ID: 920180175

View in Genome Browser
Species Human (GRCh38)
Location 1:204127550-204127572
Sequence CTTTGAGGATGGAGAGAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 9, 3: 81, 4: 762}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920180175_920180178 -5 Left 920180175 1:204127550-204127572 CCGTCTTCTCTCCATCCTCAAAG 0: 1
1: 0
2: 9
3: 81
4: 762
Right 920180178 1:204127568-204127590 CAAAGCCCCCACTTCTCTCCAGG 0: 1
1: 0
2: 3
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920180175 Original CRISPR CTTTGAGGATGGAGAGAAGA CGG (reversed) Exonic
900861875 1:5239628-5239650 GTTAGCGGATGGAGAAAAGAGGG + Intergenic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
902936115 1:19766028-19766050 CTTGTTGGATGGAGAGAAGGAGG - Intronic
903681326 1:25099216-25099238 CCTTGTGTATGGAGAAAAGATGG - Intergenic
904423617 1:30409669-30409691 GGTTGAGGATGGAGTGGAGAGGG + Intergenic
904480624 1:30791219-30791241 CTTTCAGCAGGAAGAGAAGATGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
905001311 1:34671862-34671884 GGTAGAGGATGGAGAGATGATGG + Intergenic
905401250 1:37705149-37705171 CTTTGTGGATGGATGGATGATGG + Intronic
905603300 1:39272681-39272703 TTTTTAGGATGGAGAGAAATGGG + Intronic
906084448 1:43119494-43119516 CTTTGAGAGCTGAGAGAAGAAGG - Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906245248 1:44268831-44268853 CTTTGTGGGTGGAAAGGAGAGGG - Intronic
906649662 1:47503657-47503679 CTTTGAAGATGCTGAGAAGGAGG + Intergenic
906683636 1:47748460-47748482 CTGGGAGGCTGGAGAGATGAGGG + Intergenic
906760207 1:48369911-48369933 TTTTGAGGGTGGAGCCAAGATGG - Intronic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907167498 1:52427285-52427307 CTTTGAGGCAGCACAGAAGAAGG + Intronic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907264692 1:53250463-53250485 GTTTGAGGAAGGAAAGAAGGAGG + Intronic
907795970 1:57717426-57717448 CATTGAGGATGTAGAGAAAGGGG + Intronic
907804821 1:57807745-57807767 GTTTGAGGAAGAAGAGATGAAGG - Intronic
908352014 1:63295349-63295371 CTCTGAGGATTGAGAGTGGATGG + Intergenic
908474782 1:64476796-64476818 CTTGGGGGAGGGAGAGGAGATGG + Intronic
908961384 1:69700512-69700534 CTGTGAGGAAGGAGACATGAAGG - Intronic
909725834 1:78833811-78833833 CTTTGAGGAGGGAAAGAAGGCGG - Intergenic
910205172 1:84742535-84742557 CTTTGAGGATGGAGGAAGGGTGG + Intergenic
910504863 1:87938845-87938867 TTTTGAGGATGCTGAGCAGATGG + Intergenic
910730949 1:90395411-90395433 TTTCCAGGATGGAGAGAATAAGG - Intergenic
911656897 1:100454322-100454344 CCCTGAGGATGGAGACAAGGAGG + Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
912278891 1:108291649-108291671 GTATGAGGATGGCAAGAAGACGG - Intergenic
912289335 1:108402708-108402730 GTATGAGGATGGCAAGAAGACGG + Intronic
912857085 1:113178623-113178645 CTTTGTGGAGGGAGAGATGTCGG - Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913322575 1:117599535-117599557 GTCTGAGGATGCAGAGACGAGGG + Intergenic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
913509678 1:119550316-119550338 CTGTTAGAATGGAGAGAGGAAGG + Intergenic
915441832 1:155950401-155950423 CTTTGAGGACCGAGAGAGGCAGG - Exonic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915630982 1:157154194-157154216 CTTGGAGGAGGAAGAGAAGGAGG + Intergenic
915904609 1:159868636-159868658 CTTTGAGGCTGGACAGGAGTAGG - Intronic
916298057 1:163242181-163242203 CCTTGAGGATAGAGAGATAATGG + Intronic
916328530 1:163591115-163591137 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
917568983 1:176244257-176244279 CTAGCAGGATGGAGGGAAGAGGG - Intergenic
918158948 1:181879170-181879192 CTGTGAGGTTGCAGAGAAAAAGG - Intergenic
918899279 1:190391300-190391322 CTTTTAGAATGAAGAGAATATGG + Intronic
919015224 1:192024898-192024920 GCTTGAGGGTGGAGAGAGGAAGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919272332 1:195363931-195363953 TTGTGAGGATGTAGAGAAAAGGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920344075 1:205294645-205294667 CTTTGAGGGTGGAGAGATAGAGG + Intergenic
921064281 1:211611686-211611708 CTTTACAGATGGAGAGATGAAGG + Intergenic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
921641414 1:217559499-217559521 TGTTAAGCATGGAGAGAAGAGGG - Intronic
921829001 1:219706233-219706255 CCGTGAGGTTGCAGAGAAGAAGG + Intronic
922026679 1:221756270-221756292 TAATGAGGATAGAGAGAAGAGGG - Intergenic
922075277 1:222237509-222237531 ATTTGTGGGTGGAGAGAAGGAGG - Intergenic
922159620 1:223069153-223069175 CTTTGAGGAGGTACAGGAGAAGG - Intergenic
922773874 1:228206235-228206257 CGTGGAGGGTGCAGAGAAGATGG - Intronic
923128443 1:231053573-231053595 CTGTCAGGATGGAGAAGAGAGGG + Intergenic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
923241985 1:232095069-232095091 CCAGGAGGATGGAGAGAAGGAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923392319 1:233525256-233525278 CAGTGAGGATGCAGAGAACAGGG + Intergenic
923531744 1:234817534-234817556 CTTTGATGATGGAGGGTGGAGGG + Intergenic
924368390 1:243320817-243320839 CTCAGAGGCTGGAGAGAGGATGG - Intronic
1062896709 10:1108877-1108899 CTTTGAGAATTGGGTGAAGAGGG + Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063862606 10:10327918-10327940 CTTTGAGAAAGGATAGAAGGAGG + Intergenic
1064347885 10:14549040-14549062 CATTGAGGCTGGAGAGTACAGGG - Intronic
1064441652 10:15359451-15359473 CCTTGAGGATGTTGAGAAGGAGG - Intronic
1064577381 10:16760040-16760062 CTTTGAGAAAGGAGCTAAGATGG - Intronic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1067817978 10:49497254-49497276 CTTGGAGGATAGAAAGAAGCTGG - Intronic
1067998997 10:51309601-51309623 CGATGAGGATGCAGAGAAAATGG + Intronic
1068216195 10:53985470-53985492 GCTTGAGGTTGGAGAGAGGATGG + Intronic
1068256158 10:54514985-54515007 CTTGGGGGATGGAGCCAAGATGG + Intronic
1069734746 10:70646583-70646605 TGCTGAGGTTGGAGAGAAGATGG + Intergenic
1069775057 10:70921977-70921999 CCCTGATGAAGGAGAGAAGAGGG - Intergenic
1069935071 10:71909797-71909819 CTTGGAGGTTAGAGGGAAGATGG + Intergenic
1069999462 10:72365522-72365544 CTTTCAGGCTGGAGAAAGGAGGG + Intergenic
1070747146 10:78940953-78940975 CTTAGTGGATGGATAGATGATGG + Intergenic
1070797991 10:79228355-79228377 CCTTGAGTCTGAAGAGAAGAAGG + Intronic
1071129965 10:82378981-82379003 ATTCGTGGATGGAGAGCAGAGGG + Intronic
1071182619 10:83004561-83004583 CATTGTGGAAGGAGAAAAGAAGG + Intergenic
1071457147 10:85859746-85859768 TGCTGAGGTTGGAGAGAAGATGG - Intronic
1071511582 10:86265632-86265654 CATAGAGGTTGGAGGGAAGAGGG + Intronic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1072374871 10:94804126-94804148 CTTTGAGGATGGAATGGAGAGGG + Intronic
1072635658 10:97176282-97176304 CTTTGAGGCTGGCGAGAGGGAGG + Intronic
1072786011 10:98282860-98282882 CCTTGAAGGTGGAGAGAATAAGG - Intergenic
