ID: 920183485

View in Genome Browser
Species Human (GRCh38)
Location 1:204146850-204146872
Sequence GGCAAGTGCCCTGGTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920183485_920183493 -6 Left 920183485 1:204146850-204146872 CCAGGCCCACCAGGGCACTTGCC 0: 1
1: 0
2: 2
3: 31
4: 244
Right 920183493 1:204146867-204146889 CTTGCCAGAGGGCCAAGGATGGG 0: 1
1: 0
2: 1
3: 15
4: 195
920183485_920183496 14 Left 920183485 1:204146850-204146872 CCAGGCCCACCAGGGCACTTGCC 0: 1
1: 0
2: 2
3: 31
4: 244
Right 920183496 1:204146887-204146909 GGGATGATTGCAAGTCCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 85
920183485_920183497 22 Left 920183485 1:204146850-204146872 CCAGGCCCACCAGGGCACTTGCC 0: 1
1: 0
2: 2
3: 31
4: 244
Right 920183497 1:204146895-204146917 TGCAAGTCCCTTAGGAGCACAGG 0: 1
1: 0
2: 0
3: 17
4: 121
920183485_920183492 -7 Left 920183485 1:204146850-204146872 CCAGGCCCACCAGGGCACTTGCC 0: 1
1: 0
2: 2
3: 31
4: 244
Right 920183492 1:204146866-204146888 ACTTGCCAGAGGGCCAAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920183485 Original CRISPR GGCAAGTGCCCTGGTGGGCC TGG (reversed) Intronic
900158461 1:1212674-1212696 GAGAAGTGCCCTGGAGGGCAGGG + Exonic
900300021 1:1972408-1972430 GGAACATGCCCTGGAGGGCCAGG + Intronic
901050904 1:6425430-6425452 GGCAGATGCCCTGGCGAGCCTGG + Intronic
901417970 1:9129759-9129781 GGCAAGAGCAGGGGTGGGCCTGG - Intergenic
901428974 1:9200915-9200937 GGCATCTGCCCAGGTGGTCCTGG - Intergenic
901788081 1:11637766-11637788 GGCCGGTGCCCTGTTGGGCAAGG - Intergenic
901810478 1:11764470-11764492 GGCAAGAGGCTTAGTGGGCCTGG + Exonic
902731693 1:18374031-18374053 GGCTAGAGCCCTGGAGGGCAGGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903658433 1:24962831-24962853 GGCTAGAGCCCCGGTCGGCCTGG - Intronic
903795893 1:25928685-25928707 GGCAAGTTCACTGCAGGGCCAGG - Intergenic
904296310 1:29521818-29521840 GCCAAGTCCCCTGATGAGCCTGG + Intergenic
904301168 1:29555895-29555917 CGCCAGTGTCCTCGTGGGCCTGG + Intergenic
904410016 1:30319627-30319649 GCCAAGTCCCCTGATGAGCCTGG - Intergenic
904852077 1:33466956-33466978 GGCAGATGCACTGGTGGGACGGG + Intergenic
904860834 1:33536604-33536626 GGCCTGTGTCCTGGTGGGCCAGG + Intronic
905536982 1:38729870-38729892 GAAAAGTGCCCTGGTGGGCTGGG + Intergenic
905645617 1:39623277-39623299 GGCAAGTGGCCAGGAGGCCCTGG - Intergenic
906211837 1:44016519-44016541 GGCAAGTGCCCGCATGGGCTGGG - Intronic
906636422 1:47413353-47413375 GCTAAGTGCCATTGTGGGCCTGG + Intergenic
907486441 1:54781338-54781360 GGCCCGGGCCCTGGTGGCCCAGG - Exonic
