ID: 920176471

View in Genome Browser
Species Human (GRCh38)
Location 1:204104860-204104882
Sequence CTGTCGTTGTGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920176471 Original CRISPR CTGTCGTTGTGGAGGGAGGA AGG Intronic
900398057 1:2461362-2461384 CTGTCCTTCAGCAGGGAGGAGGG + Intronic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
900921789 1:5676982-5677004 CGGACGTTGGGGAGGGAGGAGGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901143332 1:7049906-7049928 CTGATGTTCTGGTGGGAGGAGGG + Intronic
901209865 1:7518658-7518680 CTGGCCTGGTGCAGGGAGGATGG + Intronic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901862212 1:12081509-12081531 CTCTCCTACTGGAGGGAGGAGGG + Intronic
903056441 1:20639439-20639461 TTGTCGTGGGGGATGGAGGAAGG + Intronic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905911946 1:41661547-41661569 CTGTCATTATGCCGGGAGGAGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907653041 1:56314335-56314357 CTGGTGTTGTAGATGGAGGAAGG + Intergenic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908942179 1:69448287-69448309 CTGTTGTGGTGGTGGGAGGTGGG + Intergenic
910205170 1:84742531-84742553 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910400438 1:86832705-86832727 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910559821 1:88578397-88578419 CTTTCTTTGTGGTGGGAGGCAGG - Intergenic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
914050115 1:144124457-144124479 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
914129067 1:144840994-144841016 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
914381448 1:147120007-147120029 CTGTCATTGTGGAGGTATGGAGG + Intergenic
914940807 1:152021442-152021464 CTGTCATTGTGGAGGTATGGAGG - Intergenic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
917232422 1:172852535-172852557 CTGTCGGTGGGGTGGGAGGTTGG - Intergenic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918678366 1:187319381-187319403 CTTTCTTTATGGAGTGAGGAGGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922852285 1:228743360-228743382 CTGACGTTCTGGAAGGATGAGGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063502026 10:6563842-6563864 GTGCAGTTGGGGAGGGAGGAAGG + Intronic
1065504781 10:26418952-26418974 CTGTCGTGGGGGAGGGGGAAGGG - Intergenic
1065908171 10:30278116-30278138 CTGTCGGTGGGTAGGGAGAAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067454250 10:46404938-46404960 CTGCCTTTGAGGATGGAGGAAGG - Intergenic
1067632953 10:47979694-47979716 CTGCCTTTGAGGATGGAGGAAGG + Intergenic
1067695911 10:48535560-48535582 CTGTCTTACTGCAGGGAGGATGG + Intronic
1069081301 10:64090834-64090856 ATGTCTTGGTGGAGGTAGGAAGG + Intergenic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074150334 10:110753846-110753868 CTGTCTTTGAGGATGGAGAAGGG - Intronic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1075520946 10:123143180-123143202 CGGCCGTTGTGCAGGGTGGATGG + Intergenic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076779643 10:132717152-132717174 CTCACGTGGTGGAGGGAGGGAGG + Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077549389 11:3193361-3193383 CTGGCGTTGTGCAGGGAAGGGGG - Intergenic
1077618422 11:3696495-3696517 CTGTCTTGGTGCAGGGGGGAGGG + Intronic
1078873996 11:15375844-15375866 CTGTCCTTGTGAAGGGAGAATGG + Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1080888956 11:36391953-36391975 GGGTAGTTGTGGTGGGAGGAAGG - Intronic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082757807 11:57095423-57095445 GTATTGATGTGGAGGGAGGAGGG + Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084737157 11:71112969-71112991 CTGGCGTGGTGGAGGGAAGCGGG - Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089614098 11:119685504-119685526 CTGTCCTGCTGGAGGGAGGTGGG - Intronic
1090005520 11:122998943-122998965 CTGCTGTTGTGGTGGGAGCAGGG - Intergenic
1091312142 11:134582163-134582185 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1091783006 12:3225671-3225693 CTGTTATTGTGGAGGGCGGGGGG - Intronic