1072798523 10:98375213-98375235 CATTGAGGCTGCAGAGAACATGG + Intergenic
1073383695 10:103103446-103103468 CTTTAATGATGGAGGGAATAGGG - Intronic
1073813577 10:107179096-107179118 TGTTGAGGATGCAGAGAAAAGGG - Intergenic
1074254009 10:111782381-111782403 CTTTCAGGAAGGAGAGCAGCGGG + Intergenic
1074746184 10:116534850-116534872 ATTTGAGGGTGGAGGGTAGAAGG - Intergenic
1074975200 10:118574731-118574753 CTTTGAGGTGGGAGAGTAAACGG - Intergenic
1075298122 10:121296020-121296042 CTTTGTGAATGGATAGAAAATGG + Intergenic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075726032 10:124611394-124611416 CTTGGAGGATGGAAGGGAGAGGG + Intronic
1075856106 10:125631600-125631622 GTGTGAGGATCCAGAGAAGATGG + Intronic
1077168001 11:1152397-1152419 CCTGGAGGAGGGAGTGAAGAGGG - Intergenic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1079954087 11:26841257-26841279 CTTTGAGGCTGGGGTGAACAAGG + Intergenic
1080393999 11:31873421-31873443 GTTGAAGGAGGGAGAGAAGAGGG + Intronic
1080572252 11:33567025-33567047 CTTTGAGGGTAGACAGAAAAAGG + Intronic
1081134729 11:39426177-39426199 GTTTGAGGATGTAGAGAAAAAGG + Intergenic
1081441286 11:43084404-43084426 TTTTGAGTATGGTGAGAAGTAGG + Intergenic
1081581050 11:44352242-44352264 CTTTGTGGAGGGAGTGAAGCTGG + Intergenic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1082087990 11:48065771-48065793 GTTACAGGGTGGAGAGAAGAAGG + Intronic
1082321538 11:50818328-50818350 CTTTGACAACTGAGAGAAGAAGG - Intergenic
1082730084 11:56785416-56785438 CTTTGAGGAAAGAAAGAAAAAGG - Intergenic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1083427905 11:62598459-62598481 CGTAGAAGATGGAGAGAAGGAGG - Intronic
1083706644 11:64521075-64521097 CTTAGAGGATGCAGAGAATGTGG - Intergenic
1084018638 11:66403346-66403368 ATGTGAAGATAGAGAGAAGAAGG + Intergenic
1084903801 11:72330434-72330456 CTTTGAGTATGACAAGAAGAAGG + Intronic
1084908451 11:72367604-72367626 CTTAGAGGAGGGAGGGATGAAGG + Intronic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085391170 11:76183055-76183077 GTCTGAGGAGGGAGACAAGAAGG - Intergenic
1085406071 11:76263106-76263128 CTTACAGGATGGGGACAAGATGG - Intergenic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085747026 11:79123715-79123737 CTCTAAGGAAGGAGAGAGGATGG - Intronic
1086053074 11:82616895-82616917 CTTTGAGATTGAAGAGAAGCGGG - Intergenic
1086499120 11:87434173-87434195 GCCTGAGGATGAAGAGAAGAGGG + Intergenic
1086731830 11:90259561-90259583 ATTTGAGGATGAAGGGAGGAAGG + Intergenic
1086952419 11:92904875-92904897 CTTTCAAGATGGAGAGCTGAGGG + Intergenic
1087139843 11:94754464-94754486 ATTTGAGGAAGGAGATAACAAGG - Intronic
1087141903 11:94772363-94772385 GAGTGAGGATGGGGAGAAGAGGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087296003 11:96374757-96374779 TTTTGAGGGTGGAGAGTAGGAGG - Intronic
1087384548 11:97453789-97453811 GTTTCAGGAAGGAGAGAATAAGG + Intergenic
1087667364 11:101066072-101066094 ATTAGAGGATGCAGACAAGAGGG - Intronic
1088547077 11:110970079-110970101 CTTTGAGACAGGACAGAAGAGGG - Intergenic
1089269728 11:117293796-117293818 CTTTCAGGAAGGGGAGAGGATGG + Intronic
1089391486 11:118104889-118104911 TTTTTAGGAAAGAGAGAAGAAGG - Intronic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090296591 11:125593241-125593263 CTTTGAGGGTGGGAAGAAGAGGG + Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091155320 11:133366575-133366597 CCTTCATGATGGGGAGAAGAAGG + Intronic
1091242733 11:134064769-134064791 CTTTGAGGATGTGGAGAAGCAGG - Intergenic
1091532925 12:1376821-1376843 CTTTACGGATGGAGAGGGGAAGG - Intronic
1091797923 12:3307819-3307841 CTAGGAGCAAGGAGAGAAGAGGG + Intergenic
1092515429 12:9206953-9206975 CTTTCTGGATGGAGAGCAGCTGG + Intronic
1092555388 12:9554813-9554835 ATTTGAGGATAAAGAGAATATGG - Intergenic
1092621739 12:10279140-10279162 GCTTGAGGGTGGAGAGTAGAAGG - Intergenic
1092750556 12:11715310-11715332 TTTTGAAGATGAAGAGAAGGAGG + Intronic
1093128661 12:15362058-15362080 ATATGAGAATGGAGAGAAGGAGG - Intronic
1093817173 12:23563159-23563181 TTTTGAGGATGATAAGAAGATGG + Intronic
1094310489 12:29075271-29075293 CTTTGAGAATGGTGAGAGGGGGG + Intergenic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1095223408 12:39647547-39647569 GCTGGAGGATGGAGAGAAGCAGG + Intronic
1095275978 12:40282682-40282704 CTTTGAGGATGGGTTGAAGGTGG + Intronic
1095370485 12:41461346-41461368 ATTTGAGGATGGAGAGGATCAGG - Intronic
1095634333 12:44415019-44415041 ACTTGAGGATGGAGAGTGGAAGG - Intergenic
1095977673 12:47950851-47950873 CATTGCGGAAGGTGAGAAGAAGG + Intergenic
1096012443 12:48231576-48231598 ATTAGAGGATGGAGAGTGGAGGG - Intergenic
1096602159 12:52737040-52737062 CACAGAGGATGGAGAGATGAAGG - Intergenic
1096602899 12:52742693-52742715 CACAGAGGATGGAGAGATGAGGG + Intergenic
1096801634 12:54114295-54114317 TTTTCAGGATGGTGAGGAGAAGG + Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1097901637 12:64879528-64879550 CTTCCAGGATGTAGAGAAGCAGG - Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098441313 12:70522197-70522219 CATTTAGAATGGAGATAAGAGGG + Intronic
1099697999 12:86045084-86045106 CATTGAGGGTGGACAGAAGGAGG - Intronic
1099963735 12:89422489-89422511 CTTAGAGAATGTACAGAAGATGG - Intronic
1100024323 12:90109219-90109241 CACTGAGGATGGAGAAAATAGGG - Intergenic
1100225410 12:92551312-92551334 TTTTTCAGATGGAGAGAAGACGG + Intergenic
1100645231 12:96522546-96522568 CTTTGAGGCTGTGGAGAAGATGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101336836 12:103804172-103804194 GTTTCAGGATGGAGAGGAGGTGG - Intronic
1101681996 12:106977958-106977980 CTTTGAGTTTGGATAGAAGCTGG + Exonic
1102394090 12:112573689-112573711 CTTTGAGGATCCTTAGAAGAGGG + Intronic
1103939000 12:124491873-124491895 CCCTGAGGATGGAGAGAATGAGG + Intronic
1103993656 12:124815354-124815376 TTTTGTAGATGGAGAGACGATGG - Intronic
1104469859 12:129020973-129020995 CTTTGGGGGTGAAGAGAGGAAGG - Intergenic
1106114831 13:26808405-26808427 CTCTGAGGGTGGAAAGGAGATGG - Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1108342033 13:49506639-49506661 CTTTCAGGTTGCAGAAAAGATGG + Exonic
1108758480 13:53532774-53532796 CTTTGAAGATGGGGGGAAGGGGG + Intergenic
1109371375 13:61424464-61424486 ATTTGGGGAAGGAGAGAGGATGG + Intronic
1109760611 13:66823354-66823376 TTTTTAGGAAAGAGAGAAGAAGG + Intronic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1111166584 13:84465129-84465151 CATGGAGGATGGAGTGAAGCAGG + Intergenic
1111625667 13:90782682-90782704 GTTGGAGGATGTAGAGAACAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111955706 13:94756040-94756062 ACTTGAGGATGGAGAGAGGGAGG - Intergenic
1112501374 13:99945936-99945958 CTTTGTGGATGGGAAGATGAGGG - Intergenic
1113809463 13:113129591-113129613 CTTTGAGGACAGCGACAAGACGG + Exonic
