ID: 920187822

View in Genome Browser
Species Human (GRCh38)
Location 1:204172608-204172630
Sequence CTCTGTTGACCTAGTAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920187811_920187822 19 Left 920187811 1:204172566-204172588 CCTCTGGAAGCAGGGAGCTGGGG No data
Right 920187822 1:204172608-204172630 CTCTGTTGACCTAGTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920187822 Original CRISPR CTCTGTTGACCTAGTAAGGG TGG Intergenic
No off target data available for this crispr