ID: 920185621

View in Genome Browser
Species Human (GRCh38)
Location 1:204157355-204157377
Sequence CTCTGCAGAGATTCCGAGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920185621_920185622 -3 Left 920185621 1:204157355-204157377 CCTTACTCGGAATCTCTGCAGAG 0: 1
1: 0
2: 2
3: 5
4: 98
Right 920185622 1:204157375-204157397 GAGAAAGAGAGACAGCAGAAAGG 0: 1
1: 0
2: 41
3: 418
4: 3100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920185621 Original CRISPR CTCTGCAGAGATTCCGAGTA AGG (reversed) Exonic
901211895 1:7531458-7531480 CTCTGCAGGTTTTTCGAGTAAGG - Intronic
903364648 1:22798526-22798548 CACTGCAGAGATTCAGAACATGG - Intronic
905452512 1:38065820-38065842 GTCTGCAGAGTTTCCAAGTGAGG - Intergenic
906800430 1:48732500-48732522 CTATGCAGAGACTTGGAGTAGGG + Intronic
907668203 1:56451534-56451556 CTCTGCATACAGTCGGAGTATGG - Intergenic
907687630 1:56628875-56628897 CTCTGAAGGTATTCCCAGTAAGG - Intronic
907885156 1:58586112-58586134 CTCTCAAGAGAATCCAAGTAAGG + Intergenic
909288484 1:73852161-73852183 CTCTGGAGGGATTCAGAGAATGG - Intergenic
913090634 1:115474460-115474482 CTCTGCAGAAATTCCAAGTAAGG + Intergenic
915063668 1:153207237-153207259 CTCTGCAGGGATCTAGAGTATGG - Intergenic
915914137 1:159931149-159931171 ATCTGCAGAGATTCAGTGTCTGG - Exonic
919141428 1:193577105-193577127 CTGGGCAGATATTCCGAGTGAGG + Intergenic
920185621 1:204157355-204157377 CTCTGCAGAGATTCCGAGTAAGG - Exonic
922005614 1:221527814-221527836 ATATGCAGAGATTCAGATTAGGG + Intergenic
924165592 1:241278775-241278797 GTGTGCAGAGATGCCGAGTCAGG - Intronic
1063619945 10:7637429-7637451 TTCTGCAGTGATTCCCAGCAAGG - Exonic
1063982796 10:11469591-11469613 CTCTGCAGAGATTTTCAATAAGG + Intronic
1064414112 10:15134231-15134253 CTCTGCAGAGCTTCCCAACATGG + Intronic
1071264556 10:83953399-83953421 CCCTGCAGAGATTCTGATTTAGG - Intergenic
1073302601 10:102480206-102480228 CTCTGCAGCCATTCAGAGTGAGG + Exonic
1074687837 10:115976291-115976313 CCCAGCAGAGATTCCTTGTAAGG + Intergenic
1076476660 10:130758383-130758405 CCCTGCAGGGCTTCCGAGGATGG + Intergenic
1078923086 11:15849502-15849524 GTCAGCTGAGAGTCCGAGTATGG + Intergenic
1081863162 11:46345695-46345717 CTCTGCAGAGGCACAGAGTAGGG + Intronic
1088994832 11:114987256-114987278 CTCTGCAGATATTTCTTGTACGG + Intergenic
1095357385 12:41291895-41291917 CTGTGCTGAGACTCCTAGTAAGG - Intronic
1095417211 12:41990037-41990059 CTCAGCAGAGTTATCGAGTAAGG + Intergenic
1097312439 12:58134997-58135019 CTTTGGAGAAATTCCAAGTATGG - Intergenic
1097371382 12:58785648-58785670 CTCTGCAGAGATTCCTTATTGGG + Intronic