1114419537 14:22569642-22569664 CTGGGAGGATGGAGAAAATAAGG + Intronic
1114444071 14:22774585-22774607 CTTTGAGGATTGACAGGGGATGG - Intronic
1114848401 14:26352179-26352201 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1114877991 14:26747178-26747200 CGGTGAGGATGTAGAGAAAAAGG + Intergenic
1115364509 14:32542664-32542686 CCTTGAGGAAGGAGGGAACATGG + Intronic
1115638895 14:35318878-35318900 TGTTGAGGATGCAGAGAAAAGGG - Intergenic
1115669145 14:35589262-35589284 GTTTGAAAATGGAGAGAAGCTGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116345844 14:43792481-43792503 TTTAGAGGCTGGACAGAAGAGGG - Intergenic
1118115132 14:62767181-62767203 TGTTGAGGATGCAGAGAAAAGGG + Intronic
1118316992 14:64731572-64731594 CCTTTGGGAAGGAGAGAAGATGG - Intronic
1118976671 14:70683850-70683872 CTGTTAGGATGCAGTGAAGAGGG + Intergenic
1119010959 14:70988306-70988328 AATTGAGGTTGAAGAGAAGATGG + Intronic
1119540785 14:75436885-75436907 CTCTGAGAATGAAGAGAACATGG + Intronic
1119552180 14:75522952-75522974 CTTGGAAAATGGAGAGAAAAAGG - Intronic
1120064357 14:80022693-80022715 CTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1120694781 14:87632613-87632635 CTTGGAGGATGGAAGCAAGATGG - Intergenic
1121219085 14:92272383-92272405 CTTTGCGGATGAAGATAAAAGGG - Intergenic
1121395166 14:93615375-93615397 CTTAGAGGGTGGGGAGAAGAGGG - Intronic
1121573099 14:94962197-94962219 CTTTGAGGAGGGAGTGGAGCTGG + Intergenic
1121727573 14:96164447-96164469 CTTTGAGGATGGAGGAGGGAGGG + Intergenic
1121735452 14:96214679-96214701 CTTGGAGGCTGGAGAGATGAGGG - Intronic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1121843180 14:97151420-97151442 CTTTAAAGATTGAGAGAGGAAGG + Intergenic
1121871418 14:97411576-97411598 CTTTGAGAAGAGAGAGAAGGGGG - Intergenic
1122401095 14:101467862-101467884 TGGGGAGGATGGAGAGAAGAGGG + Intergenic
1122630103 14:103103861-103103883 CTTTGAGCCTGGCCAGAAGAGGG + Intronic
1122646817 14:103200093-103200115 CTTGGAGGTTGGAGGCAAGATGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1124090740 15:26597823-26597845 TTTTGAGGGTGGAGAAAAAATGG - Intronic
1124888172 15:33706814-33706836 GGTTGAGGATGTAGAGAAGTTGG - Intronic
1125041370 15:35190818-35190840 CTTGGAGGATAGAAACAAGATGG + Intergenic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1125794426 15:42394020-42394042 CTTAGAAGATAGAGAGGAGATGG + Intronic
1125844514 15:42839092-42839114 CTTTGAGGGTGGAGCAAAGAAGG - Intronic
1125883298 15:43211064-43211086 CTCTGAGGATGGTGAGGAGTTGG + Intronic
1125969193 15:43898350-43898372 CTCTGAAGATGCAGACAAGAAGG - Intronic
1126096718 15:45095484-45095506 CTTTGAGGATGGAGGCAAAGGGG + Exonic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126947243 15:53835348-53835370 CTAGGAAGATGGAGAGAGGAAGG + Intergenic
1127485448 15:59413869-59413891 CCTTGAGAAGGGAGAGATGAGGG + Intronic
1127709638 15:61583536-61583558 ACTTGAGGGTGGAGGGAAGAAGG + Intergenic
1128515672 15:68340421-68340443 CTCTGAGGCTGGAGAGAGCACGG + Intronic
1128931285 15:71706930-71706952 CCTGGAGGATGGAGAGGAGTTGG + Intronic
1128949952 15:71868287-71868309 CTCTGAAGATGGAGAAAGGAGGG - Intronic
1129524039 15:76202943-76202965 CTTTGAGGGAGGAGAGAAGAGGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130070593 15:80643883-80643905 CTTAGAGGAGGAAGAGGAGATGG - Intergenic
1130165349 15:81451247-81451269 CTCTGTGGAAGGAGAGAAGCAGG + Intergenic
1130562577 15:84970289-84970311 CTTGGAGGATGGTGTGGAGAGGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131439484 15:92448219-92448241 CTTTTAGCAGGGGGAGAAGAAGG + Intronic
1131523734 15:93136393-93136415 CTTTAAGGGGGAAGAGAAGATGG - Intergenic
1131833202 15:96367178-96367200 CTTTGAAGTTAGAGTGAAGATGG - Intergenic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134880638 16:17742783-17742805 CTTTCATTAGGGAGAGAAGAGGG - Intergenic
1135382145 16:22004211-22004233 TTTCTAGGATGGATAGAAGAGGG + Intergenic
1135822180 16:25693517-25693539 CTTTGAGGAGTGAGACAGGATGG + Intronic
1135829141 16:25758127-25758149 GTTTGAGGGTGGAGAGAATTAGG - Intronic
1135921903 16:26657917-26657939 ACTGGAAGATGGAGAGAAGAAGG - Intergenic
1135953339 16:26935628-26935650 CTTGGAGGAAGGGGAGAAGGTGG + Intergenic
1137467192 16:48720497-48720519 CATTGAGGAAGCAGAGAAGGTGG + Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138786520 16:59852938-59852960 CATTGAGGAGGGAGAAAAGGAGG + Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139122321 16:64035433-64035455 ATTTGAGGATAGTGAAAAGATGG - Intergenic
1139312744 16:66041020-66041042 CTTTGTGGAAGGAGAAGAGAAGG - Intergenic
1139609146 16:68042499-68042521 TTTTGAGGATGTAGAGAAACCGG - Intronic
1140147524 16:72325531-72325553 CTTTGATGATTGACAGAAGTAGG + Intergenic
1140245453 16:73244349-73244371 CTTGGAGGATGGAGGAGAGAAGG - Intergenic
1140712879 16:77694662-77694684 CTATGAGGAAGGAATGAAGAGGG + Intergenic
1140912941 16:79470042-79470064 CCTGGAGGATGGCGAGCAGAAGG - Intergenic
1141265567 16:82493877-82493899 CAAAGAGGAAGGAGAGAAGAGGG - Intergenic
1141531726 16:84650863-84650885 CTTTAATGATGGAGGGAAGCAGG + Exonic
1141627469 16:85268836-85268858 CTTTGAGTGTGGAGAGAGCACGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1143129030 17:4664462-4664484 CGTGAAGGAAGGAGAGAAGATGG - Intergenic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1144013806 17:11174701-11174723 TTTTGAGGGTGGAGAAAGGAGGG + Intergenic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144567295 17:16370302-16370324 ACTTGAGGATGGAGGCAAGAAGG - Intergenic
1144870843 17:18369795-18369817 TTCTCAGGATGGAGAGAAGATGG + Intergenic
1146521860 17:33531711-33531733 CGTAGAGGATGGAGGAAAGAAGG - Intronic
1146884741 17:36463625-36463647 CATTGAGGGTGGAGGGAGGAAGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148218600 17:45847375-45847397 ACCTGAGCATGGAGAGAAGATGG - Intergenic
1148394333 17:47296067-47296089 CGCTGAGGATGTAGAGAGGAGGG - Intronic
1148967104 17:51445300-51445322 CTTTGAGGGTGGAGGGTAGGAGG + Intergenic
1149192312 17:54077688-54077710 CTCTAAGGATGTAGAGGAGACGG - Intergenic
1149328301 17:55555735-55555757 CTCTGAAGATGGTGGGAAGATGG - Intergenic
1149394892 17:56230343-56230365 TTTTGGGGAAGGAGAGAGGAAGG + Intronic
1149565515 17:57638188-57638210 CTTTCAGCCTGGAGAGGAGAGGG - Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150602526 17:66663181-66663203 CTTTGAGGCTGGAGAGGAGCAGG - Intronic
1150847440 17:68674008-68674030 ATTTGAGGAGGGAGAAAACATGG - Intergenic
1151180015 17:72320543-72320565 ATTGGAGGATGGAGAGATTAGGG + Intergenic
1151918586 17:77137337-77137359 CTTGGTGGAAGGAGAGAAGGGGG + Intronic
1152022483 17:77787824-77787846 GTTTGAGGATGAAAAGAAGTTGG + Intergenic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1203168420 17_GL000205v2_random:121785-121807 CTTAGAGGGTGGAGAGAGGGAGG + Intergenic
