ID: 920183337

View in Genome Browser
Species Human (GRCh38)
Location 1:204146088-204146110
Sequence CAGGGTCCCCAAAGGCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920183337 Original CRISPR CAGGGTCCCCAAAGGCACAT GGG Intronic
900883631 1:5400461-5400483 CAAGGACCCCAGAGACACATGGG - Intergenic
901131395 1:6963883-6963905 CAGTGTCCCCCAGGGCACAAAGG - Intronic
903240304 1:21978314-21978336 GAGGGTCCCCAAAAGCAAAGAGG - Intronic
903244053 1:22002948-22002970 GAGGGTCCCCAAAAGCAAAGAGG - Intronic
904079313 1:27862227-27862249 CAGAGTCCCCAGAGGCACCTTGG - Intergenic
904181669 1:28670131-28670153 AAGGGTCCCCAAATGCACTTTGG - Intronic
904458937 1:30664046-30664068 CACTGTGCCCAAAGGCACAGGGG + Intergenic
905296782 1:36959453-36959475 CAGGGGCCACACAGGCTCATGGG - Intronic
908224509 1:62042392-62042414 GAGGGTCCACATAGGCAAATGGG - Intronic
910646048 1:89516448-89516470 CAGGGTCCCCAAGGACAAAAAGG - Intergenic
912375735 1:109208430-109208452 CAGGGTCCCTAACGGCCCACCGG + Intergenic
913099193 1:115547372-115547394 CAGATTTCCCAAAGGAACATTGG + Intergenic
913524251 1:119676076-119676098 CAGGCTCCCCAAGGACACACAGG + Intronic
915008714 1:152664537-152664559 CAGGGACCACAAAGACTCATGGG + Exonic
915220579 1:154371361-154371383 CATGGTACCCAAAGGCAAAGTGG + Intergenic
915334711 1:155134362-155134384 CATGGTCCCTTAAGGCACAGTGG + Exonic
920183337 1:204146088-204146110 CAGGGTCCCCAAAGGCACATGGG + Intronic
922082840 1:222314300-222314322 TAGGGACCCAAAAGACACATTGG - Intergenic
923425001 1:233859987-233860009 CGCTCTCCCCAAAGGCACATAGG + Intergenic
924621984 1:245669937-245669959 GAGGGTCCACAAAGGCAGAGTGG + Intronic
1066126292 10:32346497-32346519 CGGGGGCCCGAAAGGCACAAAGG - Intronic
1066439718 10:35426939-35426961 CAGGGAGCCCAGAGGCACAAAGG - Intronic
1069177622 10:65312919-65312941 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1069934991 10:71909289-71909311 CAGTGTCCCCAAAGGCTCAGAGG + Intergenic
1072275672 10:93820437-93820459 CAGTCTCCCCAAAGGCTCACGGG + Intergenic
1078484155 11:11706286-11706308 GAGGCTCCCCACAAGCACATGGG + Intergenic
1079556995 11:21771489-21771511 CATGGCCCCTAAAGGAACATGGG + Intergenic
1081680320 11:44998025-44998047 CAGGCTCCCAAAGGGCAGATTGG - Intergenic
1082826882 11:57586530-57586552 CAGAGTCCCCACTGGCACAGTGG + Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086578463 11:88368371-88368393 TAGGGTTCCCAAAAGCACAGGGG - Intergenic
1088806652 11:113358846-113358868 CTTGGTCCCCAAAGGCTCTTGGG - Intronic
1089376624 11:117999430-117999452 CAGGGGCCCCAACGGGACAGTGG + Exonic
1091523266 12:1269714-1269736 CACTTTCCCAAAAGGCACATGGG + Intronic
1092729060 12:11511262-11511284 CAGGGTCCCCATGAGCACATGGG - Intergenic
