ID: 920183142

View in Genome Browser
Species Human (GRCh38)
Location 1:204144828-204144850
Sequence TGGCATGGCAGAAATAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920183142_920183147 2 Left 920183142 1:204144828-204144850 CCCTGCTTATTTCTGCCATGCCA 0: 1
1: 0
2: 1
3: 30
4: 274
Right 920183147 1:204144853-204144875 TCTGCCAAGACAACTTTCCCTGG 0: 1
1: 0
2: 0
3: 26
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920183142 Original CRISPR TGGCATGGCAGAAATAAGCA GGG (reversed) Intronic
901458123 1:9375581-9375603 TGGCATGTCACGAATAAGGATGG - Intergenic
901461381 1:9393877-9393899 GGGCATGGGAGAAGAAAGCAAGG - Intergenic
903993678 1:27291193-27291215 TGCAAAGGCAGAAATAAACATGG + Intronic
906904396 1:49873771-49873793 ACGCCTGGAAGAAATAAGCATGG - Intronic
907413067 1:54295819-54295841 TAGAATGGCAGAAACTAGCAGGG - Intronic
907899580 1:58725673-58725695 TGGTATAGCAGAAATAATAAAGG - Intergenic
908176424 1:61559836-61559858 TGGCAGGGCAGAAAGATGGAAGG - Intergenic
908873222 1:68638638-68638660 TGGCTAGGTAAAAATAAGCAAGG - Intergenic
911400872 1:97373578-97373600 TGGCATGGGAGAAAGAGGAATGG - Exonic
912793985 1:112679283-112679305 GGGAATGGCTGAAATAAGGATGG + Intronic
914254200 1:145947654-145947676 TGACATAGCAGACATAAGGAGGG + Exonic
915101520 1:153504293-153504315 TGGCATTGCAGAAGGCAGCAGGG - Intergenic
916858784 1:168780210-168780232 CTGCTTGGCAGAAGTAAGCATGG + Intergenic
917162302 1:172071390-172071412 TGGCATAGCAGAAACATGCCTGG + Intronic
917852954 1:179081171-179081193 TGGCTTGGCTGAAGTAAGCCAGG + Intergenic
919443349 1:197667706-197667728 TGACATAGCAGAATTAAGAATGG - Intronic
920183142 1:204144828-204144850 TGGCATGGCAGAAATAAGCAGGG - Intronic
920831838 1:209472475-209472497 AAGTATGGAAGAAATAAGCATGG + Intergenic
921638110 1:217521538-217521560 GGGCATGGCAGCACTAAACAGGG + Intronic
923257404 1:232233559-232233581 TGGCATTGCAGAAAAAAATAAGG + Intergenic
924351802 1:243121732-243121754 TAGCAAGGCAGAAAGCAGCATGG - Intergenic
1063782356 10:9339926-9339948 TGTCATGGCAGAGATAAGCCTGG + Intergenic
1063938364 10:11102664-11102686 TGGCATTCAAGAAAAAAGCAGGG - Intronic
1064156810 10:12909425-12909447 GGGCAGGGCAGGAGTAAGCATGG - Intronic
1065092366 10:22247623-22247645 TGCTTTGGCAGAAATCAGCAGGG + Intergenic
1066072539 10:31834383-31834405 TCACATGGCAGAAATAACAAGGG - Intronic
1066619234 10:37326337-37326359 TGGAAGGACAGAAATAAGCTTGG + Intronic
1067384830 10:45809326-45809348 TGGGATCACAGAAATAAACAAGG - Intergenic
1067946647 10:50693499-50693521 TGGGATGGCAGAGATAAAAAGGG + Intergenic
1069242269 10:66157802-66157824 TGGCATGGATGAGATAATCAGGG - Intronic
1070403131 10:76070899-76070921 AGGCATGGGAGGAGTAAGCATGG + Intronic
1070881956 10:79858492-79858514 TGGGATGGCAGAGATAAAAAGGG + Intergenic