1152975494 18:213494-213516 CTTTGAGAAGGGAGAGGAGTAGG + Exonic
1153859364 18:9185334-9185356 CTTTTGGGATGAAGAGAAGTTGG + Intronic
1154024543 18:10695291-10695313 GTTGGAGGCTGGGGAGAAGAAGG + Intronic
1154046770 18:10913313-10913335 CTATGAGGTGGGAGAGATGAGGG + Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1155222921 18:23701709-23701731 CGCTGAGGATGAAGAGAAGCGGG + Intronic
1155456614 18:26022650-26022672 CTTAGAGTCTGGAGAGAAAAAGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156006901 18:32452809-32452831 CTTTGAGGATCCAGAGAAGGGGG + Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157342052 18:46787638-46787660 CCTTCAGGATGGGGAGAACAGGG + Intergenic
1157594262 18:48854300-48854322 CTTAAAGGATGGAGAGAGGATGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157888338 18:51390131-51390153 CCTGAAGGGTGGAGAGAAGAAGG - Intergenic
1158124741 18:54088601-54088623 ATTGGAGGATGGAATGAAGAGGG - Intergenic
1158831620 18:61285637-61285659 CTTTCAGAATGAACAGAAGATGG - Intergenic
1159271748 18:66162492-66162514 TTTTAAGGCTGGAGAGAAGAAGG + Intergenic
1159700013 18:71615087-71615109 TGTTGAGGATGCAGAGAAAAGGG + Intergenic
1160363074 18:78300723-78300745 ATTTGAGCATAGAGAGTAGATGG - Intergenic
1160778948 19:869293-869315 ATTTGAGGCTGGACAGAAGCAGG + Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1161842697 19:6692561-6692583 CCATAAGGATGGAGAGAAGGAGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162530505 19:11233365-11233387 CCCTGAGGATGGAGTGAATAGGG + Exonic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1162780923 19:13006745-13006767 CTTTGGGGGTGGAGAGAATCTGG - Intronic
1163654199 19:18536267-18536289 CTGTGAGGATGAACAGAAAAGGG + Intronic
1164271979 19:23680841-23680863 AGTTGAGGGTGGAGAGTAGAAGG + Intronic
1164404546 19:27932356-27932378 CTTGGTAGATGAAGAGAAGAAGG - Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165104389 19:33460489-33460511 CTCTGAAGATGGTGGGAAGATGG - Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165355692 19:35302539-35302561 CCTTGAAGATGGTGAGAATAGGG - Exonic
1165660008 19:37569801-37569823 GACTGAGGATAGAGAGAAGAGGG - Intronic
1166016883 19:39988114-39988136 TGTTGAGGATGTAGAGAACAGGG + Intronic
1166302743 19:41921637-41921659 TTGGGAGGAAGGAGAGAAGAGGG + Intronic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167454877 19:49592790-49592812 TTTGGGGGGTGGAGAGAAGAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167727642 19:51227352-51227374 TGGTGAGGATGTAGAGAAGAGGG - Intronic
925730446 2:6916923-6916945 CTTGAAGGATGAAGAAAAGAGGG - Intergenic
926593625 2:14765725-14765747 CTTTTATGATTGAGAGAAAATGG + Intergenic
927024873 2:19056792-19056814 AGTGGAGTATGGAGAGAAGAAGG + Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927237124 2:20884621-20884643 TTTTGAGGATGGTGCAAAGATGG - Intergenic
927524398 2:23723622-23723644 CACTGAGGATGTAGAGAAAAGGG + Intergenic
927788681 2:25992727-25992749 ATTGGAGGATGGAGAGGAGGAGG - Intergenic
928021947 2:27712357-27712379 TTTAGAGGATGGAGAGACTATGG + Intronic
928076446 2:28269282-28269304 CTTCCAAGATGGAGAGGAGAAGG - Intronic
928300775 2:30122071-30122093 ATCTGAAGATGGAGAGAAGGAGG + Intergenic
928326206 2:30321663-30321685 CATTGAGGAGGGAAAGAAGCGGG - Intronic
928891005 2:36202917-36202939 TCTTGAGGAAGGAGAGAACATGG - Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929920605 2:46168761-46168783 GTTTGAGGACAGAGAGAAGAGGG + Intronic
930253266 2:49060195-49060217 CGGTGAGGATGCAGAGAAAAAGG + Intronic
930363805 2:50413539-50413561 CTGTGAGGATGTGGAGAAAAGGG + Intronic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
930802729 2:55459597-55459619 CTTGGAGGTTGGAGGCAAGATGG - Intergenic
931561431 2:63566051-63566073 ATTTGAGGTTGGAGAAGAGAAGG - Intronic
931588146 2:63851529-63851551 CTTTGGGGATTGAGAGATCAGGG + Intronic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932456657 2:71853737-71853759 GTTTCAGGATGGAGGGATGAGGG - Intergenic
932521375 2:72417002-72417024 TTTTGGGGATGGACAGAAGGTGG - Intronic
932703501 2:74006302-74006324 GTTTGAGGATGGAGAGAAAGAGG + Intronic
933117818 2:78497257-78497279 ATCTGAGAATGGACAGAAGAAGG + Intergenic
933202544 2:79467034-79467056 CTTTAAGAGTTGAGAGAAGAAGG + Intronic
933564690 2:83935453-83935475 CATTAAAGGTGGAGAGAAGAAGG - Intergenic
933583647 2:84155795-84155817 TTTTGAGTATAGAGTGAAGAAGG + Intergenic
934784399 2:96994460-96994482 CAAAGAGGATGGAGAGCAGAAGG - Intronic
935503234 2:103868065-103868087 CTTAGAGGAAGGAGGAAAGAGGG + Intergenic
935741876 2:106156394-106156416 CGTTGAGGATGTAGAGAAACTGG + Intronic
935859064 2:107308037-107308059 CTTTGAGGATCCAGAGAAAAGGG - Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936988536 2:118336196-118336218 TTTTGAGGATGCAAAGAAAAGGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937403870 2:121610161-121610183 CGTGGAGGAGTGAGAGAAGAAGG + Intronic
937634398 2:124139772-124139794 ATTTGAGGAAGGAGCCAAGATGG + Intronic
937753002 2:125500363-125500385 CATTGAGGTTGTAGAGAAAAGGG - Intergenic
937768862 2:125695356-125695378 CTATGAGCATGGAAATAAGAAGG + Intergenic
937859097 2:126694328-126694350 CCTTGAGGATGGAGGGTTGAGGG - Intronic
938442406 2:131347647-131347669 CCCTGAGGGTGGAGCGAAGACGG - Intronic
938611033 2:132948012-132948034 CTGTGAGGATGCTGAGAAGTTGG - Intronic
938706208 2:133929782-133929804 CCTAGAGGAGGGAGAGAATAAGG + Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939793468 2:146610699-146610721 CGTTGAGGATGTGGAGAAAAGGG - Intergenic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940189375 2:151023542-151023564 CTATGAGGATGCAGAGAAAGGGG + Intronic
940635272 2:156291696-156291718 CCTTGATGGTGGAGAGAAGGAGG - Intergenic
941188026 2:162341740-162341762 GGTTGGGGATGGAGAGAAAAGGG + Intronic
941767384 2:169313196-169313218 CTTTGAGAGTTGAGAGAAGAAGG - Intronic
941898309 2:170653075-170653097 TTTTGAGGATGAAGAAAAAAAGG - Exonic
942374020 2:175317292-175317314 ATTTGGGGATGGACAGAGGAGGG + Intergenic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
942799253 2:179857913-179857935 CTTTGAGGCTGGACTGCAGAGGG + Intronic
942967502 2:181914845-181914867 CTTTCAGAATGGAGAGAAGGAGG + Intronic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
944938047 2:204590179-204590201 CTGTGAGGACAGAGAGATGATGG - Intronic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946160595 2:217833474-217833496 CCAAGAGGAGGGAGAGAAGAAGG + Intronic
946226170 2:218265227-218265249 CTTTGAGAATTGGGAGCAGATGG - Intronic
946361331 2:219220823-219220845 CTTGGAGGGTGGGCAGAAGATGG - Exonic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947422778 2:229955571-229955593 CTTTGATGAGGGAGAGAAAAGGG - Intronic