1091784911 12:3237499-3237521 GTGTCCTTGGTGAGGGAGGAGGG - Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092182173 12:6453330-6453352 CTGTCCTGGTGGAGGGAGCCCGG - Intronic
1093234408 12:16588874-16588896 CTGTTGTTATGAAGGGAGAATGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1097903019 12:64891909-64891931 CTCACATTGAGGAGGGAGGAGGG + Intergenic
1097953302 12:65456839-65456861 TTGCCCTTGTGGATGGAGGAGGG + Intronic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098957944 12:76706841-76706863 CTGTAGTTTTGGGGAGAGGAAGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100670151 12:96802825-96802847 CTGTCGGTGGGTAGGGAGCAGGG - Intronic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103074166 12:117968954-117968976 ATGTCGGTGTGGAGCGAGGCAGG - Intronic
1103601828 12:122059377-122059399 CTGTCCTTGGGGAGGCAGGCGGG + Exonic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1103936151 12:124478000-124478022 CTGTCATTGTGGCCGGAGTAGGG - Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104520727 12:129472426-129472448 CTGTCGTTGGGTTGGGGGGACGG + Intronic
1104667693 12:130659004-130659026 CTGGCATGGTGGAGGGAGGGAGG - Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1106735373 13:32583674-32583696 CTGGCTTTGCGGATGGAGGAAGG + Intergenic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107461836 13:40611730-40611752 CTGTAGCTGTGATGGGAGGAGGG - Intronic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1112821251 13:103338805-103338827 CTGGCGTGGTGGAGGGATGAAGG - Intergenic
1113522435 13:110950400-110950422 CAGGAGTTGTGTAGGGAGGAAGG + Intergenic
1114462613 14:22897061-22897083 CTCTCCTGGTGGAGTGAGGAAGG + Intergenic
1114773300 14:25453360-25453382 CTGAAGTTGTGGGGGAAGGAAGG - Intergenic
1115519960 14:34223536-34223558 CTCTAGTTTTGGAGGGAGGCAGG - Intronic
1116739739 14:48739272-48739294 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1118467225 14:66041933-66041955 CTGTCGTGGGGTAGGGGGGAGGG + Intergenic
1119651474 14:76387047-76387069 CTGTCCTTGTGTGGGGAGGTAGG - Intronic
1119774180 14:77238382-77238404 CTGCTGTGGTGAAGGGAGGAAGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121727571 14:96164443-96164465 TTGTCTTTGAGGATGGAGGAGGG + Intergenic
1123419978 15:20123720-20123742 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123529199 15:21130256-21130278 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1127156637 15:56134761-56134783 CTGTTGTTGGGGAGGGCGGTAGG - Intronic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1128869082 15:71138648-71138670 TTGGCCTTGTGGAGGGGGGAGGG - Intronic
1128890888 15:71330955-71330977 CTGGCCTTGTCGAGGAAGGAGGG + Intronic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1129855732 15:78823521-78823543 ATGTCCTTCTGAAGGGAGGAAGG + Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132536973 16:487028-487050 CTGTCACTGTGTAGGAAGGAAGG + Intronic
1132614796 16:835208-835230 CTCGTGTTGTGGAGGGAGGTGGG + Intergenic
1132641106 16:979031-979053 CTGGCCTTGTGGAGGGAGGCAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1135040425 16:19113851-19113873 CTGCCTTCGGGGAGGGAGGATGG + Intergenic
1135568162 16:23528040-23528062 CTCACGTGGTGGAGGGACGAGGG - Intronic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1138262758 16:55637085-55637107 CTGTCCTTGGTGAGAGAGGAGGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139201741 16:64984419-64984441 ATCTTGTTTTGGAGGGAGGAAGG - Intronic
1139918206 16:70441010-70441032 CTTTTAATGTGGAGGGAGGAGGG - Intergenic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1141570258 16:84929763-84929785 CTGTTGTCGTGGCGGGAGGTTGG + Intergenic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142012050 16:87720498-87720520 CTGTGGTTGTGTGGTGAGGAGGG - Intronic
1142157777 16:88540429-88540451 CTGTCCTTGGGCAGGGAGCAGGG + Intergenic
1142369669 16:89671553-89671575 CTGTCGTGGGGTAGGGGGGAGGG - Intergenic
