + Intronic
1038054168 8:23842668-23842690 CTGGGGGTGGGAAGTGTGGGAGG + Exonic
1038438763 8:27557340-27557362 CTAGTGTTGGGGGGTGTGAGTGG - Intergenic
1038485061 8:27929241-27929263 CTTGGGGTGGGCTGTGGGTGGGG - Intronic
1038775643 8:30528218-30528240 TTAGTGGTGGATTGTGTGTGTGG + Intronic
1039104662 8:33976951-33976973 GTGGGGGTGGGGTGGGGGTGGGG + Intergenic
1039433861 8:37546196-37546218 CTGGAAATGGTGTGTGTGTGTGG - Intergenic
1039546763 8:38416119-38416141 CTGGGGGTGGGGTTTCTTTGAGG - Intronic
1039554476 8:38466891-38466913 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1039960887 8:42246836-42246858 CTGGGGTTGGGGTGGGAGTGAGG + Intergenic
1040520751 8:48174137-48174159 ATGGTGGTGTGTGGTGTGTGTGG + Intergenic
1040801665 8:51349152-51349174 ACGGTGGGTGGGTGTGTGTGTGG + Intronic
1040936401 8:52786269-52786291 CTGGTGAGGGGGTGAGTGTGGGG + Intergenic
1041139431 8:54800315-54800337 GTGTTGGGGGGGTGTGTGTATGG + Intergenic
1041588410 8:59547389-59547411 GTGGGGGTGGGGTGGGGGTGGGG - Intergenic
1042030370 8:64469609-64469631 TTGGTGGTGGTGCGTGGGTGGGG - Intergenic
1042077338 8:65010466-65010488 CTTGTGGTGCTGTGTGTGGGTGG - Intergenic
1042228101 8:66530602-66530624 CTGGTGTTTGGGTGGGTGTCAGG - Intergenic
1042333163 8:67604061-67604083 CTGGTGATGGAGGTTGTGTGGGG + Intronic
1042452696 8:68967288-68967310 CTGCTGGAGCTGTGTGTGTGTGG - Intergenic
1042491846 8:69408293-69408315 ATGGTGGGGGGGTGGGTGGGGGG + Intergenic
1042725224 8:71868097-71868119 CTGGGGGCTGGGTGTGTGTGTGG + Intronic
1042976695 8:74478106-74478128 CTGGTGGGGTGGTGGGGGTGGGG + Intronic
1043444014 8:80301534-80301556 GTGGTGGTGGGGGGTGAGGGGGG - Intergenic
1043662781 8:82766150-82766172 ATGGTGTTTGTGTGTGTGTGTGG - Intergenic
1043842778 8:85128421-85128443 GTGGTGGTGGGGGGGGTGGGGGG - Intronic
1043874275 8:85466338-85466360 TTGGTGGTGGTGTGGGAGTGAGG + Intronic
1044511446 8:93085009-93085031 CAGGAGGTGGGCGGTGTGTGAGG - Intergenic
1046754863 8:117962750-117962772 TTGGGGGTGGGGGGTGTGGGGGG - Intronic
1046766329 8:118074077-118074099 ATGGGGGTGGGGTGGGAGTGGGG + Intronic
1046967524 8:120184193-120184215 GTGTTTGTGGTGTGTGTGTGGGG + Intronic
1047380389 8:124356642-124356664 TTGGGGCTGAGGTGTGTGTGGGG - Intronic
1047498079 8:125422609-125422631 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1047498084 8:125422622-125422644 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498087 8:125422633-125422655 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498090 8:125422644-125422666 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498093 8:125422655-125422677 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498100 8:125422688-125422710 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498101 8:125422699-125422721 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1047498104 