947879311 2:233491494-233491516 CTTTGAGGAAGGAGAGAATGTGG - Intronic
948180908 2:235979294-235979316 GTTTGAGGTTGGAGGGAGGAGGG + Intronic
948282425 2:236757612-236757634 CTTTGAGGAGGGAGATGAGCTGG - Intergenic
948285070 2:236777793-236777815 CTTTGGGGATGGCCAGATGACGG - Intergenic
948690826 2:239703475-239703497 CATTGAGGATACAGAGAAGTTGG - Intergenic
948752030 2:240138459-240138481 CTTTGAGGATGCTGGGAGGAAGG - Intergenic
948877415 2:240837049-240837071 CTTTGTGGATGAACAGATGAGGG - Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168794909 20:604955-604977 ATTTGATGATGGAGAGAGGATGG + Intronic
1169363683 20:4973564-4973586 CTCTGAGGAAGGAGTTAAGAAGG + Intronic
1169503397 20:6183374-6183396 CTTTGAGAAAGCAGAGAAGATGG + Intergenic
1170535210 20:17334442-17334464 CTTTGTGGATGCAGAGAATGCGG - Intronic
1171795066 20:29560171-29560193 TTTTCAGGATGGCGAGGAGAAGG - Intergenic
1171853387 20:30324094-30324116 TTTTCAGGATGGTGAGGAGAAGG + Intergenic
1172407114 20:34698174-34698196 CTTTGAGGCTAGGGAGGAGAGGG - Intronic
1172482602 20:35279782-35279804 CATTGAGGAGGGAGAGAATTTGG - Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1172936456 20:38623924-38623946 ATTTGAGGATTTAGAGCAGAGGG - Intronic
1173245647 20:41335707-41335729 CTTAGAGGATGGGGAGGGGAGGG - Intergenic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1174506162 20:51018961-51018983 TTCTGAGGATGGGGAGAAGCAGG + Intronic
1175293558 20:57894122-57894144 CTTTTAGGATGGAGAGATAATGG + Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175662864 20:60832080-60832102 CTTGGAGGCTGGAGAGTAGAGGG - Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1176017993 20:62946732-62946754 GTTTGAGGATGAAGATAAGTTGG + Exonic
1176107217 20:63395125-63395147 CTCTGAGGGTGGAGAGCACACGG - Intergenic
1176333130 21:5568897-5568919 CTTAGAGGGTGGAGAGAGGGAGG - Intergenic
1176394627 21:6252055-6252077 CTTAGAGGGTGGAGAGAGGGAGG + Intergenic
1176403337 21:6337350-6337372 CTTAGAGGGTGGAGAGAGGGAGG - Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176433820 21:6651754-6651776 CTTAGAGGGTGGAGAGAGGGAGG + Intergenic
1176442530 21:6737049-6737071 CTTAGAGGGTGGAGAGAGGGAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176466792 21:7064119-7064141 CTTAGAGGGTGGAGAGAGGGAGG - Intronic
1176490353 21:7445897-7445919 CTTAGAGGGTGGAGAGAGGGAGG - Intergenic
1176510289 21:7692486-7692508 CTTAGAGGGTGGAGAGAGGGAGG + Intergenic
1176603411 21:8812160-8812182 ATTTGAGGAAGGAGAGGTGAGGG - Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176904616 21:14484386-14484408 CCTTTAGGATGGAGGAAAGAGGG + Intergenic
1177198956 21:17932313-17932335 TTGTGAGGATGAAGAGAAAAGGG + Intronic
1178337782 21:31759341-31759363 CTTTGAGGCGGGAGGGAAAAAGG - Intergenic
1178956033 21:37022831-37022853 ACTTGAGGATGGAGGGAGGAGGG - Intergenic
1179164853 21:38927358-38927380 CTTTGAAGATGGAGGAAGGAAGG - Intergenic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179601324 21:42479411-42479433 ATTTCAGGATGATGAGAAGAAGG - Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1180141994 21:45898557-45898579 CTGTGAGGATGGCGTGTAGAGGG - Intronic
1180345695 22:11703718-11703740 ATTTGAGGAAGGAGAGGTGAGGG - Intergenic
1180588362 22:16914120-16914142 CTTTGAGTCTGCAGAGGAGAAGG - Intergenic
1181881339 22:25982688-25982710 CTTTGAAGATGGAGGCAAGGGGG - Intronic
1182197145 22:28530058-28530080 CTTCGACGGTTGAGAGAAGAAGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183203095 22:36399593-36399615 CTTTGTGGTTGGAGAGGAAAGGG - Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183405927 22:37630543-37630565 CTTTGGTGATGGAGAGATCAGGG - Intronic
1183806458 22:40215585-40215607 CCCTGAGGATGCAGCGAAGATGG - Intronic
1183818960 22:40328801-40328823 CTCTGAGGATGGGGAAAAAATGG - Exonic
1184496838 22:44846929-44846951 CTCTGAGGACGGGGAGAAGCTGG + Intronic
1184550109 22:45199964-45199986 CTTGAGGGATGGGGAGAAGAAGG + Exonic
1185098316 22:48823572-48823594 CTCTGAGCTAGGAGAGAAGAGGG - Intronic
950194278 3:10998300-10998322 CTGTGAGGCTGGGGAGAAAAGGG + Intronic
951043777 3:18016001-18016023 CTTTTAGGATGTAGAGAGAAAGG + Intronic
951281240 3:20752550-20752572 ACTTGAGGATTGAGAGAAGTGGG - Intergenic
952010511 3:28895561-28895583 CTTGGAGGAAGGACAGAAAATGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952560502 3:34587253-34587275 ACTTGAGGGTGGAGAGTAGAAGG - Intergenic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
952697168 3:36279457-36279479 CTTTGAAGATGGGGAGAAGGAGG + Intergenic
952713499 3:36454590-36454612 GTTTAAGGATGGAGTGGAGAGGG - Intronic
953160601 3:40415926-40415948 CTTCGTGGCAGGAGAGAAGATGG + Exonic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
953783431 3:45892555-45892577 CCTTGAGGATGGAGGGAGGTAGG + Intronic
953813421 3:46133555-46133577 CATTGAGGATGGAGAGCTGAAGG - Intergenic
954562226 3:51566915-51566937 GTTGGAGGATGGAGACAAAATGG - Intronic
955588303 3:60506252-60506274 CTTTGAGGGTGGAGGGTAGGTGG + Intronic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
956211182 3:66803417-66803439 CTTGCAGGATGGAGAGAAAAGGG + Intergenic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956541241 3:70342012-70342034 ATTTGAGGATTGAGAGTACAAGG - Intergenic
956578030 3:70777441-70777463 CCTTGAGGGTGGAGGGTAGAAGG + Intergenic
956839168 3:73121142-73121164 CTTTGAGGGTGGATAGAAGGAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957103019 3:75851108-75851130 ATTAGAGGGTGGAGACAAGATGG - Intergenic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
958053854 3:88384455-88384477 CTCTGAGGCTGGAAAGAACATGG + Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959114659 3:102162416-102162438 CTTTGAGGTTGGTGAGTAAATGG + Intronic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
960172556 3:114479091-114479113 TTTTCAGGATGGGGGGAAGAAGG + Intronic
961635713 3:128331215-128331237 CACTGAGGAAGGGGAGAAGAGGG - Intronic
961635737 3:128331301-128331323 CATTGAGGAAGGGGGGAAGAAGG - Intronic
962019997 3:131489955-131489977 ATTTGAGGTTGGGGAGAGGAGGG - Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962275113 3:134006956-134006978 TTTTGAGGATGGAGAGAAATTGG - Intronic
962894408 3:139701012-139701034 CTTTCAGAAGAGAGAGAAGAGGG + Intergenic
962917694 3:139920200-139920222 CTCTGAGGATTGAGATAAAAAGG - Intergenic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
963173571 3:142275877-142275899 CCATACGGATGGAGAGAAGAGGG + Intergenic
963269679 3:143273431-143273453 CTTTGTGGAAGGTGGGAAGAGGG - Intronic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
963826336 3:149958358-149958380 CTTTGAAGATAGGGGGAAGAAGG - Intronic
964127119 3:153245950-153245972 TGTTGAGGATGCAGAGAATAGGG + Intergenic