1142832808 17:2561915-2561937 CTTACGTTGTGAAAGGAGGATGG + Intergenic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143058973 17:4184297-4184319 TTGTCCTTCTGGAGGGAGGTTGG - Intronic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144673297 17:17145165-17145187 CTGTCTCTGAGGAGTGAGGAAGG - Intronic
1144717472 17:17444511-17444533 CTGTCCCTGGGAAGGGAGGAAGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148615678 17:48998168-48998190 CCGTCGGTGGGGAGGAAGGATGG - Intronic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148974995 17:51519836-51519858 CTGACGTTGGGGTGGGAGGCAGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1153479810 18:5535856-5535878 CTGTTGTTGAGGACGAAGGAAGG + Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1157534491 18:48448364-48448386 CAGTCATGGTGGAAGGAGGAGGG - Intergenic
1157874190 18:51256640-51256662 ATGTGGTGGTGGGGGGAGGAGGG + Intergenic
1157881900 18:51328721-51328743 CTGGCGTTGAGGATGGAGGAAGG - Intergenic
1158823864 18:61192113-61192135 CTCTAGTTGGGGGGGGAGGAGGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159695075 18:71546797-71546819 CTGTCGTTGGGGGTGGAGTAGGG + Intergenic
1159732799 18:72052529-72052551 CTGTCCTTGTGGATGTATGAAGG + Intergenic
1160335976 18:78039996-78040018 CTGGCCTTGAGGATGGAGGAGGG - Intergenic
1160622669 18:80181624-80181646 CAGTCGCTGATGAGGGAGGATGG - Intronic
1161325354 19:3661078-3661100 CCTTCGCTGTGGAGGAAGGACGG + Exonic
1161853916 19:6753122-6753144 GAGTCGTTTTGGAGGGAGCAGGG + Intronic
1162066040 19:8126095-8126117 TTGTCCTTGAGGAGGAAGGAAGG + Intronic
1162639531 19:11997227-11997249 CTTTCTTTGGGGAGGAAGGAGGG - Intergenic
1163025240 19:14507188-14507210 CTGGCATAGGGGAGGGAGGATGG - Intergenic
1163223337 19:15937264-15937286 CTGTCCTTGCAGAGGGAGTAGGG - Intergenic
1164050691 19:21583884-21583906 CTGTCCTGGAGGAGGGAGAAAGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166791932 19:45403893-45403915 CTGTCCTTGAGGCGGGGGGAGGG - Intronic
1167005644 19:46774983-46775005 CTGTTATTGTGGAGGGAATAGGG + Exonic
1167469048 19:49665327-49665349 CTGTCCTGGAGGAGGGAGGCGGG - Exonic
1202689504 1_KI270712v1_random:77020-77042 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
926092380 2:10059189-10059211 CTGCCCTGGTTGAGGGAGGACGG + Intronic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928686888 2:33759242-33759264 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
932670237 2:73731195-73731217 CATTCATTTTGGAGGGAGGAGGG - Intronic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
933293762 2:80467227-80467249 CTGTCTTTGTGCATGAAGGATGG - Intronic
933956930 2:87379072-87379094 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934241051 2:90270962-90270984 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934272127 2:91545723-91545745 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
936148108 2:109995349-109995371 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
936196585 2:110376099-110376121 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
937209983 2:120262255-120262277 GTGACATTGGGGAGGGAGGAAGG + Intronic
938257221 2:129868715-129868737 CTCTCCTTCTGGAGGGAGGATGG - Intergenic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
940911855 2:159216395-159216417 CTGTTCCTCTGGAGGGAGGAAGG - Intronic
945007402 2:205423319-205423341 CTATCCTTTTGGAGGTAGGAGGG + Intronic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946714000 2:222534142-222534164 TTGTGTTTGTGGAGGAAGGAGGG + Intronic
947242833 2:228015067-228015089 CTGTTGTGGGGGAGGGGGGAGGG - Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
948656503 2:239479775-239479797 CTGTCCTTGTGTAGGGAGCAGGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1172886630 20:38235552-38235574 CTGGCTTTGAGGATGGAGGAAGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175504390 20:59471204-59471226 CTGTCGTGTTGGAGGGGGCACGG + Intergenic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1179034473 21:37747688-37747710 CTGGCTTTGAGGGGGGAGGAGGG + Intronic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181352112 22:22266482-22266504 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1182067922 22:27443505-27443527 CTCTCCTTGAGGAGGGAGGGTGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182309579 22:29395072-29395094 CATTCATTGTGGAGGGAGGATGG - Intronic