1071101300 10:82041036-82041058 ACTCATGGCAGAAATATGCATGG - Intronic
1071960989 10:90808797-90808819 TGGCATTGCAGAAGAAAGTAAGG - Intronic
1072244853 10:93534302-93534324 TGGCATGGTAGAAAGAAGATGGG - Intergenic
1073072446 10:100803280-100803302 TGGAAGGGCAGAAAGAAGGAGGG - Intronic
1074138855 10:110653237-110653259 TGGGGTGGCAGAAATAATAATGG - Intronic
1074249872 10:111734281-111734303 TGGCGTGGCAGAGAAAAGAAGGG - Intergenic
1074915502 10:117951156-117951178 TTGCATGGCAGAGATGAGCAAGG + Intergenic
1075807509 10:125200735-125200757 TGGCATGGCAGAAAGACAGAGGG + Intergenic
1078843187 11:15097676-15097698 TGTCATGGCAGAAAGTAACATGG - Intergenic
1079455000 11:20628785-20628807 TGGTGTGGCAGAAATAACCCAGG + Intronic
1079508399 11:21181485-21181507 GGGCATGGCAGAAATGAGATTGG + Intronic
1080960783 11:37157442-37157464 TAGCTTTGGAGAAATAAGCAAGG - Intergenic
1081082910 11:38765884-38765906 AGGCATGTCTAAAATAAGCATGG - Intergenic
1081286260 11:41274087-41274109 TGGCATGTCAGGAAATAGCAGGG + Intronic
1083146480 11:60763604-60763626 TGGCAGGGCTGCAGTAAGCAAGG + Intronic
1083692602 11:64419453-64419475 TGGCTTGGCAGCAATAAACCTGG + Intergenic
1086671082 11:89548680-89548702 TGGCATGGCAGGTGAAAGCAAGG - Intergenic
1087417102 11:97871375-97871397 TGGCATGGCAGAACCCACCATGG - Intergenic
1088035016 11:105300742-105300764 TGGCATGGCATAAATAATAGAGG - Intergenic
1089406553 11:118202529-118202551 TGGCAGGGCAGAGATAAGAATGG + Intronic
1091714227 12:2765625-2765647 TTGCAGGGCAGAATTTAGCAGGG - Intergenic
1092536700 12:9395602-9395624 TTGCAGGGCAGAAGTTAGCAGGG + Intergenic
1092548097 12:9469037-9469059 TTGCAGGGCAGAAGTTAGCAGGG - Intergenic
1092557975 12:9577719-9577741 TTGCAGGGCAGAAGTTAGCAGGG - Intergenic
1092684911 12:11031978-11032000 TGTCAAGCCAGAAATAACCATGG + Intronic
1092689588 12:11092870-11092892 TGTCAAGCCAGAAATAACCATGG + Intronic
1093220138 12:16410946-16410968 TTCCATGTCAGAAAAAAGCATGG - Intronic
1094504901 12:31053410-31053432 TTGCAGGGCAGAAGTTAGCAGGG + Intergenic
1094513320 12:31110198-31110220 TTGCAGGGCAGAAGTTAGCAGGG + Intergenic
1095264435 12:40137368-40137390 GGGCAAGTCACAAATAAGCAAGG + Intergenic
1095348597 12:41182607-41182629 TGGCATGGCAGAACAAGTCATGG + Intergenic
1096315608 12:50562378-50562400 TGGCATTGCTGAAATAAGATAGG - Intronic
1097446153 12:59674690-59674712 CAGCATGGCAGAAATAAGGCAGG + Intronic
1097830269 12:64217295-64217317 TGGGGTGTCAGAAATAAGTAGGG - Intronic
1098016809 12:66113884-66113906 TAGCATGGCAGAAAAGAGGACGG + Intergenic
1098094609 12:66941645-66941667 TGGGAAGGAAGAAATGAGCAAGG - Intergenic
1099499246 12:83390988-83391010 TTCCAAAGCAGAAATAAGCATGG + Intergenic
1101445333 12:104733314-104733336 TGGCATGGAAGAAAGAGGAAAGG + Intronic
1107409688 13:40147072-40147094 CTGCATGGCAGAAGTGAGCATGG - Intergenic
