ID: 920187811

View in Genome Browser
Species Human (GRCh38)
Location 1:204172566-204172588
Sequence CCCCAGCTCCCTGCTTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920187811_920187825 28 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187825 1:204172617-204172639 CCTAGTAAGGGTGGGAGAGAAGG No data
920187811_920187826 29 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187826 1:204172618-204172640 CTAGTAAGGGTGGGAGAGAAGGG No data
920187811_920187820 16 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187820 1:204172605-204172627 ATCCTCTGTTGACCTAGTAAGGG No data
920187811_920187819 15 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187819 1:204172604-204172626 TATCCTCTGTTGACCTAGTAAGG No data
920187811_920187823 20 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187823 1:204172609-204172631 TCTGTTGACCTAGTAAGGGTGGG No data
920187811_920187822 19 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187822 1:204172608-204172630 CTCTGTTGACCTAGTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920187811 Original CRISPR CCCCAGCTCCCTGCTTCCAG AGG (reversed) Intergenic
No off target data available for this crispr