912388354 1:109284044-109284066 GACAAGTTCACTGGTGGCCCGGG - Intergenic
913340313 1:117752006-117752028 GACAAGTGCCCTCTTGGGCAGGG + Intergenic
914748038 1:150513617-150513639 CGCCAGTGCCCTCCTGGGCCAGG - Intronic
915908819 1:159899760-159899782 GGAAAAAGCACTGGTGGGCCGGG - Intronic
917068717 1:171125845-171125867 AGCAAGTCCCTTGGTGGGGCAGG - Intergenic
918132593 1:181642821-181642843 GGCAGATGCTCTGGGGGGCCAGG - Intronic
919928530 1:202206395-202206417 GGTAACTGCGCTGGGGGGCCGGG - Intronic
920183485 1:204146850-204146872 GGCAAGTGCCCTGGTGGGCCTGG - Intronic
921005105 1:211085529-211085551 GGCAAGAGACCATGTGGGCCTGG + Intronic
922176969 1:223204560-223204582 GGCAAGTGCCCATGTGGGCAAGG - Intergenic
922802959 1:228372392-228372414 GGCAGGGGCCCATGTGGGCCAGG + Exonic
922868772 1:228883384-228883406 GGCAAGTGCCATCGTGGGGCAGG - Intergenic
924797706 1:247304283-247304305 GGCCAGTAGCCTGCTGGGCCTGG + Intronic
1062938155 10:1403027-1403049 GGCAGGTGCGCTCGTGCGCCTGG + Intronic
1063365295 10:5486890-5486912 GGCAAGAGGCCAGATGGGCCTGG + Intergenic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1065683705 10:28263291-28263313 GGAATGTGACCTGATGGGCCTGG + Intronic
1066154629 10:32661631-32661653 GGCAAGTTCCCTTTTGGCCCAGG + Intronic
1068397923 10:56487951-56487973 GGGTAGGGCACTGGTGGGCCAGG + Intergenic
1073050587 10:100664588-100664610 GGCAAATGCCATGATGGGGCAGG + Intergenic
1073176390 10:101560027-101560049 GGCCAGAGCCAGGGTGGGCCTGG - Intergenic
1076540562 10:131211773-131211795 GGCAAGTGGCCCGGCAGGCCTGG - Intronic
1076587141 10:131556855-131556877 GGCAGATGCCCGGGTGAGCCAGG + Intergenic
1077474001 11:2777925-2777947 GCCAAGTGCTGGGGTGGGCCGGG - Intronic
1077610889 11:3642505-3642527 GGCCCCTGGCCTGGTGGGCCGGG - Intergenic
1077896342 11:6456401-6456423 GTCAAGTCCCCTGGCGGCCCCGG - Exonic
1083353682 11:62049182-62049204 GGGAAGTGATCTGGTGGGGCTGG - Intergenic
1083619522 11:64042039-64042061 GGCAGCGGCCATGGTGGGCCAGG + Intronic
1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG + Intergenic
1083654890 11:64224806-64224828 GGGAATGGCCCTGGTTGGCCCGG + Exonic
1083756283 11:64793402-64793424 GGCAACAGCCCTGTGGGGCCAGG + Intronic
1084423353 11:69071512-69071534 GGCCAGGCCCCTGGTGGGACGGG + Intronic
1084955624 11:72689762-72689784 GCCATGTGCCCAGGAGGGCCTGG + Intronic
1085511982 11:77093151-77093173 GGCAAGTGCCATGCGGGGCCTGG + Intronic
1089713535 11:120335798-120335820 GGCAGGTGCCCAGGTGAGCGGGG + Intergenic
1090187005 11:124745650-124745672 GGCCCGGGCCCTGGGGGGCCTGG + Exonic
1091123029 11:133072736-133072758 GACAGGTGTCCTGGTGGGCTTGG + Intronic