1107739387 13:43433189-43433211 TAGCATGGCAGAGAAAATCAAGG + Intronic
1108064175 13:46560979-46561001 TTGCATGGCTGGAGTAAGCAAGG - Intronic
1108478827 13:50846359-50846381 TGGCATGGCAGAAAGAAGGAAGG - Intergenic
1108743337 13:53362209-53362231 AGGGATGGAAGAAATAAGGAAGG - Intergenic
1108970576 13:56370416-56370438 TAACATGAGAGAAATAAGCAAGG + Intergenic
1109209857 13:59522601-59522623 TGGCTTGAGAGAAATAAGCCAGG + Intergenic
1109820289 13:67643845-67643867 TGGGGTGGCAGTAATGAGCAGGG - Intergenic
1111098545 13:83547557-83547579 TGGCATAGCATAGATAAGCAGGG + Intergenic
1111634231 13:90882515-90882537 TGACATGGTTGAAAGAAGCAAGG - Intergenic
1112199692 13:97262582-97262604 TGGAATGGCAAAAATAAGAGAGG - Intronic
1112815256 13:103265368-103265390 AGCCATGGCAGGAAAAAGCAGGG - Intergenic
1113535809 13:111065554-111065576 TGGCGAGGCAGACATGAGCAGGG + Intergenic
1114317820 14:21524095-21524117 TGGAGTGGCAGAAAGTAGCACGG - Exonic
1115296233 14:31830442-31830464 TGGCATGAAAAAAATAATCATGG - Intronic
1115639684 14:35326218-35326240 TGGTATGGCAGAAATGAGGAAGG - Intergenic
1115977374 14:39011993-39012015 TCACATGGCAGAATAAAGCAGGG - Intergenic
1116146153 14:41071798-41071820 TCACATGGCAGAAGTAAGTAGGG + Intergenic
1116779375 14:49219238-49219260 TGGCATGGCACAAAAGAGCACGG - Intergenic
1118908594 14:70042565-70042587 TGGAATGGCAGCAGTAAGCATGG - Intergenic
1120245334 14:81999230-81999252 TCTCATGGCAGGAACAAGCATGG + Intergenic
1121154483 14:91670273-91670295 TGGCATGATAGTCATAAGCATGG - Intronic
1121540522 14:94722580-94722602 TGGCCTGGTAAAAATAATCAGGG - Intergenic
1121848026 14:97191405-97191427 TGGCATGGCTGCAGTGAGCAGGG - Intergenic
1123218778 14:106837774-106837796 TGGCGGGGCAATAATAAGCAAGG - Intergenic
1124095871 15:26648473-26648495 TGGCATGGATGAACTAACCATGG + Intronic
1125905229 15:43385586-43385608 TGGCATGGTGGAAATAAGAGTGG - Intronic
1126390633 15:48146821-48146843 TGACATGGCAGAAAAATGGATGG + Intronic
1126561493 15:50048850-50048872 TGGGGTGGCAGCAATGAGCAGGG + Intronic
1126728775 15:51659748-51659770 TGGCATGAGAGAAAGAAGCGGGG + Intergenic
1128037955 15:64543293-64543315 TGGTATGGCTGAAATAAAGAAGG - Intronic
1128387229 15:67158438-67158460 TTGCATGGCACAGAGAAGCAGGG + Intronic
1128909486 15:71499369-71499391 TGGCATGGCAAAAATGTGCTAGG - Intronic
1129119562 15:73387877-73387899 TAGGAAGGCTGAAATAAGCAAGG + Intergenic
1129124280 15:73424741-73424763 TGGCAGGGCAGAAAGAGGGAAGG - Intergenic
1130564997 15:84986455-84986477 TGGGCTAGCAGAAAAAAGCAAGG - Intronic
1130740400 15:86592895-86592917 TAGCTAGGCAGATATAAGCAGGG - Intronic
1131440119 15:92453613-92453635 TGGCCAGGCAGAGAAAAGCAAGG - Intronic
1132408426 15:101559268-101559290 TGGAATGGCTAAAATAAACATGG - Intergenic
1133493885 16:6297759-6297781 TGGCATGGCAGAAAGAAGAGAGG + Intronic
