ID: 920176394

View in Genome Browser
Species Human (GRCh38)
Location 1:204104507-204104529
Sequence CTGCCCTAAACAATAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920176394_920176397 -1 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176397 1:204104529-204104551 GCCTGAGGTTCTCAGCTCTCTGG 0: 1
1: 1
2: 1
3: 23
4: 241
920176394_920176403 18 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176403 1:204104548-204104570 CTGGGGGCTTTCAGAGGAAGTGG 0: 1
1: 1
2: 4
3: 64
4: 571
920176394_920176402 12 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176402 1:204104542-204104564 AGCTCTCTGGGGGCTTTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 225
920176394_920176401 2 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176401 1:204104532-204104554 TGAGGTTCTCAGCTCTCTGGGGG 0: 1
1: 0
2: 1
3: 22
4: 209
920176394_920176399 0 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176399 1:204104530-204104552 CCTGAGGTTCTCAGCTCTCTGGG 0: 1
1: 0
2: 1
3: 44
4: 266
920176394_920176405 30 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176405 1:204104560-204104582 AGAGGAAGTGGCATTCCCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 190
920176394_920176400 1 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176400 1:204104531-204104553 CTGAGGTTCTCAGCTCTCTGGGG 0: 1
1: 0
2: 0
3: 29
4: 304
920176394_920176404 29 Left 920176394 1:204104507-204104529 CCTTGGCCTATTGTTTAGGGCAG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 920176404 1:204104559-204104581 CAGAGGAAGTGGCATTCCCCTGG 0: 1
1: 0
2: 4
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920176394 Original CRISPR CTGCCCTAAACAATAGGCCA AGG (reversed) Intronic
903220392 1:21865934-21865956 CTGCCCAAACCAAGAGGCCAGGG + Intronic
904446171 1:30574556-30574578 CTGCACTAAATATTAGGCGATGG - Intergenic
905033669 1:34904016-34904038 CTGTCCAAAACAGTAGGTCAAGG + Intronic
908623648 1:66014895-66014917 CTTCCCTATACTCTAGGCCAGGG - Intronic
910019603 1:82570823-82570845 CAGCCCAAAACAATAGGCAAAGG - Intergenic
911656585 1:100450743-100450765 CTGACCTAAACAATTCCCCATGG + Intronic
914269118 1:146063588-146063610 CTGCCCTAAACACCAGGGCTAGG + Intergenic
914367978 1:146997277-146997299 CTGCCCTAAACACCAGGGCTAGG - Intergenic
914464354 1:147912868-147912890 ATGCCCAAAACACTAGGCCAGGG - Intergenic
914485002 1:148100931-148100953 CTGCCCTAAACACCAGGGCTAGG + Intergenic
914584965 1:149052915-149052937 CTGCCCTAAACACCAGGGCTAGG + Intergenic
915906164 1:159878885-159878907 CTGCCCTAGATAACAGGACAGGG + Intronic
916726355 1:167527068-167527090 CAGCACTAAACAATATGCGATGG - Intergenic
918413797 1:184287092-184287114 CTGCAGTCAAGAATAGGCCAAGG + Intergenic
918414260 1:184290273-184290295 CTGCAGTCAAGAATAGGCCAAGG + Intergenic
919439001 1:197603337-197603359 GTGCCCGAAACAGTAGACCATGG - Intronic
920176394 1:204104507-204104529 CTGCCCTAAACAATAGGCCAAGG - Intronic
921483087 1:215685973-215685995 GAACACTAAACAATAGGCCATGG - Intronic
1067014980 10:42751955-42751977 CTGGCCTAACCAGTAGCCCAGGG - Intergenic
1068498891 10:57818552-57818574 CTTCAGTAAAGAATAGGCCAAGG + Intergenic
1070473835 10:76812778-76812800 CTGCCCTAAATAATATGAGATGG + Intergenic
1073859569 10:107722176-107722198 CTGATCTAATCTATAGGCCATGG - Intergenic
1074693143 10:116025286-116025308 CTGCCCTCAACATCTGGCCAAGG + Intergenic
1075424063 10:122327947-122327969 CTGCCCTAAGCAGTGGGCCCCGG - Intronic
1079697852 11:23506072-23506094 CTGTCCTACACAATAGGACATGG + Intergenic