1093219215 12:16399089-16399111 GGCACGTGTCCTGGTGGGCCTGG + Intronic
1094719994 12:33053112-33053134 GGCAAGGGGCCAGGAGGGCCGGG - Intergenic
1095948352 12:47766659-47766681 GGCAGGTGGCCTGGGGGGTCAGG - Intronic
1096608211 12:52782684-52782706 GACCAGTGCCTTGGTGGCCCTGG - Intergenic
1096660016 12:53118464-53118486 GGTAAGTTTCCTGATGGGCCTGG - Intronic
1099113023 12:78586745-78586767 TGCATGTGCCCTGGTGGGTGGGG + Intergenic
1100664467 12:96736379-96736401 GGGAAGTGCTCTGATTGGCCCGG + Intronic
1101967248 12:109290171-109290193 GGCAAGTGGCCGCGTGGACCTGG - Exonic
1102193712 12:111009005-111009027 GGCAAGTGACTTGGTGGGGAGGG - Intergenic
1103606185 12:122087640-122087662 GGCAAGGGGCCTTGTGGGCCAGG + Intronic
1103882911 12:124180170-124180192 GGCTACTGCCCCAGTGGGCCTGG + Intronic
1104640464 12:130463664-130463686 GTCAAGTGACCCGGTGAGCCTGG - Intronic
1106017682 13:25884803-25884825 GGCAAGTGCCTGAGTGGGGCAGG - Intronic
1106413135 13:29524803-29524825 GGCCAGTGCCCAGCTGTGCCCGG - Intronic
1114298518 14:21352487-21352509 GGCACGTGTCCTGGTGGGCCTGG + Exonic
1117512858 14:56471076-56471098 GGCAATTGCAGTGGTGGGCTGGG + Intergenic
1118928152 14:70212959-70212981 GTTAAGTTCCCTGGAGGGCCAGG + Intergenic
1121235844 14:92390742-92390764 GGAATGTTCCCTGGTAGGCCTGG - Intronic
1121441042 14:93949613-93949635 GGCAGGTGCCCTGGAGAGCCTGG + Intronic
1122419174 14:101564479-101564501 GGCAACTTCCCTGGCGCGCCAGG + Intergenic
1122553154 14:102560976-102560998 GACACTGGCCCTGGTGGGCCTGG - Intergenic
1122811896 14:104293352-104293374 GGCCAGGGGCCTGGAGGGCCAGG + Intergenic
1122866817 14:104609717-104609739 GGCAAGAGCCCTGGGAGGCAGGG - Intergenic
1122937849 14:104968138-104968160 GGCCAGGGCGCTGGGGGGCCCGG - Intronic
1122938471 14:104970634-104970656 GGCGGGTCCCCTGATGGGCCAGG + Intronic
1123002228 14:105301521-105301543 GGCAGCTGCGCTGGGGGGCCTGG + Exonic
1123033924 14:105464147-105464169 AGTAAGTGCCCTGGATGGCCGGG + Exonic
1123037078 14:105475878-105475900 GGCAGGCGCCCTGTTGGTCCCGG - Intronic
1123057741 14:105579950-105579972 GGCAAAGGTCCTGGAGGGCCTGG - Intergenic
1123876365 15:24627698-24627720 GCCAAGTGCCAACGTGGGCCTGG - Intergenic
1124208482 15:27743191-27743213 GGCAGCTGCCCTGGGTGGCCGGG - Intergenic
1124344517 15:28913367-28913389 GGCAGGTGCAGTGGTGGGCACGG - Intronic
1127359518 15:58232548-58232570 AGCAGCTGCCATGGTGGGCCTGG + Intronic
1128185827 15:65642684-65642706 TCGAAGTGGCCTGGTGGGCCTGG - Intronic
1128358330 15:66943638-66943660 GGCAGGGGGCCTGGTGGGGCTGG + Intergenic
1129739481 15:77983320-77983342 GGCAAGTGCCCTGTGGTGGCTGG + Intergenic