8:125422712-125422734 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1047498107 8:125422725-125422747 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1047498114 8:125422751-125422773 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498115 8:125422762-125422784 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1047498120 8:125422775-125422797 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498121 8:125422786-125422808 GTGTGTGTGGGGTGTGTGTGTGG + Intergenic
1047498126 8:125422799-125422821 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047498129 8:125422810-125422832 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1047550133 8:125862207-125862229 ATGGGGGTGGTGTGTCTGTGAGG + Intergenic
1048254203 8:132893476-132893498 TGTGTGGTGTGGTGTGTGTGTGG + Intronic
1048292957 8:133194368-133194390 GTGTGTGTGGGGTGTGTGTGTGG + Intronic
1048321610 8:133404568-133404590 TGTGTGGTGTGGTGTGTGTGTGG - Intergenic
1048441295 8:134461341-134461363 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1048441317 8:134461656-134461678 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1048579962 8:135722666-135722688 CTGGTGAGTGGGTGTGTGTGTGG + Intergenic
1048857125 8:138694955-138694977 CTGGAGGTGGCCTGTGTGTCCGG - Intronic
1048987336 8:139741673-139741695 CTGGGGGTGGAGTGGGTCTGGGG - Intronic
1049230481 8:141478987-141479009 GTTAGGGTGGGGTGTGTGTGGGG + Intergenic
1049530104 8:143149907-143149929 CTTTTGTTGGGGGGTGTGTGGGG - Intergenic
1049543347 8:143218344-143218366 GTGGTGGTGGGGGTGGTGTGGGG - Intergenic
1049690101 8:143954545-143954567 GTGGTCGTGGGGGGTGGGTGAGG - Intronic
1049756996 8:144315242-144315264 CTGGTGGGGGGATGGGTGTGGGG - Exonic
1050091281 9:2017521-2017543 GTGGGGGTGGCGTGTGCGTGTGG + Intronic
1050851172 9:10288154-10288176 TTGGGGGTGGGGGGTGGGTGAGG + Intronic
1050879004 9:10675684-10675706 CTGGTGCTGGGGTGCCTGAGTGG + Intergenic
1051261368 9:15268508-15268530 CTGAGTGTGGAGTGTGTGTGTGG - Intronic
1051678520 9:19582915-19582937 GTGCTGGTTGGGTGGGTGTGCGG - Intronic
1051768549 9:20550562-20550584 GTGGTGGTGGTGTGTGCTTGTGG - Intronic
1051896486 9:21994512-21994534 GTGGGGGTGGGGTGGGGGTGGGG - Intronic
1051942016 9:22518624-22518646 CTAGTGGTGGAGTTTGTGTGTGG + Intergenic
1052013899 9:23443219-23443241 ATGGTGGTAGGGTGGGGGTGGGG - Intergenic
1052769994 9:32678922-32678944 GTGGTTGGGGGGTGTGGGTGGGG - Intergenic
1053203349 9:36167106-36167128 CTGGGGGTGGGGGGTGAGGGGGG + Intergenic
1053282161 9:36827381-36827403 GTGGTGGTGGGGTGAGTAGGGGG + Intergenic
1053353585 9:37429110-37429132 CTGGTGCAGGGGTGCGGGTGAGG + Intronic
1053417972 9:37958730-37958752 CTGGTGGTGATGTGTGTGCTAGG - Intronic
1053504438 9:38629634-38629656 ATGTTTGTGGTGTGTGTGTGTGG - Intergenic
