ID: 920192156

View in Genome Browser
Species Human (GRCh38)
Location 1:204200725-204200747
Sequence CAGGCTAATCAGGGGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920192148_920192156 3 Left 920192148 1:204200699-204200721 CCAAAGTCTCTGAGGCCTAGGCC 0: 1
1: 0
2: 0
3: 24
4: 230
Right 920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 86
920192144_920192156 12 Left 920192144 1:204200690-204200712 CCACACTTCCCAAAGTCTCTGAG 0: 1
1: 0
2: 3
3: 29
4: 288
Right 920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 86
920192147_920192156 4 Left 920192147 1:204200698-204200720 CCCAAAGTCTCTGAGGCCTAGGC 0: 1
1: 0
2: 1
3: 10
4: 213
Right 920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920192156 Original CRISPR CAGGCTAATCAGGGGGTTTC AGG Intronic
900385019 1:2406571-2406593 CAGGGTGCACAGGGGGTTTCTGG + Exonic
901925968 1:12566297-12566319 CAGGCTGACCAGGGGGCCTCAGG - Intergenic
906612145 1:47210919-47210941 CAGGCCAATCAGGTAGTTGCAGG - Intergenic
910684655 1:89904002-89904024 CAGGCTAAACTGGGGATTCCAGG - Intronic
920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG + Intronic
924436347 1:244047792-244047814 CAGGCGACTCAGGCAGTTTCTGG - Intergenic
1065037595 10:21655793-21655815 CAGAGTAAACAGTGGGTTTCAGG + Intronic
1070733712 10:78849326-78849348 AAGGATAATCAGGAGGTCTCAGG + Intergenic
1071724767 10:88187027-88187049 CTGCCTAATCCGGGTGTTTCTGG + Intergenic
1073065322 10:100755288-100755310 CAGGCTACAAAAGGGGTTTCTGG + Intronic
1080923201 11:36729637-36729659 ATGGATAATCAAGGGGTTTCGGG - Intergenic
1087143762 11:94791662-94791684 CAGGCTCTGCAGGGGCTTTCTGG + Intronic
1089443129 11:118532251-118532273 CAGGCCAATCTGGGGGTGCCAGG - Exonic
1090077800 11:123590487-123590509 CAGGCTCAGCTGGGGGTTACTGG + Intronic
1092078543 12:5693642-5693664 CAGGGTATTGAGGGGGTCTCTGG - Intronic
1101953334 12:109193164-109193186 CAGGCTGCTCAGGGTGATTCAGG + Intronic
1104851858 12:131879897-131879919 CAGGCTAATGATGGGAGTTCAGG + Intergenic
1106097359 13:26659854-26659876 CAGGCTTATGAGGGGGTATTAGG + Intronic
1108942666 13:55977249-55977271 CAGGCTGTTCAGAGGGTTCCAGG - Intergenic
1112617997 13:101025503-101025525 CTTTCTAATCAGAGGGTTTCAGG + Intergenic
1117730368 14:58715960-58715982 CAGGCTTGGCAGAGGGTTTCAGG + Intergenic
1119266838 14:73267746-73267768 CAGGCTGATCAGGGGATGGCTGG - Intronic
1119646249 14:76350650-76350672 CTGGCTCATCAGAGGGCTTCAGG - Intronic
1120980969 14:90288657-90288679 CAGGCTAATTAGGCGGCTACAGG + Exonic
1125460215 15:39899227-39899249 CAGGCAAAGCAGGGGGTTGCTGG - Intronic
1127772516 15:62243084-62243106 CAGGCTCATCAGCAGGGTTCTGG + Intergenic
1128837049 15:70817563-70817585 CAAGCTATTCAGGGGGTCCCAGG - Intergenic
1129762213 15:78136341-78136363 CAGGTTAAACAAGGGGTTGCAGG - Intronic
1132985696 16:2766161-2766183 TCGGCTTATCAGGGGGGTTCTGG - Exonic
1133796036 16:9047242-9047264 CAGGCTGACCAGGGGGTCTAAGG - Intergenic
1135918875 16:26630601-26630623 CAGGCTCAGCTGGGGGTCTCGGG + Intergenic
1136134096 16:28244072-28244094 CCAGCTAATCAGGAGGCTTCAGG + Intergenic
1137996718 16:53223410-53223432 AAGGCCATTCAGGGGCTTTCTGG - Intronic
1139371320 16:66471160-66471182 CTGGCTAATCAGGGTGTGTCTGG - Intronic
1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG + Intronic
1142106529 16:88306593-88306615 CAGGCTAGTCATGGGGCTTCAGG - Intergenic
1143942610 17:10558253-10558275 CAGACTCATCAGGGGGTAGCTGG + Intergenic
1145392582 17:22467435-22467457 CAGGCATGTCAGGGTGTTTCAGG + Intergenic
1162101565 19:8342463-8342485 CGGCCTAATGAGGGGGTCTCAGG - Intronic