1129758329 15:78112002-78112024 GGCTGCTACCCTGGTGGGCCTGG + Intronic
1129846424 15:78769729-78769751 GGCAAGTGCCCTGTGGTGGCTGG - Intronic
1130255494 15:82324200-82324222 GGCAAGTGCCCTGTGGTGGCTGG + Intergenic
1130599473 15:85265786-85265808 GGCAAGTGCCCTGTGGTGGCTGG - Intergenic
1131336453 15:91553749-91553771 GGCAGGTGCCCTGTGGGGACAGG + Intergenic
1132461829 16:59227-59249 GGCAAGTGACACTGTGGGCCGGG - Exonic
1132997938 16:2833051-2833073 GGCAAGTGCCCATGTGGGCTTGG - Intronic
1135540333 16:23324941-23324963 GGCATGGGGCCTGGTGGGCAGGG + Intronic
1136010934 16:27363116-27363138 GGCCAGTGCGGTGGTGGGCTTGG + Exonic
1136024639 16:27461729-27461751 GGCAAAGGCCCTGGTGGGAGAGG + Intronic
1139332923 16:66207751-66207773 GGCAAGTGGTCTCTTGGGCCAGG + Intergenic
1140588052 16:76318054-76318076 GGAAAGTCCCCTGATGGGTCAGG - Intronic
1141812210 16:86383189-86383211 GGCACGTGCCCTCGCGAGCCAGG - Intergenic
1142178702 16:88656824-88656846 CGCAGGAGCCCAGGTGGGCCAGG + Intronic
1142411561 16:89919564-89919586 GGCCGGTGCACTGGTGGCCCGGG + Exonic
1142411626 16:89919945-89919967 GGCCAAAGCCCTGGTGGACCGGG - Exonic
1142491213 17:281006-281028 GGGAAGTGCCCTGGGGAGGCAGG - Intronic
1142686197 17:1578212-1578234 CGCAGGTGGCCTGGTGGGCGAGG - Intronic
1142953381 17:3503063-3503085 GGGGAGGGCCCTGGTGGGGCTGG - Exonic
1143112147 17:4558818-4558840 GGCAAGGGCTCTGGTGGCTCGGG - Exonic
1147605028 17:41769602-41769624 GCCATGTGCCCTGGTGTGTCAGG - Exonic
1148862947 17:50614054-50614076 GGAGAGTGGCCAGGTGGGCCAGG + Intronic
1149567843 17:57652328-57652350 TACAAGTGCCCTGGGTGGCCAGG - Intronic
1150700511 17:67443136-67443158 GGCAGGCGCCCTGGTGGGTTAGG - Intronic
1151569907 17:74921025-74921047 GCCCAGAGCGCTGGTGGGCCAGG + Intronic
1151678235 17:75610731-75610753 GGTGAGGGCCCTGGAGGGCCAGG + Intergenic
1152108870 17:78346062-78346084 GTCCAGTGCCTTGGTGGGGCTGG + Intergenic
1152223292 17:79081102-79081124 GGCAGGTGCCGTGGTGGGGGCGG + Intronic
1153781676 18:8500364-8500386 GGCATGTCCCCTGGTGAGTCTGG - Intergenic
1154338676 18:13485576-13485598 GAGATGTGCCCTGCTGGGCCCGG + Intronic
1160066780 18:75583094-75583116 CGGCACTGCCCTGGTGGGCCTGG - Intergenic
1161061360 19:2216765-2216787 GGTGAGTGCCCTGGTGGGGCTGG + Exonic
1161235710 19:3197020-3197042 GGAAAGTGTCCTGGAGGCCCCGG + Intronic
1161717088 19:5882278-5882300 GGCCAGCTCCTTGGTGGGCCGGG - Intronic
1162019787 19:7863137-7863159 GGCCAGTGCCATGCTGGGCCTGG - Intronic
1162476764 19:10905119-10905141 GCCCAGAGCCCTGGTGGGCAGGG + Intronic
1162696361 19:12479350-12479372 AGCAAGTGCCCTGGCTGGACTGG + Intronic