1134173944 16:11990883-11990905 TGCCCTGGCAGAAATAATGAAGG - Intronic
1140150953 16:72364659-72364681 TGGCAAGACAGGAGTAAGCAAGG + Intergenic
1140463535 16:75160807-75160829 TGGCATGGCAGAAAGCAAAAGGG + Intronic
1140895373 16:79320052-79320074 TTGCATGGCAGACAGAAGGAAGG + Intergenic
1140967386 16:79980155-79980177 TGCCATGGCAGAGAGAAGCCAGG + Intergenic
1142897929 17:2994233-2994255 TGGCATGGCAGAAAGAATGCTGG - Intronic
1143970944 17:10795247-10795269 TGGCTTGTCAGAAAAATGCACGG + Intergenic
1144285041 17:13765949-13765971 TGAGGTGGCAGAAACAAGCATGG + Intergenic
1145764051 17:27445811-27445833 TGGCTTGGAAGAAATGAGCTGGG + Intergenic
1147484823 17:40802363-40802385 TGGCAGGGCAGGAAAAAGGAGGG + Intergenic
1147684826 17:42280771-42280793 TGCTCTGGCAGAAGTAAGCAGGG - Intergenic
1148959451 17:51380959-51380981 TGGAAAGACATAAATAAGCAGGG + Intergenic
1150440062 17:65183795-65183817 GTGCAGGGGAGAAATAAGCAAGG - Intronic
1151123808 17:71822973-71822995 TGACATGGCTGAAATAAGGAGGG + Intergenic
1151134721 17:71935186-71935208 TGTCATGGCAGAAATCACCAAGG - Intergenic
1151188770 17:72382531-72382553 TGCGATGGCAGAAATAGGCTCGG - Intergenic
1153280048 18:3406581-3406603 TGGCATTGCATAAACAAACAAGG - Intergenic
1154096167 18:11417027-11417049 GGGCATGGCAGCAGTAAGCAAGG + Intergenic
1155350196 18:24898747-24898769 TGGCAAGGCAAAAATAATCATGG - Intergenic
1156412083 18:36840194-36840216 TGGAATTGCAGAAACAAACAAGG - Intronic
1157027562 18:43864271-43864293 TGACATGGCAGAAATAATGTGGG + Intergenic
1157996786 18:52566958-52566980 TAGCATAGCAGCAAAAAGCAGGG + Intronic
1158072332 18:53487499-53487521 TGGCACAGCAGAAATCACCAGGG - Intronic
1159265001 18:66069293-66069315 TGGGAAGGCAGAAAACAGCAGGG + Intergenic
1159641604 18:70869529-70869551 TATAATGGCAGAAATAAGAAAGG - Intergenic
1159664269 18:71138706-71138728 TGCAATGGCAGCAATTAGCAGGG - Intergenic
1161527836 19:4768401-4768423 TTGCATGTTAGAAATAATCAGGG - Intergenic
1161912548 19:7205445-7205467 TTGCATGGCAGACATGAGGAAGG - Intronic
926988473 2:18650394-18650416 TGCCATGGCAGAAAGACGCATGG + Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
928614037 2:33018572-33018594 TGACATTCCAGAAATAACCATGG + Intronic
929632327 2:43476389-43476411 TGGCACAGCAGAAACAAGAAGGG + Intronic
931861051 2:66354922-66354944 TGGCAGAGCAGAAAGAAGAAAGG + Intergenic
933208315 2:79535892-79535914 TGGCAAGGCAGATCTAATCATGG - Intronic
933490845 2:82984503-82984525 TGACATGTCATCAATAAGCAGGG - Intergenic
933612045 2:84446198-84446220 TGCTATGGAAGAAATAAGCCGGG - Intronic
933834449 2:86233989-86234011 TGGGATTGATGAAATAAGCAAGG + Intronic
935171015 2:100611630-100611652 TGGCAGGGCAGAATGAAGCTGGG + Intergenic
935222913 2:101029996-101030018 TGGCATGGGGGAAATAAAAAAGG + Intronic