1182883414 22:33753348-33753370 CTGGCCTTGGGGATGGAGGAAGG + Intronic
1183732339 22:39625691-39625713 AGGTGGTTGGGGAGGGAGGAAGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
1185230304 22:49676920-49676942 CTGGCATTGGGGAGGGAGGCTGG - Intergenic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950483857 3:13261284-13261306 CGGTCGATGTGGAGGGACAAAGG + Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954198245 3:49008605-49008627 CTGTCATTTTGGGGGAAGGAGGG + Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955234112 3:57124507-57124529 CTGGTTTTGTGGATGGAGGAAGG + Intronic
956606641 3:71079485-71079507 TTGTCTGTGTCGAGGGAGGATGG - Intronic
956875770 3:73461564-73461586 CTGTTGTTGTAGGGTGAGGATGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959349835 3:105248305-105248327 CTCACGTGGTGGAGGGAGCAAGG - Intergenic
964144449 3:153441985-153442007 CTTTCCTGGGGGAGGGAGGAAGG - Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966758599 3:183394408-183394430 GTCTGGTTGTGGAGGTAGGAGGG - Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
972420986 4:38886119-38886141 GTCTTGCTGTGGAGGGAGGATGG + Intronic
972945176 4:44244838-44244860 CTGTAGTTGTGGGGGGGGGGGGG + Intronic
973345167 4:49047356-49047378 CTATGCTGGTGGAGGGAGGATGG + Intronic
974443937 4:61954723-61954745 CTGTCCTTGTGGTGGTGGGATGG - Intronic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
976184548 4:82430779-82430801 CTGCTGTTGGGGAGGGCGGAGGG - Exonic
977637538 4:99317002-99317024 CTGTTATGGTGGAGGGAGTAGGG + Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
977697871 4:99987005-99987027 TTGTCGTTGTGGTAGGTGGAGGG + Intergenic
981202375 4:141995773-141995795 ATGTTGCTGTGAAGGGAGGAGGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983855939 4:172644889-172644911 CTGCCATTGTGGTGGGTGGATGG + Intronic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986290079 5:6392789-6392811 CTAGCTTTGTGGATGGAGGAGGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987626413 5:20406427-20406449 CTGTTGTGGGGGAGGGGGGAGGG + Intronic
988100031 5:26663338-26663360 CTTTCTTTTTGGGGGGAGGAAGG + Intergenic
988255270 5:28810623-28810645 CTTTCCTTCTGGAGGGCGGAGGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
991416351 5:66396783-66396805 GTGTCTTTGTGGCGGGACGAAGG + Intergenic
992950176 5:81850852-81850874 CTGTCGTGGGGGTGGGTGGACGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994497678 5:100534745-100534767 CTGTCGTGGGGTAGGGGGGAGGG - Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999202571 5:149826658-149826680 CTGTCAATCTGGAGTGAGGAGGG - Exonic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1001270575 5:170308392-170308414 TTGTCATTGTGGAGGGACAAAGG + Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1002192045 5:177483462-177483484 CTGTGGTGGTGGAGGGAGTGGGG + Exonic
1002466615 5:179411907-179411929 CGGTTGTGGGGGAGGGAGGAAGG - Intergenic
1002466688 5:179412070-179412092 CGGTTGTGGGGGAGGGAGGAAGG - Intergenic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466938 5:179412646-179412668 CGGTTGTGGGGGAGGGAGGAAGG - Intergenic
1005231350 6:23705058-23705080 CTGACATTGTGGAGGAAGCAAGG - Intergenic
1005699409 6:28384987-28385009 CTGGCCTTGTGGAGTTAGGAGGG + Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006639738 6:35483773-35483795 CTGATGTGGTGGAGGGAGGGTGG - Intronic
1006940879 6:37751609-37751631 CTGTCACTGTGGAGGGGGAAAGG + Intergenic
1008357006 6:50566547-50566569 CTTTCCTTGGGGAGGGACGAAGG - Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011031413 6:82927877-82927899 CAGTAGTTGTGGGGGGAGGAAGG + Intronic
1011228448 6:85133752-85133774 CTGACTTTGTGAAGAGAGGAGGG - Intergenic
1011801959 6:91027204-91027226 CTGTCATTGTGGCTGGAGCAGGG + Intergenic
