ID: 920176905

View in Genome Browser
Species Human (GRCh38)
Location 1:204107711-204107733
Sequence CCCAGAGTTGCTCTCCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920176898_920176905 -8 Left 920176898 1:204107696-204107718 CCCCCAAAGGTGAGACCCAGAGT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
920176893_920176905 6 Left 920176893 1:204107682-204107704 CCCAGGGACCCTCTCCCCCAAAG 0: 1
1: 0
2: 1
3: 17
4: 247
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
920176900_920176905 -10 Left 920176900 1:204107698-204107720 CCCAAAGGTGAGACCCAGAGTTG 0: 1
1: 0
2: 2
3: 9
4: 140
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
920176897_920176905 -3 Left 920176897 1:204107691-204107713 CCTCTCCCCCAAAGGTGAGACCC No data
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
920176899_920176905 -9 Left 920176899 1:204107697-204107719 CCCCAAAGGTGAGACCCAGAGTT 0: 1
1: 1
2: 1
3: 13
4: 181
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
920176894_920176905 5 Left 920176894 1:204107683-204107705 CCAGGGACCCTCTCCCCCAAAGG 0: 1
1: 2
2: 0
3: 21
4: 254
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
920176896_920176905 -2 Left 920176896 1:204107690-204107712 CCCTCTCCCCCAAAGGTGAGACC 0: 1
1: 0
2: 0
3: 16
4: 155
Right 920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920176905 Original CRISPR CCCAGAGTTGCTCTCCATTG GGG Intronic
900657319 1:3765306-3765328 CCCAGAGTTGTGCTTTATTGAGG + Intronic
900727323 1:4225373-4225395 GACAGAGGTGCTCACCATTGTGG - Intergenic
902798595 1:18815475-18815497 CCCAGAGCTGCTGGCCATGGGGG + Intergenic
903287620 1:22286614-22286636 CACAGCCTTGCTCTCCAGTGAGG + Intergenic
913550013 1:119907952-119907974 CCCAGAGAGGCTCTCCAGTGTGG - Intergenic
917597268 1:176541792-176541814 CCAAGAGTTGTTCTCCATTTTGG + Intronic
917926229 1:179791292-179791314 CACAGGCTTGCTCTCCATGGAGG - Intronic
920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG + Intronic
920889419 1:209969315-209969337 CTCAGAGTTGCTTTCCATGGTGG + Intronic
1068564896 10:58563447-58563469 CCAAGAGGAACTCTCCATTGTGG - Intronic
1069223075 10:65907547-65907569 ACCAGTGTGGCTCTCCTTTGTGG + Intergenic
1069662224 10:70131496-70131518 CCCAGAGCTGCCCTCCCCTGGGG - Intronic
1071532017 10:86397440-86397462 CCAGCAGTTGCTGTCCATTGTGG - Intergenic
1075179474 10:120196875-120196897 CCCAGAGATTTTCTCCAATGTGG - Intergenic
1076412852 10:130264194-130264216 CCCACAGTTTCTCTCTCTTGAGG + Intergenic
1076979487 11:197059-197081 CCCAGAGTTGCTGTCCATGCTGG - Intronic
1077329343 11:1977104-1977126 CCCGGTTTAGCTCTCCATTGTGG + Intronic
1078464940 11:11543397-11543419 TCCAGAGTGGGTCTCCATCGAGG - Intronic
1079248997 11:18773507-18773529 CCCAGAGGGGCTCTTCAGTGGGG + Intronic
1080051163 11:27860437-27860459 CCCAGGGTTGTTTTCCATTCAGG - Intergenic
1080052335 11:27870142-27870164 CACAGACTTGCTCTCCCTTCAGG - Intergenic
1080838713 11:35964628-35964650 CCCAGATTTGGACACCATTGAGG + Intronic
1084373073 11:68757431-68757453 TCCAGACTTGCCCTCCCTTGGGG - Exonic
1089418572 11:118314202-118314224 CCCATTGTTTCTCTCCATAGGGG - Intronic
1090701000 11:129295622-129295644 CACAGAGTTTCTCCCCAGTGTGG + Intergenic
1202812322 11_KI270721v1_random:32283-32305 CCCGGTTTAGCTCTCCATTGTGG + Intergenic
1095832558 12:46603498-46603520 CCCAGAGTCACTCACCAGTGTGG + Intergenic
1097899386 12:64857848-64857870 CACAACTTTGCTCTCCATTGTGG + Intronic