936480012 2:112877397-112877419 TGGCAGGGCAGGCATCAGCAGGG - Intergenic
936757953 2:115737151-115737173 TGGCAAGGGAGAAATAAACGCGG - Intronic
937304422 2:120862426-120862448 TGGCAGGGCAGACATAACCCAGG - Intronic
937944668 2:127321880-127321902 TGGAATGTCAGGTATAAGCATGG - Intronic
938265730 2:129926870-129926892 TGGCATAGCCGAAAGCAGCAGGG + Intergenic
939823549 2:146985965-146985987 TGGCCTGGAAGGAAGAAGCAAGG - Intergenic
939981534 2:148788134-148788156 TAGTATGGCAGAAACGAGCATGG - Intergenic
940143202 2:150518123-150518145 TGGCATGCCAGATACAAGCAAGG - Intronic
940939749 2:159545312-159545334 TGGCAGGGTAGAACTAAGCAAGG - Intronic
941830955 2:169959076-169959098 TGGAATGGAAGAAATAGTCAGGG - Intronic
942621317 2:177847102-177847124 TGGCATGGTACGAATAAGGAAGG - Intronic
947295887 2:228629568-228629590 GGGAAAAGCAGAAATAAGCAGGG + Intergenic
947481989 2:230509314-230509336 TGGTATGGCAGAAATATCCAAGG - Intronic
948100413 2:235368482-235368504 TGGCTAGGCAGAAAGAAGAATGG - Intergenic
1171211584 20:23321130-23321152 TGGCATGGCAGAGAGAAGAAAGG - Intergenic
1171915363 20:31058469-31058491 TGGAATGGCATAAATTAGAATGG + Intergenic
1175802815 20:61810742-61810764 TGCCAGGGCAGAACCAAGCAGGG + Intronic
1177159778 21:17535335-17535357 AGGCATGGTAGATCTAAGCAGGG - Intronic
1177315209 21:19451378-19451400 GGTAAAGGCAGAAATAAGCATGG + Intergenic
1177646074 21:23900945-23900967 TGGCAGGGCAGAAGAGAGCATGG + Intergenic
1181601190 22:23952790-23952812 TGCCATGGAAAAAATAAACAGGG + Intergenic
1181607319 22:23988536-23988558 TGCCATGGAAAAAATAAACAGGG - Intergenic
1181756022 22:25025673-25025695 TTCCATGGCAGAAACAAGAAGGG - Intronic
1182376249 22:29850531-29850553 TTGCATGGCAGAAGGAAGAAGGG + Intergenic
1183512464 22:38244087-38244109 TGGGAAGGCAGAAATATGAAAGG + Intronic
1183574317 22:38677504-38677526 TGACAGGACAGAAACAAGCAAGG + Intergenic
949196925 3:1321924-1321946 TGTCACGGGAGAAATAAGGAAGG + Intronic
950336416 3:12197445-12197467 GTACCTGGCAGAAATAAGCAAGG - Intergenic
951388566 3:22073549-22073571 TGGCAAGGAATAAAAAAGCAAGG + Intronic
952651543 3:35733411-35733433 TGCAATGACAGAAATAAGCCGGG - Intronic
953095793 3:39775605-39775627 TGTAATTTCAGAAATAAGCAAGG + Intergenic
953455354 3:43036305-43036327 TGGCAAGGCAGAGAGAGGCAGGG + Intronic
954843100 3:53530543-53530565 TGGCCTGGCACCTATAAGCAGGG + Intronic
955829098 3:62982583-62982605 AGGCATGGCAGCAGCAAGCAGGG - Intergenic
958421821 3:93939106-93939128 TGGCATTGCAGAAGAAAACAAGG - Intronic
958535854 3:95402134-95402156 TATTATGGCAAAAATAAGCAAGG + Intergenic
959019995 3:101178409-101178431 TGGGATGGAAGCAAAAAGCAAGG + Intergenic
959533426 3:107459094-107459116 TGGCAAGGCAAATATAAGAAGGG + Intergenic
960216092 3:115039273-115039295 TGGAATGGTAGAAAGAATCAAGG + Intronic