1080657509 11:34269297-34269319 CTGCCCTAAACAACAGAGCCAGG - Intronic
1086429717 11:86724878-86724900 CAGCCATAGACAATAGGCAAAGG + Intergenic
1088828543 11:113515907-113515929 CTGCCTTATACCTTAGGCCAAGG - Intergenic
1090029229 11:123193884-123193906 CTACCCTGAACACCAGGCCACGG - Intronic
1090066029 11:123504252-123504274 CTCCCCTAAGCAAGACGCCATGG + Intergenic
1091420372 12:334095-334117 CTACCCAAAGAAATAGGCCAAGG + Intronic
1091998931 12:5017445-5017467 TCCCCCTCAACAATAGGCCAAGG - Intergenic
1092094412 12:5829388-5829410 CTGCCTAAAACACTAGGCTAAGG + Intronic
1096040324 12:48509666-48509688 CTGGCCCAAACAAAAGGCAAAGG + Intronic
1096968347 12:55646597-55646619 CTGCCCAAAACAGAAGGCCCCGG + Intergenic
1100534366 12:95492812-95492834 CTGCCCTAAACTACAGACCCTGG - Intronic
1100593718 12:96053689-96053711 CTGCCCTGATCACCAGGCCAGGG - Intergenic
1101579239 12:106026989-106027011 CTGCCCTAAACACTATGGCATGG - Intergenic
1102532607 12:113557886-113557908 GTGTCCTAAAAAAAAGGCCAGGG + Intergenic
1104104523 12:125646419-125646441 GTGCTTTAAACAAAAGGCCAAGG + Intronic
1104110505 12:125700094-125700116 CTTTCCTATAAAATAGGCCAAGG - Intergenic
1107182623 13:37479243-37479265 CTAACCTAAATAATAGGCAAAGG - Intergenic
1110538207 13:76677426-76677448 CTGCCTTGACCAATAGGACATGG - Intergenic
1113786435 13:113004319-113004341 GTGCGCTCAACAAGAGGCCAAGG - Intronic
1114070427 14:19100759-19100781 CTGGCCTAACCAGTAGCCCAGGG + Intergenic
1114091834 14:19299240-19299262 CTGGCCTAACCAGTAGCCCAGGG - Intergenic
1115296379 14:31831758-31831780 GAGCCCTAAACAGTAGGCTAAGG + Intronic
1117954074 14:61109372-61109394 CTGCCCTCATCAACAGGCCCAGG - Intergenic
1119145027 14:72304269-72304291 CTGCCCTAAATAATATGAGAAGG - Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1128451603 15:67808993-67809015 CTGCCCTGAGCACTGGGCCAGGG - Intergenic
1133538364 16:6723949-6723971 TTGCCCTCAGCAATGGGCCAAGG - Intronic
1139178627 16:64719259-64719281 CTACCCAAAACAATAGGAAAGGG + Intergenic
1142587948 17:986353-986375 TTGCCCTAAATCATAGGCCATGG + Intergenic
1144358520 17:14469284-14469306 CTGTCCTAACCCATAGTCCAGGG - Intergenic
1147272015 17:39279885-39279907 CTGTCCCAAAAATTAGGCCATGG + Intronic
1155077146 18:22369032-22369054 CTGGACTAAACCAAAGGCCATGG - Intergenic
1159299303 18:66542690-66542712 CTGCCCTCACCTACAGGCCATGG - Intronic
1162044986 19:7993160-7993182 CTGCTCTAAAAAATAGTCTATGG + Intronic
1163742558 19:19024863-19024885 CTGCCGGAAAGAAGAGGCCAAGG + Exonic
1164906659 19:31973703-31973725 CTGCCATCAAAAATAGGACAGGG + Intergenic
925574645 2:5348666-5348688 CTGCCATCAAGAATAGACCAAGG - Intergenic
928789489 2:34933515-34933537 CTGCCTTAAACAATTGCCCAGGG + Intergenic
928854422 2:35787765-35787787 CTGCAGTCAAGAATAGGCCAAGG + Intergenic
928854806 2:35790456-35790478 CTGCGGTCAAGAATAGGCCAAGG + Intergenic
929458402 2:42083314-42083336 CTGCCTTAAATAATAGGCTATGG + Intergenic
929602253 2:43211676-43211698 ATGCCCTAAATGATAGGTCAGGG + Intergenic
930680056 2:54248016-54248038 CAGCCATTAACAATAGGCTATGG - Intronic
932477175 2:72013538-72013560 CTGCCTTCACCAATAGCCCAGGG - Intergenic
934858287 2:97742466-97742488 CTGCTCTGAGCAAAAGGCCAAGG + Intergenic
935273314 2:101453725-101453747 CTTCCCTCAACATTATGCCACGG + Intronic
936640458 2:114306175-114306197 CTGCCCAGAACAATAAGGCAAGG - Intergenic
937324702 2:120983517-120983539 CTGCCCAAGCCAACAGGCCAGGG - Intronic
940096553 2:149982847-149982869 CTGCCTCAAAAAATAGGCAAAGG + Intergenic
941841721 2:170092276-170092298 CCCACTTAAACAATAGGCCAAGG + Intergenic
946806539 2:223476272-223476294 CTGCCTTAAACAGTTGCCCACGG + Intergenic