1163577636 19:18119994-18120016 GGCAACTGCTCTGGTGGGGCGGG + Intronic
1163655644 19:18543464-18543486 GGCAAGTGTCCTGGGGTGCTGGG - Exonic
1164637616 19:29802840-29802862 GAGAAGTGCCCTGGTGTGCATGG - Intergenic
1164775853 19:30853072-30853094 GACCAGTGCCCTGGTAGGCATGG - Intergenic
1166294169 19:41880908-41880930 GGTAGGTGCCCTGGAGGCCCCGG - Exonic
1166811342 19:45516317-45516339 CGCTAGTGCCCTGGGGAGCCAGG + Intronic
1166996457 19:46721894-46721916 GGCAAGTGCTCAGGGGGCCCCGG - Intronic
925355124 2:3235505-3235527 GGCAAGTGCTCAAGTGGGCCAGG + Intronic
925911906 2:8579192-8579214 GCCCAGGGGCCTGGTGGGCCAGG - Intergenic
926207768 2:10846116-10846138 GGAAAGTGTCCTGGAGGGCCAGG + Intergenic
926616380 2:15000834-15000856 GCCAAGTGCCCAGGTGTGTCTGG - Intergenic
928091051 2:28375374-28375396 TCCAAGGGCCCTGGTGGGCTGGG - Intergenic
929044508 2:37776803-37776825 GGGAGGTGCCCTGGGGGTCCAGG + Intergenic
929549434 2:42880123-42880145 GGCAGGTCCCCAGGTGGGGCAGG + Intergenic
934521464 2:95022682-95022704 GGCACCTGCCCTGGTGGACAGGG - Intergenic
934706639 2:96485918-96485940 GGCAGGTGACATGGTGGACCCGG + Intergenic
934852937 2:97712855-97712877 GGAAAGGTCCCAGGTGGGCCGGG + Intergenic
934978774 2:98823374-98823396 GGCAAGGGCGCCGGTGGCCCAGG + Exonic
936013741 2:108942480-108942502 GGCAAGTTCCCGGGGAGGCCAGG + Intronic
937354847 2:121191870-121191892 TGCAAGTGCCCTGCTTGGTCTGG + Intergenic
937890245 2:126933240-126933262 GGCCCCTTCCCTGGTGGGCCGGG + Intergenic
937907677 2:127060322-127060344 GCTAAGTGCGCTGGTGGCCCGGG + Intronic
938288292 2:130136393-130136415 GGCGAGTGTCCAGGAGGGCCAGG + Intergenic
938427291 2:131202503-131202525 GGCGAGTGTCCAGGAGGGCCAGG - Intronic
938468236 2:131536551-131536573 GGCGAGTGTCCAGGAGGGCCAGG - Intergenic
940918787 2:159286146-159286168 GCCAACTGACCTGGTGTGCCCGG - Intronic
942494095 2:176520836-176520858 GACACCTGCCCTGGTGGGGCTGG + Intergenic
943375269 2:187068654-187068676 GGAAAGTCCCCTGGTGTGACTGG + Intergenic
947139366 2:227007474-227007496 GGCAAGTTCCCTGCCGGCCCTGG + Exonic
947869713 2:233427895-233427917 GCCACCTGCCCTGGTGGGCAGGG + Intronic
948588174 2:239034357-239034379 GGCGGGTGCCCAGGTGTGCCAGG + Intergenic
948726835 2:239939297-239939319 AGCAGGTGCCCTGCTGGGGCTGG - Intronic
948793818 2:240392189-240392211 AGCGCGTGCCCTGATGGGCCTGG - Intergenic
948798961 2:240421539-240421561 GGCATGGGCCCTGGGGAGCCAGG - Intergenic
948847229 2:240688853-240688875 TGCAGGTGACCTGCTGGGCCTGG - Intergenic
1170571830 20:17637019-17637041 AGCCAGTGCCCTGGAGAGCCAGG - Intronic
1172148740 20:32775817-32775839 GGCACGTGCCCTGGATTGCCTGG + Intronic