1053624924 9:39859732-39859754 CTGCTGCTGGGGTGGGGGTGGGG + Intergenic
1053879946 9:42583496-42583518 CTGCTGCTGGGGTGGGGGTGGGG - Intergenic
1053892717 9:42710815-42710837 CTGCTGCTGGGGTGGGGGTGGGG + Intergenic
1054218973 9:62390966-62390988 CTGCTGCTGGGGTGGGGGTGGGG - Intergenic
1054231744 9:62518203-62518225 CTGCTGCTGGGGTGGGGGTGGGG + Intergenic
1054627542 9:67413935-67413957 GTGGGGGGGTGGTGTGTGTGTGG - Intergenic
1055208372 9:73761371-73761393 CTAGTGTGGGGGTGTGTGTGTGG + Intergenic
1055968241 9:81886355-81886377 ATGGTGGTGGGGTGGGGGAGGGG - Intergenic
1056120484 9:83483013-83483035 CTGGTTCTGGGGTGTGGGTTTGG + Intronic
1056193384 9:84206364-84206386 TTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1056193387 9:84206375-84206397 GTGTGTGTGGGGTGTGTGTGGGG + Intergenic
1056298458 9:85217486-85217508 GTGGGGGTGGGGTGGGAGTGGGG - Intergenic
1056558986 9:87713425-87713447 GGGGGGGTGTGGTGTGTGTGTGG + Intergenic
1056577868 9:87869670-87869692 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1056670430 9:88623190-88623212 CTGGTGGTGGAGACTCTGTGTGG + Intergenic
1056708896 9:88974378-88974400 CAGTTTGTGTGGTGTGTGTGTGG - Intergenic
1056852913 9:90099008-90099030 TGGGTGGTGTGATGTGTGTGTGG - Intergenic
1057022625 9:91712021-91712043 ATGTGTGTGGGGTGTGTGTGTGG + Intronic
1057255238 9:93541070-93541092 TGTGTGGTGGGGGGTGTGTGTGG + Intronic
1057274366 9:93668502-93668524 CTGGGGGTTGGGGGTGTCTGAGG + Intronic
1057564739 9:96157644-96157666 TGTGTGGTGTGGTGTGTGTGTGG + Intergenic
1057646399 9:96878898-96878920 CTGGTGTTGGAGTGGATGTGAGG - Intergenic
1057785888 9:98087222-98087244 GTGATGGTGGGGTGAGGGTGCGG + Exonic
1058415992 9:104789009-104789031 GTGGTGGTGGGGTGGCTTTGGGG + Intronic
1058428311 9:104895494-104895516 CTGGTGGAAGGGTGAGGGTGGGG + Intronic
1058625185 9:106927212-106927234 CTGGTGGCGGGGGTTGTGGGGGG - Exonic
1059552904 9:115247948-115247970 TTGCTGGGGGGGTGTCTGTGAGG + Intronic
1059935593 9:119307157-119307179 CTGGTGGTGGTGTTTGTTGGGGG - Intronic
1060140459 9:121205194-121205216 CTGGTGATGGTGTGTCTGTGGGG - Intronic
1060158576 9:121338364-121338386 GTGGTGGTGGTGTGTGGATGGGG + Intergenic
1060158617 9:121338828-121338850 GTGGTGGTGGAGGGTGTGTGTGG + Intergenic
1060520292 9:124290430-124290452 CTGGTGGGAAGGTGTGTGTCAGG + Intronic
1060877259 9:127092324-127092346 CTGGAGATGAGCTGTGTGTGAGG + Intronic
1060887615 9:127166817-127166839 ATGATGGTGGGGTGTGTAAGAGG + Intronic
1060989823 9:127842073-127842095 CTGATGGTGGGCTGGGAGTGGGG + Intronic
1061107394 9:128542161-128542183 CTTGTGGCAGGGTGTGTTTGTGG + Exonic
1061178894 9:129012658-129012680 TTGGGGGTGGGCTGTGTTTGCGG - Intronic
1061293389 9:129665139-129665161 CGGGTGTGTGGGTGTGTGTGGGG + Intergenic
1061441418 9:130606494-130606516 CTTGTGCTGGGGTGGGAGTGGGG + Intronic
1061747733 9:132752718-132752740 CTGCAGGTGGGGTGGGTGGGGGG - Intronic