1099883814 12:88502105-88502127 CTTTGCAGAGATGACGAGTAAGG + Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103289984 12:119837639-119837661 CTCTTCAGAGATGCCCAGTAAGG + Intronic
1105436039 13:20379063-20379085 CTCTGCAGAGACTCAGAGGCAGG - Intergenic
1110540600 13:76702651-76702673 ATATGCAGAGATTCGTAGTAGGG + Intergenic
1118849604 14:69573636-69573658 ATCTGCAGAGATTCCAACAAAGG - Exonic
1120405374 14:84088328-84088350 CTCTGAAGAGATTCAGAATCAGG + Intergenic
1121060834 14:90908205-90908227 CTCTGCTGAGATGCCAAGTCTGG + Intronic
1122155450 14:99747711-99747733 CTCTGCAGGGGCTCGGAGTAAGG + Intronic
1125836138 15:42753426-42753448 TTCTGCACAGTTTCTGAGTAGGG - Intronic
1136243401 16:28958711-28958733 CTCTGCAGGGGCTCCGACTAGGG - Exonic
1137620017 16:49869883-49869905 CCCTGCAGAGATGCTGAGCAGGG + Intergenic
1144574338 17:16419493-16419515 CCCTGCTGAGATTCCCAGTTTGG + Intronic
1145827920 17:27891141-27891163 CTCTACAGAGGTTCTGAGGAAGG - Intronic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1148138549 17:45311715-45311737 CTCTGCAGAGACTCCAACTCAGG + Intronic
1151475012 17:74340356-74340378 CTATGCAGAGATGCAGAGGAAGG - Intronic
1157570307 18:48707918-48707940 CTCTGCAGATATGCCTATTATGG + Intronic
1157681566 18:49611642-49611664 GTCTGCAGAAGTTCCGAGTCAGG + Intergenic
1160547897 18:79673228-79673250 CTCTGCAGAGATGCTTAGCAAGG + Intergenic
1160839961 19:1141979-1142001 CACTTCACAGACTCCGAGTAGGG - Intronic
1163761920 19:19141981-19142003 CTCTGCAGAGTGTCCAAGTGCGG - Intergenic
1168697904 19:58415861-58415883 CTCTGCACAGATACAGAGAAGGG - Intronic
925904897 2:8534595-8534617 CTCTGCAGAGTTCAGGAGTAAGG + Intergenic
929521402 2:42655107-42655129 CTCTGCAGAGATACCTGATAAGG - Intronic
931778866 2:65563102-65563124 CTCTGCAGAGCATCCCAGTCTGG - Intergenic
934317745 2:91940832-91940854 CTCAGCAGATATTCCGAGCTTGG + Intergenic
934724730 2:96608652-96608674 CACTGGAGAGATCCTGAGTAAGG + Exonic
937259419 2:120576144-120576166 CTCTGCAGAGACACAGAGAAGGG + Intergenic
938079833 2:128364027-128364049 CTCTGCAGAGACTTCGTGGAGGG - Intergenic
938108399 2:128548684-128548706 CTCAGGAGAGATTCCGGGCACGG + Intergenic
938394298 2:130931070-130931092 CTCTGCAGAGATGCAGAGGAGGG - Exonic
938994639 2:136665119-136665141 CTCTGCAGGGAATCTGAGAACGG + Intergenic
947830738 2:233139861-233139883 CTCTGCAGAGACTCCAGGGATGG - Exonic
1169877307 20:10312128-10312150 CTCTTCAGAGAGTCCTACTAAGG + Intergenic
1170109404 20:12788749-12788771 ATCTGCAGAGCTTCAGAATAAGG + Intergenic
1170486069 20:16817329-16817351 CTGTGCAGAGCTGCCCAGTAGGG + Intergenic
1174483497 20:50847085-50847107 CTCAGGAGGGATTCCGAGCATGG + Intronic
1175135431 20:56819905-56819927 CTCTGCAAAGATTCCCAGATAGG - Intergenic