1172186706 20:33035508-33035530 CCCAAGAGCCCTGGTGGGACAGG - Intronic
1172353219 20:34260238-34260260 GGCAAGTGTCCTGGTGGAGCTGG - Intronic
1174507066 20:51023563-51023585 TGCAAGTGCTCCGGTGGTCCCGG + Intergenic
1174582474 20:51581764-51581786 GTGCAGTGCCCTGGTTGGCCAGG - Intergenic
1175150257 20:56928242-56928264 GGCCTGTGCCCTGGTGGGGATGG + Intergenic
1175515583 20:59567769-59567791 GCCAGGTGCCCTGCTGGGCTCGG + Intergenic
1179400216 21:41076337-41076359 GGCAAGTGCAGCGGTGAGCCCGG + Intergenic
1181153764 22:20904057-20904079 GGCATGTGCCCTGATGGGATGGG + Intergenic
1181163866 22:20973386-20973408 TGCCATTGCCCTGGTAGGCCCGG - Exonic
1181262370 22:21607592-21607614 GGCAAGTGCCATGGCAGACCTGG + Intronic
1181807928 22:25386214-25386236 GGCCAGTTCCCTTGTGGGGCTGG - Intronic
1183423773 22:37726491-37726513 GGCAAGAGCGCAGGTGAGCCCGG + Exonic
1183491733 22:38120535-38120557 GGGGCGTGGCCTGGTGGGCCTGG - Intronic
1183541435 22:38431419-38431441 GGCCAGTGGGCTGGTGGGCCTGG - Intronic
1183590450 22:38776617-38776639 AGCAAGGGCCCTGGAAGGCCAGG + Intronic
1184110199 22:42389731-42389753 GGCAAAGGGCCTGGGGGGCCTGG - Intronic
1184240754 22:43210282-43210304 GGCAGGGGCCCTGGCCGGCCAGG + Intronic
1184252523 22:43268857-43268879 GGAATATGCCCTGGAGGGCCAGG + Intronic
1184380228 22:44140735-44140757 GGTGAGTGCCCTGCTTGGCCGGG + Intronic
1185277669 22:49956820-49956842 GGCCTGTACCCTGGTGGCCCAGG + Intergenic
949400761 3:3663426-3663448 GGGAAGTGCCCTGGTGGTGGTGG - Intergenic
950124739 3:10504514-10504536 GGCAAGGGCCCTGGGGGTCTCGG - Intronic
950981824 3:17315376-17315398 GGCAAATGCCCTTTTGGGCCTGG - Intronic
952888922 3:38028641-38028663 GGCAAGTGACCTGGGAGGGCAGG + Intronic
953421557 3:42757249-42757271 GGCAAAGGCCCTGGTGGGCAGGG + Intronic
954362435 3:50129159-50129181 GGAGAGTGCCCACGTGGGCCGGG - Intergenic
961043546 3:123693769-123693791 GGAAAGAGGCCTGCTGGGCCAGG + Intronic
961556006 3:127697094-127697116 GGCATGAGTCCTGCTGGGCCGGG + Intronic
964380934 3:156098591-156098613 GGCAAAAGCCCTGGTGGCCCAGG - Intronic
966246109 3:177809237-177809259 CGCAAGTGCCCTGGGCAGCCTGG + Intergenic
966794044 3:183697683-183697705 AGGAAGTGCCCTCGCGGGCCGGG + Intergenic
968289464 3:197527447-197527469 GCCCAGTGCCCTGGTGGGCTGGG - Intronic
968473723 4:793282-793304 GGCAGGGGCCCTGCTGGGGCAGG + Intronic
968641884 4:1718934-1718956 GGCAGCTGCCCTGGCAGGCCAGG - Intronic
968890837 4:3367629-3367651 AGCAAGTGCCCTGGGGAGACGGG - Intronic
969969690 4:11032844-11032866 TGCAAGAGTCCTGGTGGACCTGG - Intergenic
972347357 4:38203788-38203810 GGCATGTGCCCAGGTCTGCCTGG + Intergenic