1093227816 12:16506673-16506695 CATGGTACACAAAAGCACATAGG - Intronic
1093366253 12:18302776-18302798 CAGGGTCCCCAGTGGTACTTAGG + Intronic
1100454807 12:94741786-94741808 TAGGGTCCTGAAAGGCATATTGG - Intergenic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1104096211 12:125560214-125560236 CTGGGTCACCAAAAGCACCTTGG + Intronic
1104962438 12:132494575-132494597 CAGGGTGCCCAGGAGCACATTGG + Intronic
1104984600 12:132589536-132589558 CAGGTTTCCCAAAGGCCCCTGGG - Intergenic
1105070038 12:133228658-133228680 CAGGGGCCCCACAGGCATTTGGG - Intronic
1107288516 13:38824507-38824529 CAGTCTCACCAAAGGCTCATAGG + Intronic
1108764362 13:53608584-53608606 CAGGGTTCCTAAAGGGAAATGGG - Intergenic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1110670353 13:78169708-78169730 CAAGGCCCCCAAAAGCACAGAGG + Intergenic
1113365872 13:109675504-109675526 AAGGGAACCCAAAGGCAGATGGG + Intergenic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1115475036 14:33805343-33805365 CAGGGTCCCACAAGGCAGAGGGG + Intergenic
1116023988 14:39494336-39494358 AATGGTTCCCAAAGCCACATTGG + Intergenic
1121244128 14:92450326-92450348 CAGACTCCCAAAATGCACATGGG - Intronic
1121843259 14:97151968-97151990 CAGGAGCCCCAAAGCCACAGTGG + Intergenic
1121894402 14:97632548-97632570 TAATGTCCCCAAAGGCATATTGG - Intergenic
1124335873 15:28856702-28856724 CAGCCTCCCCAAAGGCTCAGAGG - Intergenic
1125722254 15:41850967-41850989 GGGGGTCCCCAAAGGGACAGTGG - Intronic
1126579034 15:50226065-50226087 CAGAGTTCCCAAAGGTACAGTGG + Exonic
1129822648 15:78615416-78615438 CAGTGGCCCCAAAGCCACAGTGG + Intronic
1129839382 15:78734406-78734428 CAGGGTCCCCATAAGCAAAGAGG + Intergenic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1132231867 15:100190451-100190473 CAAGGTCCCCAAAGGCATTCAGG + Intronic
1133832817 16:9339873-9339895 CAGGGTCCACAAACGCTCAAAGG - Intergenic
1135787758 16:25365805-25365827 CAGGCTTCCCAAAGGCACCAAGG + Intergenic
1136189233 16:28605984-28606006 CAGCCTCCCCATAGGCACTTGGG - Intronic
1136317799 16:29464390-29464412 CAGCCTCCCCATAGGCACTTGGG + Intronic
1136432374 16:30203735-30203757 CAGCCTCCCCATAGGCACTTGGG + Intronic
1139434062 16:66926130-66926152 CAGGGCCCCCAGGGGCTCATGGG - Intergenic
1143846701 17:9777509-9777531 CAGTGTCACTAAATGCACATTGG - Intronic
1144312230 17:14024152-14024174 CAAGGCCCCCAGAGGGACATAGG + Intergenic
1144498299 17:15764339-15764361 CAAGGCCCCCAGAGGGACATAGG + Intergenic
1148575146 17:48705328-48705350 CTGGGTCCGCAAAGGCAGATCGG + Intergenic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1151144836 17:72030881-72030903 CCGCCTCCCCAAAGGCACAGAGG + Intergenic
1152764408 17:82128262-82128284 CCGGGACCCCTAAAGCACATGGG - Intronic
1157092745 18:44655217-44655239 CAGGGTTTCCATAAGCACATAGG + Intergenic