961122825 3:124387555-124387577 TGGCAAAGGAGAAAAAAGCATGG - Intronic
963112460 3:141698777-141698799 TGGCAGGACAGACAGAAGCAGGG + Intergenic
964810134 3:160654461-160654483 TGGCCTGGCAGAAATCCCCATGG + Intergenic
967616258 3:191571157-191571179 TAGAATGGCAGAGATAACCAGGG - Intergenic
967669687 3:192218250-192218272 TGGCATGTGGGAAATAAGTAAGG + Intronic
967752953 3:193135397-193135419 AGGCAAGGCAGGAATGAGCAAGG + Intergenic
968310796 3:197681716-197681738 TGGCGTGGCAGAAGTAGGGAAGG - Intronic
970567063 4:17341838-17341860 TGGGATGGCAGAAAGCAGGATGG - Intergenic
971923822 4:32980123-32980145 TGCTATGACAGAAATATGCATGG + Intergenic
973309901 4:48697833-48697855 TGGCAAAGAAGAAATAAGAATGG + Intronic
974516950 4:62928258-62928280 TGTTATGGCAGAAAAAAGAAAGG + Intergenic
976232967 4:82865197-82865219 TGGCATGAAAGAATTAGGCAAGG + Intronic
977491426 4:97717225-97717247 AGGGATGGCAAAAATAAACATGG - Intronic
977857583 4:101912663-101912685 TGGCAGGTCTGAAATATGCAGGG + Intronic
977984164 4:103361998-103362020 TGGAGTGGCAGTAATGAGCAGGG - Intergenic
978818182 4:112932952-112932974 TGGTATAGCAGAAATAAGAATGG + Intronic
979169153 4:117577735-117577757 TGGCATGGCAGACATAGGCCAGG - Intergenic
979250136 4:118558790-118558812 TAGCAAGGCAGAAAGCAGCATGG + Intergenic
979587162 4:122433827-122433849 TGCCATGGCATAAGTAAGTATGG + Intergenic
980050940 4:128039834-128039856 AGGTAAGACAGAAATAAGCAAGG + Intergenic
980168236 4:129253807-129253829 TGGAATGGCAGGAAGATGCATGG + Intergenic
980252194 4:130331891-130331913 TGGCAAGTCAGAAATTTGCAGGG + Intergenic
981395401 4:144241917-144241939 TTGCATGGCAGAAACAATCTAGG - Intergenic
985431196 4:189881811-189881833 TGGCAGGGAAGAAAGAAGGAAGG + Intergenic
985993399 5:3582278-3582300 TGGAATGACAGAAATTAACAAGG - Intergenic
987341971 5:16947242-16947264 GGGCATGGCAGGAATAAGGAAGG + Intergenic
988521974 5:31954456-31954478 AGGAATGGCAGAAAAAAGCAGGG - Intronic
988704472 5:33710991-33711013 AGGGATGGCAAAAATAAGAATGG + Intronic
990860980 5:60327015-60327037 TGGCATGGGATATGTAAGCAGGG - Intronic
992552872 5:77875754-77875776 TGGCAGTGAGGAAATAAGCACGG + Intergenic
993347733 5:86805937-86805959 TAGCTTGTCAAAAATAAGCATGG - Intergenic
993568524 5:89506427-89506449 TGGGATGGCAGAAGTAGGCATGG - Intergenic
994128496 5:96197222-96197244 GGGAATGGCAGAAACAAGCAAGG - Intergenic
995231957 5:109775594-109775616 TGGCATGGCTGAAACAAGAGTGG - Intronic
995557580 5:113345116-113345138 TGGCCTGGCAGAACTCACCATGG + Intronic
996556181 5:124781361-124781383 CAGCAAGGCAGGAATAAGCATGG + Intergenic
996892820 5:128442633-128442655 TGGCACAGCAGAAATAAACATGG + Intronic
996928767 5:128860962-128860984 TAGAATGGCAGGAAGAAGCAGGG + Intronic
998073705 5:139218968-139218990 TCCCAAGGCAGAAAAAAGCAAGG - Intronic