1101651498 12:106681511-106681533 ACCAGCGTTGCTCCCCATGGGGG - Intronic
1108152269 13:47548396-47548418 TTCAGAGTTGCCCTCGATTGAGG - Intergenic
1109356259 13:61232880-61232902 CCCAGAGAGGTTCTCCAGTGTGG + Intergenic
1110987596 13:81990830-81990852 CTCAGAATGGCTTTCCATTGTGG - Intergenic
1114707483 14:24741972-24741994 TCCAGAGATGTTCTCCATTGTGG + Intergenic
1115695966 14:35898704-35898726 GCCAGAGGTGCTCGCTATTGTGG - Intronic
1122344742 14:101051466-101051488 CCCGGAGTTGCCCTCCCTTCTGG - Intergenic
1122765773 14:104068784-104068806 CCCAGAGTTCCTTTCATTTGCGG + Intergenic
1125430556 15:39589231-39589253 CACACCGGTGCTCTCCATTGTGG - Exonic
1132908309 16:2295631-2295653 CCCAGCGCTGCTCTCCAGCGTGG + Exonic
1134671263 16:16056925-16056947 GCCATAGTTGATCTACATTGTGG + Intronic
1140388381 16:74562887-74562909 CCCAGAGTTTTGCTTCATTGTGG - Intronic
1141126887 16:81407309-81407331 CCAAGAGTTGCTCACCATTTTGG - Intergenic
1142296521 16:89226702-89226724 CACAGAGCTGCCCTCCATTGTGG - Exonic
1144823638 17:18092887-18092909 CCTAGAGCTGCTCACCATTCTGG - Intronic
1153483469 18:5571714-5571736 ACCACAGTGGCTATCCATTGAGG + Intronic
1158814631 18:61079928-61079950 CCAAGAGTTGGTCTCCAAAGAGG - Intergenic
1160327592 18:77965401-77965423 GGCAGAGTTGCTTTCCAGTGAGG + Intergenic
1162253573 19:9468304-9468326 CATAGAGTTCCTCTCCATTTTGG + Exonic
1162265155 19:9567079-9567101 CACAGAGTTCCCCTCCATTGTGG + Exonic
1162275776 19:9653533-9653555 CACAGAGTTTCTCTCCAATGTGG + Exonic
1162280257 19:9690923-9690945 CACAGAATTTCTCTCCAATGTGG + Exonic
1166764700 19:45245689-45245711 CCCAGAGCTGCTCTCCAGCATGG + Intronic
1168053524 19:53847725-53847747 ACCAGAGATGCTCTCCTTGGAGG + Intergenic
927919920 2:26964308-26964330 CCCTGAGTTGCTCGGCATTCTGG + Intergenic
929267068 2:39929910-39929932 CTCAGGGTTTCTCTCCACTGTGG - Intergenic
931875596 2:66508437-66508459 CCCAGAGTTTCACTTCAATGAGG + Intronic
932712809 2:74080436-74080458 CCAAAAGTTGTTCTCCTTTGGGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
941502278 2:166294617-166294639 TCCAAAGATGCTCTCCTTTGTGG - Exonic
942514552 2:176738113-176738135 TCCAGAGATGCGCTACATTGAGG - Intergenic
943114966 2:183657320-183657342 CCCAGAGTTGATCACCAGTGGGG + Intergenic
1170926421 20:20728719-20728741 CCCAAAGTTTGTCTCCATGGAGG - Intergenic
1172634381 20:36400229-36400251 CCAAGAGTTGGTCACCATTTTGG + Intronic
1173582091 20:44154637-44154659 CCCGGGCTTTCTCTCCATTGTGG - Intronic
1176924751 21:14734438-14734460 CCTAGAGTAGCGCTGCATTGTGG - Intergenic
1177129329 21:17237326-17237348 TCCTGAGTTGATCTCCACTGGGG - Intergenic
1180976026 22:19848921-19848943 CCCAGAGTTGCTCTCTAGGATGG - Exonic
1181719260 22:24761312-24761334 CCCCCACTTGCTCTCCTTTGTGG - Intronic
1182395018 22:30029021-30029043 CCCAGAGAAGCTTTCCATTTAGG - Intronic
1184783492 22:46660632-46660654 GGCAGAGATTCTCTCCATTGTGG + Intronic
952963389 3:38606634-38606656 CCCACACTTGCTGTCCCTTGTGG + Intronic
956088741 3:65641205-65641227 CACAGAGCTGCTCTCTCTTGGGG + Intronic
960862909 3:122169448-122169470 CCCTGTGTTGCTTTCCACTGTGG + Intergenic
966087077 3:176080669-176080691 CCCAGAGCTGCACTTCAGTGTGG + Intergenic
970117497 4:12713169-12713191 CCCTGAGATGCCCTCCAATGGGG + Intergenic
972243234 4:37216949-37216971 CAGAGAGTTGCCCTCCATTTGGG + Intergenic
973050161 4:45586102-45586124 CCAGGAGGAGCTCTCCATTGTGG - Intergenic
973541979 4:51944103-51944125 CTGAGAGTTCCTCTCCATTTTGG - Intergenic