1061839189 9:133347873-133347895 ATGGAGGGGGGGTGGGTGTGTGG - Intronic
1062002378 9:134222966-134222988 CGCGTGGTGGCGTGTGTCTGTGG - Intergenic
1062119489 9:134826654-134826676 CTGGTGGATGGGTGTGTGTATGG + Intronic
1062162170 9:135086842-135086864 GTGGTGGAGGGGTGTGGGTTGGG - Intronic
1062166323 9:135109421-135109443 CTGATGGTGGGTAGAGTGTGGGG + Intronic
1062262106 9:135667901-135667923 CTGATGGTGGGGTGGGTGCTGGG - Intergenic
1062431066 9:136527079-136527101 CAGGTGTGGGGGTCTGTGTGTGG + Intronic
1062436553 9:136548938-136548960 CTGGTGGGTGGGTGTATTTGAGG + Intergenic
1062440854 9:136568650-136568672 GTGGTGGTGGGGGCTGAGTGGGG + Intergenic
1062465150 9:136677623-136677645 CTGGGGGTGGGGTGTGGAGGAGG + Intronic
1062529127 9:136992268-136992290 TTGGGGGCGGGGTCTGTGTGTGG - Intergenic
1202802862 9_KI270720v1_random:17551-17573 ATGGTGGTGGCGTGTGCCTGTGG - Intergenic
1203445530 Un_GL000219v1:51115-51137 CAGTGGGTGTGGTGTGTGTGGGG - Intergenic
1203469648 Un_GL000220v1:111002-111024 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
1203477469 Un_GL000220v1:154974-154996 GCGGTGGGGGGGTGGGTGTGCGG - Intergenic
1185883588 X:3761825-3761847 CAGATTCTGGGGTGTGTGTGTGG - Intergenic
1186683563 X:11900761-11900783 CTGGTGGTTGGGTGGTAGTGGGG + Intergenic
1186851719 X:13586605-13586627 TTGGTGGTGGGGTCTTTGGGAGG - Intronic
1186973200 X:14872640-14872662 GGGGTGGGGGGGTGTGTGTGGGG - Intronic
1187302567 X:18065287-18065309 CAGGTTGTGGTGTGTGAGTGTGG - Intergenic
1187391658 X:18890265-18890287 TTGGGGGTGGGGTGGGTGGGAGG + Intergenic
1187486767 X:19711586-19711608 GAGGTGGTGGGGTGGGGGTGGGG - Intronic
1189239987 X:39517475-39517497 CAGGTGGTTGGGTGTGTCTAGGG - Intergenic
1190265633 X:48826196-48826218 CTGTTGGTGGTGTGTGTGTGTGG - Intergenic
1190267009 X:48832538-48832560 GTGGGGGTGGGGGGTGTCTGGGG - Intronic
1190455169 X:50619863-50619885 TTGGTGGGGGTGTGTGTGAGGGG + Intronic
1190679539 X:52813103-52813125 GGGGTGGTGGTGTGTGTGTGTGG - Intronic
1190988670 X:55523040-55523062 CTGAAGGCGGGCTGTGTGTGTGG + Intergenic
1191615882 X:63168845-63168867 AAGGTTGTGGGGTGTGTTTGTGG - Intergenic
1191620416 X:63210078-63210100 AAGGTTGTGGGGTGTGTTTGTGG + Intergenic
1192141883 X:68653069-68653091 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
1192141905 X:68653295-68653317 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
1192141937 X:68653473-68653495 AGGGGTGTGGGGTGTGTGTGTGG - Intronic
1192141950 X:68653574-68653596 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
1192141969 X:68653682-68653704 TGTGTGGTGTGGTGTGTGTGTGG - Intronic
1192220155 X:69192217-69192239 CTGGTTGTGGGCTCAGTGTGAGG + Intergenic
1192292809 X:69815424-69815446 CTGGAGTTGGGGTGGGGGTGGGG + Intronic
1192440470 X:71170068-71170090 CGGGTAGTGGAGTGTGAGTGGGG - Exonic
