ID: 920185350

View in Genome Browser
Species Human (GRCh38)
Location 1:204156019-204156041
Sequence GGGACAGTGCCCCGCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920185341_920185350 16 Left 920185341 1:204155980-204156002 CCTGCGCTGGTGGCCTGGTCTCT 0: 1
1: 0
2: 0
3: 21
4: 185
Right 920185350 1:204156019-204156041 GGGACAGTGCCCCGCCCCATGGG 0: 1
1: 0
2: 0
3: 8
4: 113
920185344_920185350 3 Left 920185344 1:204155993-204156015 CCTGGTCTCTCTGCTGGAGAGGG 0: 1
1: 0
2: 4
3: 16
4: 296
Right 920185350 1:204156019-204156041 GGGACAGTGCCCCGCCCCATGGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920185350 Original CRISPR GGGACAGTGCCCCGCCCCAT GGG Intronic