964132530 3:153305957-153305979 CCTGGAGGAGGGAGAGAAGGGGG + Intergenic
964344003 3:155737879-155737901 AATTGAAGAGGGAGAGAAGAGGG + Intronic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966911071 3:184560661-184560683 CCCTGAGGAGGGAGAGAAGCTGG - Intronic
967461269 3:189749544-189749566 TATTGAGGATGCAGAGAAAAAGG + Intronic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
968315506 3:197720941-197720963 CGGTGAGGATGGGGAGAAAAGGG - Intronic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG + Intergenic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
969106216 4:4808868-4808890 CCTGGAGGAGGGAGAGAAGGGGG + Intergenic
970336842 4:15055795-15055817 CACTGAGGCTGGAGAGAACAAGG - Intronic
970923359 4:21421143-21421165 TGGTGAGGATGTAGAGAAGAGGG + Intronic
971232257 4:24809219-24809241 CATTGAGGGTGGGAAGAAGAAGG + Intronic
971734033 4:30423060-30423082 ATTTGAGGATGGAGAGTGGGTGG - Intergenic
971958940 4:33459325-33459347 ATTTGAGGGTGGAGAGTAGAGGG + Intergenic
972069811 4:35004081-35004103 CTTTCAGAATGTAGAGAAGAAGG - Intergenic
972343821 4:38176260-38176282 ATTTGAGGATGAAGAGTAAAGGG + Intergenic
972614600 4:40686018-40686040 CTATGCGGAGGGAGAGAAGCTGG + Intergenic
972971992 4:44588258-44588280 TGTTGAGGATGCAGAGAAAAGGG + Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
973690305 4:53421398-53421420 CTATGAGCATAGAGAAAAGATGG - Intronic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974427642 4:61760787-61760809 CTTGGAGGGTGGAGCCAAGATGG - Intronic
974631084 4:64489936-64489958 GTTGGAGGAAGGAGAAAAGATGG - Intergenic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975401967 4:73949035-73949057 CTATGTGGATGGACAGATGAGGG + Intergenic
975695026 4:77004022-77004044 ATATGATGATGGAGAGAAGCAGG - Intronic
976308151 4:83582091-83582113 ACTTGAGGATGGAGAGAAAAGGG + Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977623626 4:99165432-99165454 TGTTGAGGATGTAGAGAAAAGGG - Intergenic
978154915 4:105478404-105478426 CTTTGAGAGTGGAGAGTGGATGG + Intergenic
978261100 4:106760421-106760443 CAGTAAGGATGGAAAGAAGATGG + Intergenic
978529380 4:109698885-109698907 AGTTGAGAATGGAGAGCAGAGGG - Intronic
978642638 4:110889643-110889665 CTTTCAAGAAGGAAAGAAGAGGG - Intergenic
978693793 4:111550443-111550465 ACTTGAGGATGGAGAGTAGGAGG + Intergenic
979001421 4:115225665-115225687 CTTTGCCCATGGAGAGGAGAGGG + Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
981401743 4:144321784-144321806 CATTGAGAATGGACAGAAGGAGG + Intergenic
981609686 4:146579959-146579981 CTCTGAGGGAGGTGAGAAGAGGG + Intergenic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983964648 4:173794931-173794953 CGTTATGGAGGGAGAGAAGAGGG + Intergenic
984056319 4:174933623-174933645 CCTTGAGGATGGAGGAAAGGAGG - Intronic
984448703 4:179871435-179871457 CTTTAAGGTCTGAGAGAAGATGG + Intergenic
985002812 4:185502785-185502807 CTTTGAAGAGGGAGACATGATGG + Intronic
985753933 5:1701882-1701904 CTTTGTGGATGAAGACCAGAAGG + Intergenic
985974981 5:3411556-3411578 CTTTGATGAAGGAGAGATGTAGG - Intergenic
986348906 5:6858940-6858962 ATTCCAGGGTGGAGAGAAGAAGG - Intergenic
986590734 5:9366714-9366736 GTTTGAGGATGAAGAAAGGAGGG + Intronic
987419476 5:17701879-17701901 TTTTGAGGTTGCAGAGAAAAGGG + Intergenic
987573226 5:19692738-19692760 TGTTGAGGATGCAGAGAATAGGG + Intronic
988068602 5:26256835-26256857 CTTTGACGATGGAGACAACCAGG + Intergenic
988934396 5:36067597-36067619 GTTTGAGGATAGAGAGTAAAGGG - Intronic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
989786456 5:45337137-45337159 CTTGGAGGATGGGGTAAAGATGG - Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990624270 5:57593945-57593967 GATGGAGGATGGAGAGAAGCTGG + Intergenic
990672396 5:58147739-58147761 CATTGAGGGTGGAAAAAAGAGGG - Intergenic
990705878 5:58528878-58528900 CATTGAGGCTGGTGAGAAGCTGG + Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992230617 5:74659920-74659942 CCTTGAGGATGAAGGGCAGAAGG + Intronic
992735674 5:79717717-79717739 CATTGTGGATGGAAAGAATAAGG - Intronic
992777599 5:80102180-80102202 CTATGAGTATTTAGAGAAGAAGG - Intergenic
993391553 5:87324730-87324752 ACTTGAGGAAGGGGAGAAGAGGG - Intronic
993446298 5:88015604-88015626 ATTTGAGGGTGGAGCCAAGATGG - Intergenic
993474346 5:88345952-88345974 TTTGGAAGGTGGAGAGAAGAAGG - Intergenic
993816956 5:92560288-92560310 CTTTGAGTATATAGACAAGACGG + Intergenic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995102992 5:108338276-108338298 CTTTGAGAATATAAAGAAGAAGG - Intronic
995204031 5:109458397-109458419 CTTTGACAGTTGAGAGAAGAAGG + Intergenic
995936675 5:117524459-117524481 CTTTGAAAATGGAGAGAACCTGG - Intergenic
995942577 5:117601392-117601414 CTTTGAGAGTGGAGAGATAAGGG + Intergenic
995970274 5:117961006-117961028 CTTTCAGGAGGGAAAGAGGAGGG - Intergenic
996265455 5:121534513-121534535 CTTTGAGGAGGGAGCCAAGATGG + Intergenic
996494731 5:124140780-124140802 CTCTGAAGGTGGGGAGAAGAAGG + Intergenic
996769393 5:127070089-127070111 ATTTAAGGATGGAGAGAATGAGG + Intronic
996794036 5:127324843-127324865 CCTTGAGGGTGGAGAGCAGAAGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
998007134 5:138664556-138664578 CTTTCAGGAGGGAGAGAAGCAGG + Intronic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998368319 5:141645103-141645125 CTTTGAGGAATGTGAGGAGACGG - Exonic
998447897 5:142212367-142212389 CTTTGAGGGGGTAGAGAAGAGGG - Intergenic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999658294 5:153832081-153832103 CTTTTAGGAAGAAGAGAAAATGG - Intergenic
999663932 5:153893666-153893688 TTGTGAGGAGGGATAGAAGATGG - Intergenic
1000308461 5:160018144-160018166 CTTTGTGGAAGGGGAGTAGAAGG - Intronic
1000322363 5:160144732-160144754 CGGTGAGGATGCAGAGAAAAGGG - Intergenic
1000395522 5:160770972-160770994 TTTTGAGGGTGGTGAGAAAAAGG - Intronic
1000787374 5:165562037-165562059 GTTTTATGAAGGAGAGAAGAGGG - Intergenic
1001165269 5:169359788-169359810 TTGTGAGGATGCAGAGAAAAGGG + Intergenic
1001745021 5:174085988-174086010 ATTTGAGAATGTAGAGGAGAAGG - Intronic
1001940367 5:175735869-175735891 CTTGAAGGATGGGGAGAAGCTGG - Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1002339885 5:178508859-178508881 CTGTTATGATGGGGAGAAGAAGG - Intronic
1002793866 6:455238-455260 CTTTGAGGCTGGACAGGTGAGGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1003548939 6:7084966-7084988 CCTTAAGGATGGGAAGAAGAGGG - Intergenic
1004093595 6:12530378-12530400 CTTTGAGGAGGGGGATAATATGG + Intergenic
1004359441 6:14957999-14958021 CTTAAAGGATCAAGAGAAGATGG - Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005520608 6:26597638-26597660 AATTGAGGGTGGAAAGAAGAGGG - Intronic
1005902522 6:30229587-30229609 ATTTGAGGATGGAGGGTGGAAGG - Intergenic