1192486380 X:71530533-71530555 CTGGTGGGTGGGTGGGTGGGTGG + Intronic
1192560283 X:72123811-72123833 GTGGGGGTGGTGTGTTTGTGTGG - Intergenic
1194767774 X:97862445-97862467 CAGGTAGAGGGTTGTGTGTGAGG + Intergenic
1195075842 X:101326514-101326536 CTGTTGGTGGGGTGGGGGTGGGG + Intergenic
1195229545 X:102832092-102832114 TGGGTGGTGGGGTGAGGGTGGGG + Intergenic
1195525695 X:105887782-105887804 TTAGAGTTGGGGTGTGTGTGTGG + Intronic
1196566395 X:117210234-117210256 CTGGTGTTAGGGTGGGTTTGGGG - Intergenic
1196609415 X:117694846-117694868 CTTGCAGTGGTGTGTGTGTGGGG - Intergenic
1196798932 X:119524829-119524851 CTGGTGGTGGGGCCAGAGTGAGG - Intergenic
1196868473 X:120090333-120090355 CTGGAGGTGGGATTTCTGTGGGG + Intergenic
1197250848 X:124215234-124215256 CTGGTGGTGGGGTGTTGAAGTGG - Intronic
1197435779 X:126426018-126426040 CTGCTGCTGGGGTGTGGGGGAGG + Intergenic
1197732843 X:129826758-129826780 TTGGGGGTGGGGTGAGGGTGGGG - Intronic
1197763276 X:130042594-130042616 CTGTTTGTAGGGTGTGTGAGAGG + Intronic
1197882997 X:131188931-131188953 TTTGTGGTGGGGTGTGGGGGGGG + Intergenic
1198019046 X:132640379-132640401 ATGGTGGTGGGGTGGGTGGACGG + Intronic
1198087374 X:133293891-133293913 GTGGTGGTGGGATGGGTGTGGGG - Intergenic
1198122872 X:133611210-133611232 GTGTGGGTGGGGTGTGGGTGGGG + Intronic
1198978604 X:142367116-142367138 CTAGTTTTGGGGTGTGTGTGTGG - Intergenic
1199216572 X:145266120-145266142 CTGATGGTGGTGTTGGTGTGGGG - Intergenic
1199721701 X:150547262-150547284 CTGGGCATGGGGTGAGTGTGGGG + Intergenic
1199738100 X:150704357-150704379 TTGTTGGTGGGGTGGGTGTGGGG - Intronic
1199789374 X:151137729-151137751 CTGGTGATTGGCTGTCTGTGTGG - Intergenic
1199791129 X:151156235-151156257 CTGGTGTTCGTGTGGGTGTGAGG + Intergenic
1199872759 X:151913332-151913354 AAGGTGGTGGGGTGTTTGGGAGG - Intronic
1200060484 X:153481665-153481687 CTGCTGCAGGGGTGGGTGTGGGG - Intronic
1200253522 X:154566698-154566720 CTGGGGGCGGGGTGTGGGGGCGG + Intergenic
1200264245 X:154637710-154637732 CTGGGGGCGGGGTGTGGGGGCGG - Intergenic
1200711970 Y:6492895-6492917 CTTGTGTTTGTGTGTGTGTGTGG - Intergenic
1200781839 Y:7223745-7223767 CAGATTCTGGGGTGTGTGTGTGG + Intergenic
1200939388 Y:8766248-8766270 CTGTTGGTGGTGTGTCTGTGTGG - Intergenic
1201021961 Y:9669077-9669099 CTTGTGTTTGTGTGTGTGTGTGG + Intergenic
1201229093 Y:11845812-11845834 CTGGTGGTGGTGTGAGCATGAGG - Intergenic
1202128229 Y:21587238-21587260 CTTTTGGTGGCCTGTGTGTGTGG + Intergenic
1202183471 Y:22158999-22159021 CTTTTGGTGGTGTGTCTGTGTGG - Intergenic
1202207888 Y:22427402-22427424 CTTTTGGTGGTGTGTCTGTGTGG + Intergenic
1202257272 Y:22934739-22934761 CTGGTGGAGTGGAGTGGGTGTGG + Intergenic
1202410263 Y:24568486-24568508 CTGGTGGAGTGGAGTGGGTGTGG + Intergenic
1202460519 Y:25101586-25101608 CTGGTGGAGTGGAGTGGGTGTGG - Intergenic