1179026218 21:37681024-37681046 CTCTGCAGAGGTTCCCATCAAGG + Intronic
1181068838 22:20320196-20320218 CTCTGCGGAGACTCCAAGGAGGG + Intergenic
1181403512 22:22666095-22666117 CTCTGCAGGGATTCCAAGACAGG + Intergenic
1181408518 22:22702076-22702098 CTCTGCAGAGATTCCAAGAAAGG + Intergenic
1181413841 22:22745575-22745597 CTCTGCAGGGATTCCAAGAAAGG + Intronic
959710388 3:109380057-109380079 CTCTTCAGAGAATCAGAGTCAGG + Intergenic
962479104 3:135783016-135783038 CTCTGCAGGGTTTCTGAGGATGG + Intergenic
965714669 3:171589842-171589864 CTCTCCAGAGATTTCTAGTTAGG - Intergenic
974183272 4:58410614-58410636 CTCTGCAGAGATTCTGATTTTGG - Intergenic
975163357 4:71148891-71148913 CTCTGCATATATACCTAGTAAGG + Intergenic
982465477 4:155724783-155724805 CTCTGCAGAGAATCACAGGATGG - Intronic
983381482 4:167000285-167000307 CTCTGCAGTTATTCCTGGTAAGG + Intronic
986029710 5:3882763-3882785 CTCTGCAGAGATACTGGGTCAGG + Intergenic
988480836 5:31629135-31629157 CTCTGATGAGTTTCCGAGGATGG + Intergenic
988814566 5:34821295-34821317 GTTTGCAGAGTTTCCAAGTAAGG + Intronic
996509453 5:124302598-124302620 CTCTCCAGGGATTCTGGGTAAGG - Intergenic
997657321 5:135564949-135564971 CTCTCAAAAGAGTCCGAGTATGG - Intergenic
1001080914 5:168666675-168666697 CTCTGCAGAGAATCCGTGCCTGG - Exonic
1002489337 5:179563202-179563224 CTCTGCAGAGTTTCCCAGACGGG + Intronic
1007810310 6:44480908-44480930 GTGGGAAGAGATTCCGAGTAGGG + Intergenic
1017834168 6:158161812-158161834 CTCTGAGGAGATTTAGAGTAAGG - Intronic
1018927236 6:168214936-168214958 TGCTGCAGAGATGCTGAGTACGG - Intergenic
1019140344 6:169938600-169938622 CCCTGCAGTGCTTCCGAGAAGGG - Intergenic
1024696191 7:51858962-51858984 ATCTGCAGAGCTTCCAAATAAGG - Intergenic
1031010799 7:116524628-116524650 GCCTGCAGAGATGCCCAGTATGG - Intergenic
1032682907 7:134203756-134203778 CAGTGCAGAGATTCTGAGCAGGG - Intronic
1033606585 7:142932258-142932280 CTCTGCAGAGGGTCCAAGTTGGG + Intronic
1035953541 8:4051178-4051200 CTCAGCAGAGATTCTCAGCAGGG - Intronic
1036468378 8:9025126-9025148 CTGAGCAGAGATTCAGAGAAAGG + Intronic
1037335237 8:17785438-17785460 CTCTGCAGAGTTTTGGAGTGTGG - Intronic
1041527206 8:58820517-58820539 CTCTGAAGAGAATTCCAGTAGGG - Intronic
1045094614 8:98784811-98784833 CTGTGCAGAGATTCTGTGCAGGG + Intronic
1060372159 9:123084510-123084532 CTCAGCAGAGATTCTGATTTTGG + Intronic
1062678736 9:137764378-137764400 CTCTGCAGAGGGGCCGAGTGTGG - Intronic
1190216261 X:48481418-48481440 CCCTGCAGATATTCCGAGGCCGG + Exonic
1193774263 X:85623021-85623043 CTCTTCAGAGTTGCCAAGTAGGG - Intergenic
1198050900 X:132952770-132952792 CTTTGCAGGGATTCCCAATATGG + Intronic
1199673302 X:150164362-150164384 CTCTGCAAAGATCCCCAGTTAGG + Intergenic