977849977 4:101815295-101815317 GGCAAATACCCTGGAGGGGCAGG - Intronic
978541470 4:109820719-109820741 AGCCAGTGCATTGGTGGGCCCGG + Intronic
982351768 4:154423198-154423220 GGCCAGTGGACTGGAGGGCCAGG - Intronic
984695012 4:182770465-182770487 GGCAGGGGCCCGGGTGGGGCTGG - Intronic
987160765 5:15139919-15139941 AGACAGTGCCCTGATGGGCCAGG - Intergenic
988610033 5:32714382-32714404 CAGCAGTGCCCTGGTGGGCCTGG + Intronic
990560283 5:56977202-56977224 GCCAAGTGCTCTGGTTTGCCTGG - Intergenic
1001587680 5:172844555-172844577 GGGAGGTGGCCTGGTGGGCATGG + Intronic
1002012139 5:176291766-176291788 GTAAAGTGCCCTGCTGGGCGCGG - Intronic
1002189631 5:177471997-177472019 GGCAAGTGGCCGGCTTGGCCTGG - Intronic
1002469791 5:179428548-179428570 GGACAGGGCCCTGGTGGGCCAGG - Intergenic
1002644800 5:180647896-180647918 GGCCAGTGTCCTGGTGCTCCCGG - Intronic
1002715131 5:181222537-181222559 GGCAAGCGCCCTTGTAGGACAGG + Intronic
1003092016 6:3112277-3112299 GGAAAGTGAACTGTTGGGCCGGG + Intronic
1005375011 6:25173097-25173119 GGCAAGTGGGCTGGAGGGCAGGG - Intergenic
1005968024 6:30741459-30741481 GGCAAGTGCCTTGGGGTGCCTGG + Intronic
1010032178 6:71282498-71282520 GACAAGTGCCCTTCTGAGCCAGG + Intergenic
1015834061 6:137400287-137400309 GGCCATTTCCCAGGTGGGCCTGG - Intergenic
1017588893 6:155957120-155957142 GGCAAGTGGGCTGGTTGCCCTGG + Intergenic
1017716760 6:157218431-157218453 GGCAAGGTCGCTGGTGGGGCAGG - Intergenic
1019205983 6:170362332-170362354 AGCTGGTGCCCTTGTGGGCCTGG + Intronic
1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG + Intergenic
1019484981 7:1285225-1285247 GGCAGGAGGCCTGGTGGGCTGGG + Intergenic
1020020180 7:4861820-4861842 GGGACGTGCCCTGGCGGGGCGGG - Exonic
1024084009 7:45878664-45878686 GGCAAATGGCTTTGTGGGCCAGG - Intergenic
1024534422 7:50418342-50418364 GGCAAGTTCCCTGCTGGCCCTGG - Intergenic
1026883051 7:73919736-73919758 GGCAGGTGCCCTCTTGTGCCAGG - Intergenic
1026883219 7:73920517-73920539 GGAAATTGTCCTGCTGGGCCTGG + Intergenic
1027267791 7:76503718-76503740 GGCCAGAGCCATGGAGGGCCGGG + Intronic
1032196760 7:129793922-129793944 GGGAAGGGCCATGGTGGCCCTGG - Intergenic
1032546714 7:132749957-132749979 TGCAAGTGACCTGGTGGTCCCGG - Intergenic
1033132370 7:138755595-138755617 AGCAAGGGCCCTGGGGGGCAGGG + Intronic
1033550208 7:142439871-142439893 GGCAAGTCCCCTGGGGCGCAGGG + Intergenic
1035117355 7:156535882-156535904 GGGAAGTGCACTGATGGGGCTGG - Intergenic
1035402059 7:158572431-158572453 GCTCAGTGCCCTGGTGGGTCAGG - Intronic
1037572832 8:20173051-20173073 GGGAACTGCTCTGGGGGGCCTGG - Exonic