1013639256 6:112057376-112057398 AAGTCATTCTGGAGGGAGGAAGG + Intronic
1014629551 6:123772188-123772210 CTGTCGTTTAGGAGGAGGGAGGG - Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017548571 6:155479442-155479464 CTGCACTTGTGGAGGGAGGGAGG + Intergenic
1017883845 6:158582326-158582348 CTGTCTTAGTGAAGTGAGGATGG - Intronic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018786527 6:167112654-167112676 CTGGCTTTGTGCAGGGAGGTTGG + Intergenic
1019341419 7:510645-510667 CTGTGGTGGTGGATGCAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021835871 7:24674159-24674181 AGGTCATTGTGGAGGGAAGAAGG - Intronic
1022968025 7:35492607-35492629 CAGACTTTGTGGAGGAAGGAAGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1026852645 7:73734875-73734897 CTCTTGTGGTGAAGGGAGGAAGG + Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030638698 7:111979556-111979578 CTGGCGGGGTGGAGGGGGGATGG - Intronic
1032195614 7:129786631-129786653 CTCTCGTTGCGCAGGGTGGAGGG + Intergenic
1032987654 7:137356655-137356677 CTGTCCAGGTGGTGGGAGGAGGG - Intergenic
1033116824 7:138632710-138632732 AGGGGGTTGTGGAGGGAGGATGG + Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034499428 7:151440205-151440227 CTGGAGTGGTGGGGGGAGGAGGG + Intronic
1035115424 7:156519379-156519401 CCGTCCTTGTGCAGGGATGACGG + Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1035318107 7:158010082-158010104 CTGTCCTTGTGGAGGAGGCAGGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041953658 8:63533299-63533321 AAGACATTGTGGAGGGAGGAAGG - Intergenic
1042295808 8:67216329-67216351 CTCACGTGGTGGAAGGAGGAGGG - Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046483467 8:114854090-114854112 CTGTCGTGGTGGGGGGAGGGGGG - Intergenic
1047748910 8:127865553-127865575 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048788092 8:138073405-138073427 CTGTCGTTGTAGGGAGAGGCAGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1053062082 9:35039996-35040018 CTGTAGTTTTGGATGGAGGTTGG - Intergenic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1055583860 9:77735670-77735692 CTGTTGTTGGGGCGGGAGGTGGG + Intronic
1056485077 9:87047737-87047759 CTGTTGTGGGGGAGGGGGGAAGG + Intergenic
1056741357 9:89258064-89258086 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057009596 9:91589725-91589747 TTGGCGCTGTGGAGGGAGCAGGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057620378 9:96629294-96629316 CTGTAGTTGTGGAAGGGTGAAGG + Intergenic
1058506348 9:105669896-105669918 CTGGAGTTGGGGAGGAAGGAGGG + Intergenic
1058991420 9:110257561-110257583 CTGGCCTTGTGGAGCCAGGAGGG + Intergenic
1060078111 9:120613340-120613362 TTGTCTCTGTGGAGGGAGGGGGG + Intronic
1060093359 9:120764563-120764585 CTGGTGTTGTGGAAGGAGCACGG - Exonic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061728077 9:132592216-132592238 CTGTCGCTGTGGGGGGAGTGGGG - Intergenic
1185669087 X:1791596-1791618 CAGTCGTTTTGTGGGGAGGAAGG + Intergenic
1186489345 X:9959436-9959458 CTGGCTTTGCGGATGGAGGAAGG - Intergenic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1186982190 X:14969138-14969160 CTGTCGTGGGGGAGAGAGGAGGG - Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1190392126 X:49942551-49942573 CTGTCGTGGGGTAGGGGGGAGGG - Intronic
1190630899 X:52384847-52384869 CTGTTGTTGGGTGGGGAGGAGGG + Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1193248429 X:79258957-79258979 GTGTCTTTGTGGAGAGAGGTAGG + Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193609240 X:83609116-83609138 CTGTCATGGTGTTGGGAGGAGGG - Intergenic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196339773 X:114583334-114583356 CAGTCGTTGTGGGGGAGGGAGGG - Intergenic
1198126857 X:133653408-133653430 TTGTCATTCTGGAAGGAGGAAGG + Intronic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199791625 X:151160863-151160885 CTGTCCCAGTGGAGGGAGGCAGG - Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1201427104 Y:13863779-13863801 CTCTCGTTGTGCAGGCTGGAGGG + Intergenic