1158759706 18:60370008-60370030 CAGGGTCTTCAAATGCTCATGGG - Intergenic
1160045369 18:75381649-75381671 CAGGGTCACAAAAGTCACAATGG + Intergenic
1160785344 19:897784-897806 CAGGGTCCCCATCCGCACAGTGG - Intronic
1161316841 19:3621207-3621229 CAGGGTCCCCCACTGCACGTGGG + Intronic
1161620592 19:5294959-5294981 CAGCATCACCAAAGGCACACAGG + Intronic
1163153855 19:15429620-15429642 CGGCCTCCCCAAAGGCACAGTGG - Intronic
1163552356 19:17972660-17972682 CAGGGTCCCTAATGTCCCATAGG + Intronic
1163743790 19:19033194-19033216 CCGCGTCCACAAAGGCTCATTGG - Intronic
1164608313 19:29615824-29615846 GGGGGTCCCCAAAGGTCCATTGG + Intronic
1165447259 19:35863100-35863122 GAGGGTCCCCAAATTCAAATAGG + Intronic
1165561828 19:36687014-36687036 CATAGTCCTCACAGGCACATTGG + Intergenic
1166008927 19:39926974-39926996 CAGGATCCCGAAAGCCACAGAGG + Intronic
1167499380 19:49836681-49836703 AAGGGCCCCCAAAGGCTCATGGG + Intronic
927430008 2:23019531-23019553 AAGGGTCTCCAAAGGCTCATGGG - Intergenic
932303313 2:70683795-70683817 CAGGGTACCCATGTGCACATGGG - Intronic
935674217 2:105580257-105580279 CTGGGTCCTCAGCGGCACATGGG - Intergenic
939299743 2:140320099-140320121 CAAGGTCTGCAAAGGCAGATTGG - Intronic
939588942 2:144039736-144039758 CAGGGACCAGAAAGGCACAAGGG + Intronic
941778537 2:169419140-169419162 CAGTCTCCCCTAAAGCACATTGG - Intergenic
946245107 2:218382965-218382987 AAGGGTCCCCAAAGGCTAAGCGG + Exonic
948550929 2:238772681-238772703 CAGGGTCCCCACAGGCACGGAGG + Intergenic
1170052707 20:12164246-12164268 AAGGGAACCCAAAGGCACTTTGG + Intergenic
1172326423 20:34039072-34039094 CTGTGTCTCCAAAGGCGCATTGG + Intronic
1175923629 20:62461626-62461648 CAGGGTCCCCATAGGTAGAGTGG - Intergenic
1176277359 20:64279913-64279935 CAGGGGCTCGAAAGGCACACAGG - Intronic
1179454433 21:41489103-41489125 AAGGATCCACAATGGCACATGGG + Intronic
1179881540 21:44295159-44295181 CAGGATCCCTAAAGGCTCCTCGG - Intronic
1180980461 22:19875887-19875909 CAGGGACCCCCAAGGGAGATGGG + Intronic
1182730369 22:32485174-32485196 CAGGTTTCCCAAAGGCACACAGG - Exonic
1183076984 22:35433512-35433534 CAAGGTCCCCAAAGGCAACCTGG - Intergenic
1185379839 22:50503291-50503313 CAGGGTCAGCTAAGGCACAGTGG + Exonic
950626466 3:14251120-14251142 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
950966412 3:17149788-17149810 CAGTGTCCCCAATGTCACTTTGG + Intergenic
952250628 3:31649691-31649713 CAGGGTCCCAGAAGGCAAAGAGG + Intergenic
956673388 3:71712566-71712588 CTGGATCCCCCAAAGCACATAGG + Intronic
956921224 3:73931608-73931630 CAGGGCTCCCAAAAGGACATGGG + Intergenic
961131951 3:124477069-124477091 CATGGTCCCCTAACGGACATTGG - Intronic
961412187 3:126730498-126730520 CAGGGTCCACGAAGTCACAGAGG - Intronic