1006997369 6:38274025-38274047 ATTTCAGGAAGGAGTGAAGATGG + Intronic
1007056596 6:38892125-38892147 TTTAGAGGAGGGAAAGAAGAAGG - Intronic
1007195788 6:40059094-40059116 TTTTGAGGTTGCAGAGAAAAGGG + Intergenic
1007231720 6:40352832-40352854 GTTTGTAGCTGGAGAGAAGAGGG - Intergenic
1007339436 6:41181157-41181179 AGAGGAGGATGGAGAGAAGAAGG - Intergenic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007457199 6:41988366-41988388 CTATCAGGATTGAGAGAAGATGG - Intronic
1007457743 6:41993287-41993309 CTGTGAGGATGAGGAGAAAAGGG - Intronic
1007977219 6:46113854-46113876 ACATGAAGATGGAGAGAAGATGG + Intergenic
1008081078 6:47195129-47195151 CTTTGAGGATGGAAAGTTGATGG - Intergenic
1008306792 6:49912739-49912761 ATTTAAGGAGAGAGAGAAGAGGG + Intergenic
1008318519 6:50077675-50077697 CTTTAAGGCAGGAGAGAGGAGGG - Intergenic
1008417923 6:51265076-51265098 TTTGGAAGATGCAGAGAAGAAGG + Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1008795392 6:55296526-55296548 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1010330133 6:74613969-74613991 ATTGGAAGGTGGAGAGAAGAAGG - Intergenic
1010855483 6:80833261-80833283 GTCTGAGGATGGACTGAAGAAGG - Intergenic
1010869325 6:81018193-81018215 TTTTGAGGGTGGAGCCAAGATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013587508 6:111592647-111592669 CTTTGAGGATGGAATTAAGCTGG + Intronic
1013732209 6:113181779-113181801 CATTGACAATGGAGAGAATAGGG + Intergenic
1013747039 6:113358042-113358064 CTTTGTGGATAGAGACAAGGTGG - Intergenic
1013841745 6:114404342-114404364 TTATGAGTATGGTGAGAAGAAGG + Intergenic
1014768910 6:125439024-125439046 CATTGAGGATGCAGAACAGAAGG - Intergenic
1015365117 6:132388617-132388639 CTTGGAGAATGGAGAGGAAAGGG + Intronic
1015684557 6:135845278-135845300 CTTAGAGTGAGGAGAGAAGAGGG - Intergenic
1016202064 6:141422916-141422938 ATTGGATGATGGAGAGGAGATGG + Intergenic
1016256801 6:142116241-142116263 CTAAGAGGGTGAAGAGAAGAAGG - Intergenic
1017410733 6:154165296-154165318 CTTTGAGGAAGAGGAGAGGATGG - Intronic
1017417430 6:154235906-154235928 TGTTGAGGATGTAGAGAAAATGG + Intronic
1017570755 6:155742009-155742031 CTTTTAGGATGGGGTGAAGAGGG - Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017772353 6:157652966-157652988 CTTGAAGAATGGAGAGCAGAGGG + Intronic
1017858418 6:158372313-158372335 CTTGGAGGATCTGGAGAAGAAGG - Intronic
1018004093 6:159604203-159604225 CTTTAAGTGTGCAGAGAAGAAGG - Intergenic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018654660 6:166024105-166024127 CTTACAGGATGGACAGTAGAGGG + Intergenic
1019166329 6:170100053-170100075 CATAGAGGAAGGAAAGAAGAAGG + Intergenic
1019843207 7:3470207-3470229 TTTAAAGGAGGGAGAGAAGAAGG - Intronic
1020141532 7:5614640-5614662 CTTTGAGGGAGGGGAGGAGATGG + Intergenic
1020775786 7:12452084-12452106 TGTTGAGGATGTAGAGAAAATGG + Intergenic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021265052 7:18509763-18509785 CTATGAGGATCGAGAGAGAAGGG - Intronic
1021411867 7:20338046-20338068 TTTAGAGGTGGGAGAGAAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022136362 7:27453134-27453156 ATTTGAAAATGAAGAGAAGAGGG + Intergenic
1022832958 7:34086663-34086685 GCTTGAGGATGGAGGGAGGAAGG + Intronic
1022850300 7:34255034-34255056 TTTAGAGGATGGGAAGAAGATGG - Intergenic
1023785267 7:43701252-43701274 ATTTGAGGATGGAGAGTGGGAGG - Intronic
1024131190 7:46354588-46354610 CGGTGAGGAAGGAGAGAAGCAGG + Intergenic
1026741786 7:72983474-72983496 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026801629 7:73403902-73403924 TTATGAGGAAGGAGAGAAGAGGG + Intergenic
1026877987 7:73890633-73890655 CTTTGTCGGTGGAGAGGAGACGG - Intergenic
1027101949 7:75381603-75381625 TTATGAGGAAGGAGAGAAGAGGG - Intergenic
1027432200 7:78125838-78125860 CTTTGGGGTTGGGGAGAAAATGG + Intronic
1027905911 7:84181120-84181142 ATTTGAGGAGGGAAAGAAAAGGG - Intronic
1028677465 7:93482392-93482414 ATTTGAAGATGGTGAGAAAATGG - Intronic
1028750845 7:94381132-94381154 CATTGAGGATGAAGAGAATTAGG - Intergenic
1028821768 7:95219862-95219884 ATTTGGGGTTGGAGAGATGAGGG - Intronic
1030132986 7:106218911-106218933 CTTTGTGGATGGAGAGGAATGGG + Intergenic
1030939428 7:115627984-115628006 CTTTGAAGATGGAGAAAAAGGGG + Intergenic
1031131063 7:117833690-117833712 CTTGGAGGACAGAGAGGAGATGG - Intronic
1031916318 7:127566120-127566142 CTCTGAGGATGGAGCCAACATGG - Intergenic
1032474765 7:132204204-132204226 GGTGGAGGGTGGAGAGAAGAGGG + Intronic
1032632261 7:133666507-133666529 CTTAAAGGCAGGAGAGAAGAGGG - Intronic
1032941227 7:136794917-136794939 CTGTGAGGATGTGGAGAAAAGGG + Intergenic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033672008 7:143502159-143502181 ATTTGAGGAAGGAGAGAATTGGG + Intergenic
1034165328 7:149021103-149021125 CATTGAGGATGAAGAGGAGGAGG - Exonic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1035458778 7:159026435-159026457 TTTGGAAGATGGAGAGAAAAGGG - Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035692710 8:1570738-1570760 CTTCTGGGATGGAGAGGAGAGGG + Intronic
1035692926 8:1571768-1571790 CTTCTGGGATGGAGAGGAGACGG + Intronic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035829889 8:2684178-2684200 AGTTGAGGATGGAATGAAGAAGG - Intergenic
1037234112 8:16696250-16696272 CTTAGTGGAGGGAGTGAAGAAGG - Intergenic
1037889161 8:22614201-22614223 CTTGGATGATGGAGGGAAAAGGG - Exonic
1038455686 8:27670879-27670901 ACCTGAGGTTGGAGAGAAGATGG - Exonic
1038576386 8:28707464-28707486 CTTGGAAGATGGGGAGGAGAGGG - Intronic
1039135373 8:34316762-34316784 CTTTGAAGATGGAGGGAATGTGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040016693 8:42706065-42706087 CTAAGAGGATAGAGAGGAGAGGG + Intronic
1040475614 8:47774731-47774753 TGTTGAGGATGTAGAGAAGGTGG - Intronic
1041071101 8:54126747-54126769 CTTTGAGGATAGAGAAAAGTAGG + Intergenic
1041168327 8:55114209-55114231 CTGTGAGGTTGCAGAGAAAAGGG - Intronic
1041215515 8:55596295-55596317 CTTGGAGGGTGGGGAGAAGTGGG + Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1042319225 8:67457532-67457554 CAGAGAGGATGGAAAGAAGAAGG - Intronic
1042337963 8:67648353-67648375 CTTTGAGGAATGAGAGAGAAGGG + Intronic
1042425849 8:68647308-68647330 CCGTGAGGATGTAGAGAAAAGGG + Intronic
1042856189 8:73270540-73270562 CTTTCAGGAAGGAGGGGAGATGG + Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1043541282 8:81265676-81265698 CTTTTGGGAAGGAGAGAAGGAGG - Intergenic
1045173745 8:99697954-99697976 CTTGGAGAAAGAAGAGAAGATGG + Intronic
1045209534 8:100082371-100082393 ACTTGAGGATGGAGAGTGGAGGG - Intronic
1045240949 8:100400983-100401005 CCTGGAGGGTGGAGAGAAGATGG - Intronic
1045387547 8:101686282-101686304 GTTTGAGGAAGGAGAGGATATGG + Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045808822 8:106197700-106197722 TTTCAAGGAGGGAGAGAAGAGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1045909239 8:107386237-107386259 ATTTGAGGATGGAGGGTAGGAGG + Intronic