998744226 5:145238524-145238546 TGGCATAGGAGAAAAAGGCATGG - Intergenic
1000201638 5:159016638-159016660 TGGCATTGCAGTCATAGGCATGG - Intronic
1000219513 5:159199553-159199575 TGGCAAGGTAGAAATTAGAAAGG - Intronic
1000676066 5:164124065-164124087 TCACATGGCAGAAATAAAAAAGG + Intergenic
1001287671 5:170435623-170435645 TAACAAGGCAGGAATAAGCATGG - Intronic
1001330354 5:170757980-170758002 TGGCATGGAAGAAAGAAGGAGGG + Intergenic
1003923978 6:10859673-10859695 TGGCAAGTCAGAAATATGCAGGG - Intronic
1003938981 6:11005280-11005302 TAGCCTGGCAGAACTATGCAAGG - Intronic
1004245834 6:13974186-13974208 TGGAATGGCAGAAAAGAGCATGG - Intronic
1007540637 6:42640513-42640535 TGGCAAGTCTGAAATATGCAGGG + Intronic
1008679665 6:53858517-53858539 TGGCCTGACATAAATAATCAGGG + Intronic
1009464206 6:63951235-63951257 TGGCATTGCAGAAGAAAGTAAGG - Intronic
1009561135 6:65244821-65244843 TGCCATGGTAGAAATAAGTTCGG - Intronic
1009760329 6:67996849-67996871 TGGCAGGTCAGACATAACCAAGG - Intergenic
1010929611 6:81785178-81785200 TGGCATGGCAGAGAATGGCAAGG + Intergenic
1011307343 6:85942835-85942857 TGGGATGCAAGAAATAAACATGG - Intergenic
1012939136 6:105399261-105399283 TGGCATTGTAGAACAAAGCAAGG - Intronic
1015547731 6:134378579-134378601 TGGTATGGCAAAGATAAGCCTGG - Intergenic
1015688622 6:135895333-135895355 TGGCGTGTTAGAAATAAACAGGG - Intronic
1018504091 6:164444761-164444783 TTGCATGGCAGAAATGAAGATGG - Intergenic
1018751201 6:166807877-166807899 TGCCATGGCAGAAATCAGTGCGG - Intronic
1019611403 7:1938569-1938591 GGGCATGTCAGAAATAACCAAGG + Intronic
1019611406 7:1938590-1938612 GGGCATGTCAGAAATAACCAAGG + Intronic
1022119636 7:27295472-27295494 TGTCATGAAAGACATAAGCAGGG + Intergenic
1022848232 7:34233352-34233374 TGGAATGCCAAAAAAAAGCAGGG - Intergenic
1024453878 7:49580491-49580513 TGCCATGGCAGAGAAAAACACGG - Intergenic
1024474828 7:49799066-49799088 TGGCATGGCTGAAAAGGGCAGGG + Intronic
1024782021 7:52862109-52862131 TTGAATGGCAGAAATATTCAAGG - Intergenic
1025066626 7:55861978-55862000 TAGCATGGCAGAAAGAACAATGG - Exonic
1025755152 7:64331309-64331331 TGTCATAGCAGAAAGCAGCATGG - Intronic
1026274443 7:68864406-68864428 TAGCTAGGCAGACATAAGCAGGG + Intergenic
1026954545 7:74368844-74368866 GGGCATGGCTGAAATAAGACTGG - Intronic
1031109532 7:117590549-117590571 TGGTATGGCAGAATGTAGCATGG + Intronic
1032556437 7:132840588-132840610 AGCTTTGGCAGAAATAAGCAGGG - Intronic
1033021539 7:137730102-137730124 TGCCATGCCAGAGATAAGAAGGG - Intronic
1036006492 8:4670190-4670212 AGGCATAGCAGAAATATACATGG - Intronic
1038114720 8:24540527-24540549 TCCCATGGCAGAAATAAGTGGGG + Intergenic
1038525055 8:28265814-28265836 TGGGATGGCAGAAAGAGGGACGG + Intergenic
1039092143 8:33843678-33843700 TGGCATGGCTGGGATAGGCATGG + Intergenic
1039531502 8:38267388-38267410 TGGCCTGGAAGAAAGCAGCATGG + Exonic