961705344 3:128780781-128780803 CAGTGACCACATAGGCACATGGG - Intronic
965454146 3:168876575-168876597 AAAAGTCCCCAAATGCACATGGG + Intergenic
965734117 3:171802932-171802954 GAGGGGCCCAGAAGGCACATGGG + Intronic
968296424 3:197580454-197580476 CAAGGTCTCCAAAGACAAATGGG - Intergenic
968516859 4:1019115-1019137 AAGGGTCCCCAAAGGCATGCGGG - Intronic
968523520 4:1045209-1045231 CAGGGTCTCCACAGGCACCAGGG - Intergenic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
972302027 4:37793406-37793428 CAGTCTTCCCAAAGGCACAGAGG + Intergenic
973618306 4:52702799-52702821 AAGAGTCCCCAAAGGCTAATTGG - Intergenic
977696265 4:99970020-99970042 CAGGAGCCCCAAAAGCACCTGGG + Intergenic
978447022 4:108789468-108789490 CAGGGCACCCAAAGGAACAGAGG + Intergenic
981277693 4:142921118-142921140 CAGGGTACCCAACAGAACATTGG + Intergenic
985677447 5:1239349-1239371 GAGTGTCCCCAAAGCCACCTTGG + Intronic
986033820 5:3918543-3918565 AGGGGACCCCAAAGGCAAATGGG - Intergenic
987835589 5:23156790-23156812 AAGGGCCATCAAAGGCACATAGG - Intergenic
988982957 5:36589880-36589902 AAGTGTCCCCAAAAGCACCTAGG + Intergenic
991609993 5:68440155-68440177 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
992902448 5:81311479-81311501 CAGGGTCCCCTAAGGCTTACTGG - Intronic
993466239 5:88250287-88250309 CAGGGTCACCAAAGCCACTCAGG - Intronic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
1001940443 5:175736215-175736237 CAGGGCCCCCAAAGCCAGAGTGG + Intergenic
1004512112 6:16291544-16291566 CATGGTCTCCAAAGACACCTGGG + Intronic
1005026477 6:21467215-21467237 CAGGGACCCCGAAGCCACAGAGG - Intergenic
1005932332 6:30492830-30492852 CAGAGTCCCCTAAGACACATAGG - Exonic
1006791396 6:36703564-36703586 CATGGACCCCAAGGGCACAGGGG + Intronic
1007485831 6:42179846-42179868 CAGGGTCCCCCAGGGCAGAATGG - Exonic
1009192523 6:60646533-60646555 CAGGGACCCCACAGCCAGATGGG + Intergenic
1009349211 6:62653170-62653192 CAGGGACCCCAAAAGAACATGGG + Intergenic
1011900146 6:92284249-92284271 CACGGGCCCCAAAGGCAGCTGGG - Intergenic
1012994143 6:105957012-105957034 CAGGGTGCACAAGGGCACAGAGG + Intergenic
1015204325 6:130617841-130617863 CTGCGTCCTCAAAGGCACACAGG + Intergenic
1018093595 6:160366010-160366032 CAGGTTCCCCCATGACACATGGG + Intronic
1018201127 6:161396740-161396762 AAGGATACCCACAGGCACATGGG - Intronic
1018888056 6:167957971-167957993 CAGGGTCCCCAAACCCACCATGG + Intronic
1022480389 7:30739772-30739794 CAGGCTCCCACCAGGCACATGGG - Intronic
1022610687 7:31868579-31868601 CAGGGTCCCCAAAAGCAAAGAGG + Intronic
1023708930 7:42971119-42971141 AAGGGTTCCCAACGGAACATAGG - Intergenic
1023978975 7:45054854-45054876 CAGGGTTCCCCAGGGCAGATGGG + Intronic
1026363763 7:69627156-69627178 CCCTGTCCCCAAAGACACATGGG + Intronic