978085060 4:104641605-104641627 CCCAGTGCAGCTGTCCATTGAGG - Intergenic
978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG + Intergenic
980206507 4:129725624-129725646 CCCAGAGGTGCTCTCCAAAATGG - Intergenic
981317875 4:143359159-143359181 CCCAGGGTTGGCCTCCTTTGGGG + Intronic
988480492 5:31626417-31626439 CCCAGACCTGCTCTAAATTGGGG + Intergenic
988919795 5:35929767-35929789 CCCAGATTTGCTCTGCACTCCGG - Intronic
989565075 5:42893994-42894016 CCCAGGCTTGCTCTCGATTCAGG - Intergenic
989565783 5:42899429-42899451 CCCAGACTTGCTCTCGGTTCAGG + Intergenic
990344458 5:54857689-54857711 CACAGAGTTTCTCACCAGTGTGG - Intergenic
994865515 5:105264191-105264213 ACCTGAGTTGTTCTTCATTGGGG + Intergenic
996019707 5:118577775-118577797 CCCAGAAATGCTCTCCAGAGTGG + Intergenic
996142797 5:119933374-119933396 TCCAGAGTTGTTCTCCAGTAAGG + Intergenic
999151740 5:149430761-149430783 CCCACAGTTGCCCCCCAATGGGG + Intergenic
999473491 5:151877024-151877046 ACCAGAGTTGGTCTCTAGTGAGG - Intronic
1000712141 5:164593682-164593704 CCCAGAGTTGCTCTAAACTTAGG - Intergenic
1003161126 6:3635706-3635728 TCCCTAGTTGCTCTCCAGTGGGG - Intergenic
1005677201 6:28166921-28166943 CATAGGGTTTCTCTCCATTGTGG - Intergenic
1005960514 6:30689979-30690001 CCCACACTTGGTCTCCCTTGGGG + Intronic
1007336834 6:41160470-41160492 CCCAGATTTGTTCTCCTTTGGGG + Intronic
1009324822 6:62337638-62337660 CCCTGAGCTGCTCTCCATGTTGG - Intergenic
1014378657 6:120711203-120711225 CCCAGTGTTGCTTTCCGCTGTGG - Intergenic
1016060982 6:139629778-139629800 CTCTGAGTTGTTCTCTATTGTGG + Intergenic
1016170157 6:141004502-141004524 CCCAGTGGAGCTCTCTATTGAGG + Intergenic
1017077569 6:150633081-150633103 AACAGATTTGCTCTCCTTTGAGG + Intronic
1019160064 6:170063552-170063574 CCCAGAGTTGCTTCCCAGGGAGG - Intergenic
1019894514 7:3973142-3973164 CCCAGGGTTGCTCTGCCCTGAGG + Intronic
1022281110 7:28910658-28910680 CTCAGGATTGCTTTCCATTGTGG + Intergenic
1023920159 7:44622966-44622988 CGTAGAGTTGCTCACCATGGAGG + Intronic
1024015767 7:45312589-45312611 CCCAGAGAGGCTCCCCAGTGTGG - Intergenic
1030080513 7:105773979-105774001 CCCAGAGCTGCCCTCCTCTGTGG - Intronic
1031535807 7:122931994-122932016 CCCAGAGATGGTCCCCACTGTGG + Intergenic
1032938201 7:136758262-136758284 CCCAGGGTTGCCATCAATTGAGG + Intergenic
1045026631 8:98093139-98093161 CCCACAGTTTGTCTCCAATGGGG - Intronic
1045783666 8:105897175-105897197 CCTGGGGTTGCTATCCATTGAGG - Intergenic
1048182988 8:132213425-132213447 CCCAGAGTTGGTCTCCTTGAAGG + Intronic
1048930547 8:139312068-139312090 GTCAGAGTGGCTCTGCATTGAGG + Intergenic
1049555987 8:143282448-143282470 CACAGTGTTCCTCTCCAGTGGGG - Intergenic
1049582666 8:143419990-143420012 CCCAGAGCTGCCATCCATGGGGG - Intronic
1049705219 8:144039004-144039026 CCCACAGTTAGTCTCTATTGAGG - Intronic
1049814352 8:144591219-144591241 CACAGAGCAGCTGTCCATTGGGG - Intronic
1053259142 9:36646598-36646620 CCCTGAGTGGCTCTGGATTGTGG + Intronic
1053494636 9:38541380-38541402 CCCACCGTGGCTCTTCATTGCGG - Exonic
1054818515 9:69498400-69498422 CTCACAGTTTCTCTCCATTAGGG - Intronic
1060222977 9:121774161-121774183 CCCAGAGTTGCTTGTCCTTGTGG + Intronic
1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG + Exonic
1190939669 X:55028210-55028232 GCCAGAGTTTATCGCCATTGGGG + Intronic
1196388859 X:115189459-115189481 CCCAGAGAAGCTTTTCATTGGGG + Exonic
1199971657 X:152866164-152866186 CCCAGACTGGGTGTCCATTGAGG + Intronic