1041400559 8:57439243-57439265 CTGCATGACAGAAATAAGTAAGG - Intergenic
1041450231 8:57997970-57997992 TGGCATGACAGAAAGATTCATGG - Intronic
1042762666 8:72287689-72287711 TGGCCTGGCTGATTTAAGCATGG - Intergenic
1042812128 8:72837478-72837500 TGTCATGGCACAACTAAGGATGG - Intronic
1043922499 8:85999485-85999507 TGGGAAGAAAGAAATAAGCACGG - Intronic
1044690829 8:94876811-94876833 TGGTGTAGCAGAAATTAGCAAGG - Intronic
1044794566 8:95883919-95883941 TAGCATAGCAGAAAAGAGCAGGG - Intergenic
1045412345 8:101931456-101931478 TGGCAGAGCAGAAAGAAGCCTGG + Intronic
1046723559 8:117650419-117650441 AGACATTGCAGAAATGAGCAAGG - Intergenic
1047578403 8:126184244-126184266 TAGCATGGCAGAAAAATGGAGGG + Intergenic
1047755883 8:127918117-127918139 AGTCATGGCAGAGATGAGCAGGG - Intergenic
1048474036 8:134727040-134727062 TAGCAAGGCAGACATGAGCAGGG - Intergenic
1050042981 9:1514879-1514901 TGGGTAGGCAGACATAAGCAGGG - Intergenic
1050138846 9:2496319-2496341 GGCCAAGGCAGAAATGAGCATGG - Intergenic
1050737483 9:8780551-8780573 TGGCTTGGCAGAAACTACCATGG - Intronic
1051213763 9:14774444-14774466 TGGCATGTCCGAAATACACAGGG - Intronic
1051662816 9:19441528-19441550 AGGGATGGCATAAATAAGGAAGG - Intronic
1053257206 9:36627834-36627856 TGGCAAGGGATAAATAAGAATGG - Intronic
1055873200 9:80910443-80910465 TCACATGCAAGAAATAAGCAAGG - Intergenic
1057956446 9:99412023-99412045 CCGCATGTCAGAAATCAGCATGG - Intergenic
1059287168 9:113184343-113184365 TGACATGCTAGGAATAAGCATGG + Exonic
1060975979 9:127765272-127765294 GGTCAGGGCAGAATTAAGCAGGG - Intronic
1062051735 9:134450818-134450840 TCACATGGCAGAAGTGAGCAAGG + Intergenic
1187640726 X:21286108-21286130 TGGAAAGGCTGAAATAAGGAAGG + Intergenic
1187664282 X:21586855-21586877 AGGCATCGCAGAAATATGAAAGG + Intronic
1188219027 X:27517304-27517326 GGGCATGGCAGATATGAGAAGGG + Intergenic
1189318859 X:40075129-40075151 TGGCCTGGCAGCACTGAGCATGG - Exonic
1190137363 X:47808974-47808996 TGGCATGGGAGAAAAGAGCAGGG + Intergenic
1190456070 X:50628900-50628922 TGACATGCCAGATATAGGCAGGG - Intronic
1190539951 X:51467030-51467052 AGCTATGACAGAAATAAGCATGG + Intergenic
1190980275 X:55451607-55451629 TGGGACTGCAGAAACAAGCAGGG - Intergenic
1191978205 X:66896829-66896851 TGCCGTGGCAAAAGTAAGCATGG + Intergenic
1192763626 X:74121563-74121585 TGACATGGGAGAAATTATCATGG + Intergenic
1193696343 X:84710808-84710830 TGGGTTGGCAGTAATGAGCAGGG - Intergenic
1197004958 X:121484709-121484731 TGTCATGGTTGAAATAAGAAAGG - Intergenic
1197548353 X:127856205-127856227 GGGCTGGGGAGAAATAAGCAGGG - Intergenic
1199244083 X:145582727-145582749 TGGGATTTCAGAACTAAGCAAGG - Intergenic
1201339160 Y:12913729-12913751 TGACATGGGAGAAATTATCATGG + Exonic
1201625684 Y:16012143-16012165 AGGGATGGCAGAAATGAGGAAGG + Intergenic