1039455311 8:37702050-37702072 GGGAAGTTCACTGTTGGGCCTGG + Intergenic
1040482223 8:47836440-47836462 GGAGAGTGCCCTGGGAGGCCTGG + Exonic
1041529612 8:58850312-58850334 GGGAAGTACCCAGGTTGGCCAGG + Intronic
1046740993 8:117828891-117828913 GATAAATGCCCTGGTGTGCCTGG + Intronic
1047731348 8:127731452-127731474 GGCAGGTCTCCTGGAGGGCCGGG - Intergenic
1048579950 8:135722599-135722621 GGCAAAGGCCCTGGAGGGCAGGG + Intergenic
1048811087 8:138286905-138286927 GGGAAGTAAACTGGTGGGCCTGG - Intronic
1048987232 8:139741111-139741133 GGGGAGTGCCCTGCTGGGGCAGG - Intronic
1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG + Intronic
1049382359 8:142323653-142323675 GCCAAGTGCCCTGCTGGTCCTGG - Intronic
1049593023 8:143471234-143471256 CGGACGTGCCCTGGAGGGCCTGG - Intronic
1049604256 8:143521711-143521733 GGCAGGTGCACTGGTGGGGGAGG - Intronic
1049661622 8:143822104-143822126 GGCAGGTGCCCTGGAGGCCCTGG + Intronic
1049761297 8:144333022-144333044 GGCAAGGCCCCTGGCGGGCGGGG + Exonic
1050416891 9:5427805-5427827 GACAAGGGCCCTGGTTGGCTGGG + Intronic
1051195858 9:14562260-14562282 GGCCCCTGCCCAGGTGGGCCCGG + Intergenic
1055993268 9:82130785-82130807 GGCAGGTGCCCTGGGGGCCCTGG + Intergenic
1056494991 9:87147903-87147925 GGCAATGGACCTGGTGTGCCTGG - Intergenic
1057552762 9:96064103-96064125 AGCAAGAGCACTAGTGGGCCTGG + Intergenic
1057638738 9:96796610-96796632 GGCAAGTACCCTGGAGTGGCAGG - Intergenic
1058899643 9:109431003-109431025 GGCAAGTGCCCAGGAGGGGCAGG - Intronic
1059145470 9:111896345-111896367 GGAACGTGGCCTGGAGGGCCTGG + Intergenic
1061940210 9:133879910-133879932 GGGAAGTCCCTTGATGGGCCAGG - Intronic
1062285600 9:135771243-135771265 GGCAGGTGACCAGGTGGGACGGG + Intronic
1062322343 9:135996570-135996592 GCCGAGTGGCCTGGTGGGTCCGG + Intergenic
1062481458 9:136754413-136754435 TGCAGGTGACCTGGTGGGCAGGG + Exonic
1062688589 9:137828918-137828940 GGGAAGAGCCCAGATGGGCCTGG + Intronic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1187045910 X:15647244-15647266 GGGAAGTGCCCCGGTGGGGCCGG - Intronic
1187051888 X:15703545-15703567 GGGAAGTGCCCCGGTGGGGCCGG - Intronic
1189382688 X:40513043-40513065 CCCAAGGGCCGTGGTGGGCCAGG + Intergenic
1189755215 X:44264411-44264433 GGCAAGTCAGCTGGTGGGGCAGG - Intronic
1190735052 X:53250588-53250610 GGCAGGGGCCCTGGTGGGGCTGG + Exonic
1192612913 X:72585777-72585799 GGCATGGGACCTGGTGAGCCAGG - Intronic
1196904824 X:120420743-120420765 GGCAAGAGCCTTGGTGGGGGTGG - Intergenic
1198384901 X:136119417-136119439 GTCAAGTACCCTAGTTGGCCCGG - Intergenic
1199736773 X:150693264-150693286 GGCGAGCGCCCAGGTGGGGCTGG + Intronic