1170140505 20:13121368-13121390 CTGCCCTGCACACTAGGCCCTGG + Intronic
1173034206 20:39393249-39393271 CTGCTCTAAAGAATGGGCAATGG - Intergenic
1173126058 20:40337038-40337060 CTGCATTAAACAACAAGCCAGGG + Intergenic
1180488899 22:15823323-15823345 CTGGCCTAACCAGTAGCCCAGGG + Intergenic
1184655878 22:45941896-45941918 CTTCCCTGAAGAATAGGTCAGGG + Intronic
949339067 3:3009166-3009188 TTGCCATAAACAGTGGGCCATGG + Intronic
950222252 3:11205340-11205362 CTGCCCCTATCAAGAGGCCAGGG - Intronic
954227158 3:49189560-49189582 CTGGCCTACACATTTGGCCAGGG - Intronic
954347354 3:50011455-50011477 CTCCCCTAAAAATTAGTCCAAGG - Intronic
954463612 3:50641624-50641646 CTGCCCCAAATCATAGGCCCAGG - Intronic
954526673 3:51277945-51277967 CTGCCCTAAAGAAGAGTCCTGGG - Intronic
956557048 3:70535852-70535874 CTTCCCTATACAATTGGCTAGGG - Intergenic
961949176 3:130729301-130729323 CTGCCCTAAGCACTAGAGCATGG - Intronic
962252168 3:133842059-133842081 CTGCCCTAAAGCATGGGCCTGGG + Intronic
967761277 3:193228666-193228688 CTGCCCTAGACACTACCCCAGGG + Intergenic
970626757 4:17894097-17894119 CTGCCCTAAATTAGAGACCATGG - Intronic
981106689 4:140889734-140889756 CTGCCCTAATTAATAGTCCCTGG + Intronic
983092525 4:163521624-163521646 CGGCCATACAAAATAGGCCAGGG + Intergenic
983750031 4:171256583-171256605 CTTCCCTAAACAAAAGGAAATGG + Intergenic
987081438 5:14428805-14428827 TTTCCCTAAACACTAGGTCATGG - Intronic
987856456 5:23425230-23425252 CTGCCGTCCAGAATAGGCCAAGG + Intergenic
991407936 5:66319942-66319964 CTTTCCTAAGCATTAGGCCAGGG + Intergenic
1000389574 5:160709275-160709297 GTGCCCTAAACAACATGCAAAGG + Intronic
1006936365 6:37721433-37721455 CTGCCTTAACCAATAGGACATGG - Intergenic
1007578743 6:42942613-42942635 CTGCCCTCAAGACTGGGCCAGGG - Intergenic
1011115387 6:83885014-83885036 ATGTCCTAAACAATAGTCCTTGG - Intronic
1012372947 6:98529458-98529480 CTGCAGTCAAGAATAGGCCAAGG + Intergenic
1016424749 6:143922801-143922823 CTGCCATAAACAAGAGGATATGG + Intronic
1018093851 6:160367777-160367799 CTGCCATGAACAAGAGGCCCAGG + Intronic
1019146118 6:169976585-169976607 ATGCTCTGAACAATAGGACACGG + Intergenic
1020713220 7:11635671-11635693 CTGCTCTAAACAACAACCCAGGG - Intronic
1023122750 7:36925914-36925936 CTGCACTGAAAAAGAGGCCAAGG - Intronic
1024603052 7:51002340-51002362 TTTCTCTAAACAGTAGGCCAGGG + Intergenic
1028093693 7:86733996-86734018 CTGCAGTCAAGAATAGGCCAAGG - Intronic
1029325644 7:99806355-99806377 CTGACTTAAAAAATAGGCAAAGG + Intergenic
1029852302 7:103475806-103475828 GTGCCCTAAAAACTAGTCCAAGG + Intronic
1043012649 8:74900373-74900395 GTGCCCTATACCATAGGACATGG + Intergenic
1047018458 8:120748743-120748765 CTGCCCTACACAATAAAACAAGG - Intronic
1050044985 9:1533746-1533768 CTGGCCTAAGGAATATGCCAAGG - Intergenic
1050143629 9:2542357-2542379 CTGCCATACACAATAGGCCCTGG + Intergenic
1054927094 9:70600497-70600519 CTGCCCTAAGCCCTAGCCCAGGG + Intronic
1055124709 9:72705862-72705884 CTCCCAGAAACAATAGGTCAGGG - Intronic
1058267910 9:102929393-102929415 CTGCCCTTAAAATCAGGCCATGG - Intergenic
1061909936 9:133717088-133717110 CTGCCCCAAGCACGAGGCCAGGG - Intronic
1062125691 9:134860668-134860690 CTGCCAAAAACAAAAGGTCAAGG + Intergenic
1186770217 X:12810938-12810960 CTCCCCTAAACCAAAGGCCGAGG - Intronic
1189849665 X:45165985-45166007 CTGCCCTAAGCAAGTGGCCATGG - Intronic
1190384861 X:49875152-49875174 CTGCCCTAAACAATAGAGTACGG + Intergenic
1195254274 X:103077987-103078009 TTGCCCTTTACAATAGCCCAAGG + Intronic
1196535362 X:116837786-116837808 CTGCCCTAAAGAGAAGGACATGG - Intergenic