1035240299 7:157524546-157524568 CAGGAGCCCCACAGGGACATTGG - Intergenic
1035304906 7:157925655-157925677 CAGGGTCCCCAGCGGCTCCTGGG - Intronic
1035690384 8:1555928-1555950 CAGTGTTCCGAAAAGCACATTGG + Intronic
1035788070 8:2278233-2278255 CAGGGTCCCCAGCGGGACATGGG + Intergenic
1035804737 8:2443480-2443502 CAGGGTCCCCAGCGGGACATGGG - Intergenic
1037315643 8:17596301-17596323 CAGGCTGCTCACAGGCACATGGG + Intronic
1039300634 8:36205148-36205170 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1039414647 8:37383512-37383534 CCGTGGCTCCAAAGGCACATTGG + Intergenic
1045398535 8:101786272-101786294 CAGGGTCCATAAAGGCCCTTGGG + Intronic
1046520920 8:115324593-115324615 CAGTGTCACTAAAGGCAAATTGG + Intergenic
1047206890 8:122809653-122809675 TCGGGTCCCCTCAGGCACATTGG - Intronic
1048297339 8:133224106-133224128 CAGGATCCCCACCTGCACATGGG - Intronic
1049178067 8:141206206-141206228 CAGGGTCCCAGATGGCAAATGGG + Intergenic
1049463243 8:142739700-142739722 CAGCGTCCCCAGCGGCACAATGG - Intergenic
1049571576 8:143372466-143372488 GAGGGTTCCCAAGTGCACATCGG + Intronic
1052866525 9:33467621-33467643 CAGGGTCCCAAGAGACACAAAGG - Intronic
1055649711 9:78395384-78395406 CAGTCTCCCCAAAGGCTCAGAGG - Intergenic
1058191065 9:101916622-101916644 CAGGGTCCTCAAAGTTACTTTGG + Intergenic
1061219411 9:129241696-129241718 CAGCGTCACCAAAGGCAGAGGGG - Intergenic
1062360907 9:136187634-136187656 CAGGGTCCCCACATGCTCAGAGG + Intergenic
1185863820 X:3604640-3604662 CAGGGGCCCCAGAAGCACGTTGG + Exonic
1190825528 X:54014682-54014704 CAGAATCCCCAAAGGCACATAGG + Intronic
1191954056 X:66625073-66625095 AAGGGTCGCCAGAGGCACAGGGG + Intronic
1192298712 X:69878344-69878366 CAGGGGCCCCAGAAGCACGTTGG + Intronic
1192804710 X:74498534-74498556 CAGTCTCCCCAAAGGCTCAGAGG - Intronic
1194620039 X:96160159-96160181 CAGTCTCCCCAAAGGCTCAGAGG + Intergenic
1194670991 X:96732642-96732664 TAGAGTACCCGAAGGCACATAGG - Intronic
1195676491 X:107511087-107511109 CAAGTTCCCCAAAGGGGCATGGG + Intergenic
1199503632 X:148537181-148537203 GAGGGTCCCCAAAGGCAGCTGGG - Intronic
1199603967 X:149561754-149561776 CAGGGTCCCCAAAATGAAATGGG - Intergenic
1199646422 X:149917720-149917742 CAGGGTCCCCAAAATGAAATGGG + Intergenic
1200800336 Y:7381256-7381278 CAGGGGCCCCAGAAGCACGTTGG - Intergenic
1200909025 Y:8514689-8514711 CAAGGTACACAAAGGTACATAGG + Intergenic
1201793027 Y:17863088-17863110 TATGGTTCCCAAAGGCACAGGGG - Intergenic
1201808527 Y:18042898-18042920 TATGGTTCCCAAAGGCACAGGGG + Intergenic
1202107197 Y:21384067-21384089 CAAGGTACACAAAGGCACACAGG - Intronic
1202354560 Y:24032332-24032354 TATGGTTCCCAAAGGCACAGGGG - Intergenic
1202516218 Y:25637780-25637802 TATGGTTCCCAAAGGCACAGGGG + Intergenic