1046334105 8:112760286-112760308 CTAGGAGAATGGGGAGAAGAAGG + Intronic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1048189857 8:132278068-132278090 CTTTGAGGATGGACAGATTTTGG - Intronic
1049171755 8:141165878-141165900 CTTTGAGGATGGGGGGAGGTGGG - Intronic
1049233640 8:141497010-141497032 CTTGGAGGAAGGAGAGGAGGAGG - Intergenic
1049872478 8:144991245-144991267 CATTGAGGAAGGAGCCAAGATGG - Intergenic
1050013748 9:1211402-1211424 CTATGAGAATGGAGACAACAAGG - Intergenic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1050866083 9:10501173-10501195 CAATGAGGATGTAGAGAAAAGGG - Intronic
1050879061 9:10676108-10676130 AATTGAGGATGGAGCCAAGATGG - Intergenic
1051055300 9:12978188-12978210 CTTGGAAGGTAGAGAGAAGAGGG - Intergenic
1051082147 9:13306520-13306542 CTTTGACAGTTGAGAGAAGAAGG - Intergenic
1051428899 9:16962175-16962197 CTTCCAGGATGGATAGTAGAGGG - Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052001161 9:23282826-23282848 CTTTGTGTATGGATAGAAAAGGG + Intergenic
1053065001 9:35061939-35061961 CTTAGATGAAGGAGAGAAGTAGG + Intronic
1053300319 9:36944452-36944474 CTTTGAGGATGTGGAGAGCATGG - Intronic
1053444459 9:38141070-38141092 CTTTGAGTATCGGAAGAAGAAGG + Intergenic
1053791189 9:41687393-41687415 TTTTCAGGATGGTGAGGAGAAGG + Intergenic
1054179537 9:61899087-61899109 TTTTCAGGATGGTGAGGAGAAGG + Intergenic
1054658001 9:67681734-67681756 TTTTCAGGATGGTGAGGAGAAGG - Intergenic
1054914797 9:70485850-70485872 CTTGAAGGATGGGGAGAAAAGGG - Intergenic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1056446021 9:86666878-86666900 CTTTGTGGTAGGACAGAAGACGG + Intergenic
1056746218 9:89306169-89306191 CTTAGAGGAGGGAGACAGGAGGG - Intergenic
1057021580 9:91702009-91702031 TTGTGAGGGTGTAGAGAAGAGGG - Intronic
1057552406 9:96061627-96061649 CTTGGAGGATGAAGAAAGGAAGG + Intergenic
1058211324 9:102173675-102173697 CTTTGCGAGTTGAGAGAAGAAGG - Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058651839 9:107182102-107182124 CTTTGATGCTGGAGAGAGCAGGG - Intergenic
1058702931 9:107615526-107615548 ATTAGAGGCTGGAGAGAAAAGGG - Intergenic
1058795846 9:108497776-108497798 CTTTTGGGATGGAGCCAAGATGG + Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059173656 9:112149649-112149671 ATTTGAAGATTGGGAGAAGAGGG + Intronic
1059660479 9:116395264-116395286 CTTTCAGGATGGAGAGAGGTTGG + Intronic
1059695526 9:116726771-116726793 GTTTGAGGAAGGAGAGAAAGAGG - Intronic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1060865672 9:126994186-126994208 CTTTGAGAGTTGAGAGAAGAAGG + Intronic
1061776756 9:132970779-132970801 CTCTGAGGCTGCAGAGATGAAGG - Intronic
1062289825 9:135789503-135789525 CTGTGAGGAAGGCGTGAAGAGGG - Intronic
1203428566 Un_GL000195v1:66325-66347 CTTAGAGGGTGGAGAGAGGGAGG + Intergenic
1203437717 Un_GL000195v1:156916-156938 CTTAGAGGGTGGAGAGAGGGAGG - Intergenic
1185683742 X:1910110-1910132 CTAGGAGGAGAGAGAGAAGAGGG - Intergenic
1186056614 X:5655818-5655840 AGTTGATGAGGGAGAGAAGAAGG + Intergenic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186172412 X:6891445-6891467 CTTTGAGAATGGAAAGAAAGGGG - Intergenic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186733334 X:12433903-12433925 CTTTATAGGTGGAGAGAAGAAGG + Intronic
1186733370 X:12434344-12434366 CTTTATAGGTGGAGAGAAGAAGG - Intronic
1187311145 X:18144207-18144229 CTGTGAGGAGGGAGACATGAGGG - Intergenic
1187950666 X:24466995-24467017 CTTTGAGGGTGGAAAGAACTGGG - Intronic
1187990771 X:24869757-24869779 GTTTGTGGATGGAGGAAAGAAGG - Intronic
1188062027 X:25612699-25612721 GTTGGAGAATGGACAGAAGAAGG - Intergenic
1188565747 X:31524116-31524138 CTCTGAGGTTGGGGAGAAAAAGG + Intronic
1188775790 X:34216717-34216739 ACTTGAGGGTGGAGAGTAGAAGG + Intergenic
1188852275 X:35146292-35146314 CTTTGAGGATGGACATAAGCTGG - Intergenic
1189057523 X:37713964-37713986 CTTTAAGGAAGAAGAGAGGAAGG + Intronic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1189222026 X:39380809-39380831 CTTTGAGAATGGAGACCATAGGG + Intergenic
1189809521 X:44768344-44768366 CCTAGAGGATGGAGGGAAGTGGG + Intergenic
1190321148 X:49179924-49179946 CCTTTAGGAAGGAGAGATGAGGG - Intronic
1190462883 X:50696119-50696141 CTTTGAGGAAGGAGGCAACATGG + Intronic
1190585812 X:51940553-51940575 ACTAGAGGATGGAGAGAAGAAGG - Intergenic
1190809607 X:53870510-53870532 CCTTGAGGATGGAGAGTGGGAGG - Intergenic
1191656644 X:63605657-63605679 CTTTGAGGTTGCAGAGAAATAGG + Intergenic
1191868830 X:65728236-65728258 CATTGAGTTTGGAGAGATGAAGG - Intronic
1191982126 X:66937501-66937523 CTTTGATGAGTGAGAGAAGAAGG - Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1192786149 X:74337630-74337652 CGATGAGGATGCAGAGAAAAGGG - Intergenic
1192931497 X:75810919-75810941 CTTGGAGGGTGGAGCCAAGATGG - Intergenic
1193160582 X:78224603-78224625 ACTTGAGGATGGAGAGTAGCAGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193860550 X:86661325-86661347 CTTTGCGGATGCAGAGAAATGGG - Intronic
1193889364 X:87025402-87025424 TGTTGAGAATGCAGAGAAGAGGG - Intergenic
1195554578 X:106207229-106207251 CTTTGAGGATGAAGATCAGTTGG + Exonic
1195616945 X:106920140-106920162 CTTTGAGGGTGGTGAGAGGAGGG - Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195791134 X:108587753-108587775 CTGCAAGGATGCAGAGAAGAGGG - Intronic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197186988 X:123598644-123598666 TTTTGGGGATGGTGAGAAGGTGG - Intergenic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197373097 X:125648206-125648228 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1197896057 X:131316962-131316984 CTTAGAGGATAAAGAGAAAATGG + Intronic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198144145 X:133838160-133838182 TTTTTAGGATAGAGAGAAGTAGG - Intronic
1198739092 X:139821690-139821712 ACTTGATGAAGGAGAGAAGAGGG - Intronic
1199223581 X:145344886-145344908 ATTGGAGGATGGAGGGTAGAAGG + Intergenic
1199696898 X:150348950-150348972 TTTACAGGGTGGAGAGAAGAAGG - Intergenic
1199910056 X:152276913-152276935 CTTTGAGGAGGGAGGGAAACAGG + Intronic
1200182128 X:154156946-154156968 GTTTGAAAATGGAGAGATGAAGG - Intronic
1200187782 X:154194060-154194082 GTTTGAAAATGGAGAGATGAAGG - Intergenic
1200193432 X:154231200-154231222 GTTTGAAAATGGAGAGATGAAGG - Intronic
1200199187 X:154269004-154269026 GTTTGAAAATGGAGAGATGAAGG - Intronic
1200213852 X:154358797-154358819 CTTGGAGGAGGTAGAGCAGATGG - Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200298869 X:154952161-154952183 CCATGAGGCTGGAGAGAAGAGGG + Intronic
1200879055 Y:8193463-8193485 CTTTGAGGGTGGAGCCATGATGG + Intergenic
1201549245 Y:15202038-15202060 TCGTGAGGATGCAGAGAAGAGGG + Intergenic