1166602829 19:44113228-44113250 CAGGCGAATCAGGGGATTTCTGG + Intronic
1168047937 19:53807465-53807487 CAGGCTGGTCTGGGCGTTTCAGG - Intronic
925998619 2:9312321-9312343 CAGGTCAATGAGGGGGATTCTGG - Intronic
931659353 2:64544082-64544104 CAGGAAAATCAGAGGGTTTTGGG - Intronic
931980137 2:67685713-67685735 GAAGCTAATAATGGGGTTTCAGG - Intergenic
932997457 2:76872772-76872794 CAAGCTATTCAGGAGGGTTCTGG - Intronic
938650452 2:133377649-133377671 CAGGCAAATTAGGGGGTCACTGG - Intronic
941503226 2:166307951-166307973 TAGGGTTATCAGTGGGTTTCTGG + Intronic
1174046080 20:47734641-47734663 CAGACTAAACAGGTGTTTTCAGG + Intronic
1174191934 20:48747127-48747149 CAGATTAATCAGGGCGTTTGGGG + Intronic
1175459513 20:59141888-59141910 CAGGCCAATCTGGGGGTTCATGG - Intergenic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1176114444 20:63425171-63425193 CAGGCTCATCAGGATGTTCCAGG + Intronic
1177019711 21:15838888-15838910 CAGGCTATTGAGGAGGTTTGGGG - Intronic
1182459513 22:30473854-30473876 CAGGCTACTCCGGGGGGTTGAGG - Intergenic
1185088979 22:48755460-48755482 CAGGCTGATCAGGGGGAGCCAGG + Intronic
949903840 3:8842092-8842114 TAGGCTAATTAGAGGGTTCCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
955400506 3:58587750-58587772 CAGGCTCACCAGGGGGCTTCAGG + Intronic
956781102 3:72604058-72604080 CCCGCTATTCAGTGGGTTTCTGG + Intergenic
961373037 3:126443146-126443168 AATGCTAACCAGGAGGTTTCTGG + Intronic
963587102 3:147205824-147205846 GAGGCCTATCAGGGGGTGTCGGG - Intergenic
966650659 3:182297191-182297213 CAGTCTGCTCTGGGGGTTTCTGG - Intergenic
973975643 4:56259767-56259789 CAGGCAAAGCAGGGGGTTGCTGG + Intronic
975802361 4:78074546-78074568 CTGGCTAAGCAGGGTGTTCCTGG - Intronic
986856198 5:11871399-11871421 CAGGATTATTAGGGGGATTCAGG + Intronic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
988082422 5:26430842-26430864 CAGGCTTTCCAGTGGGTTTCTGG + Intergenic
991085781 5:62647251-62647273 CAGGCTAAGCAGGGGGAGTTGGG - Intergenic
997825163 5:137099808-137099830 CAAGCTAATCAAGAGGTTTTGGG + Intronic
1001138999 5:169127594-169127616 CAAGCAAATCAGGGTCTTTCTGG + Intronic
1002631287 5:180581184-180581206 CAGACTAGTCAGCTGGTTTCTGG + Intergenic
1005618043 6:27594100-27594122 CAGCCTAATCCCGGGATTTCTGG + Intergenic
1007530903 6:42541362-42541384 CAGGGTGACAAGGGGGTTTCTGG - Intergenic
1009932045 6:70188072-70188094 CAGGGTGATCAGGGGATTCCAGG + Exonic
1010228501 6:73514108-73514130 CAAGCTACTCTGGGGGGTTCAGG - Intergenic
1013608914 6:111775823-111775845 CAGGCTGCTCAGGGAGTCTCAGG + Intronic
1014052515 6:116971776-116971798 ATGGCTAATCAGGGAGTTTGGGG + Intergenic
1016669768 6:146690213-146690235 TAGGCTGATAAGTGGGTTTCTGG + Intronic
1027974486 7:85133335-85133357 CAGGATAAGCAGGGGATTCCTGG + Intronic
1032575794 7:133052904-133052926 CAGGCTTATCATGGGTTTTTGGG - Intronic
1037998709 8:23371976-23371998 CAGGTTAATAAGGGGGTTTGGGG + Intronic
1038746226 8:30257667-30257689 CTGGCTGATCAGGTGGTTCCAGG - Intergenic
1044883432 8:96748036-96748058 CATGCTAATTAGGTGATTTCTGG - Intronic
1051211033 9:14744116-14744138 GAGGTTAATCAGTGGCTTTCAGG - Intronic
1052503359 9:29321482-29321504 CTGGCTTATCAGGAAGTTTCTGG + Intergenic
1057701349 9:97365359-97365381 CATGCTAATCAGGTGGATTTGGG - Intronic
1059477021 9:114555441-114555463 CAGGCTACTCAGAGGGTTAAGGG - Intergenic
1061797905 9:133098989-133099011 CAGGCCAAGCCGGGGGGTTCTGG - Intronic
1185687499 X:1941311-1941333 CAGGCTATTCATGGGTTTTAAGG + Intergenic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1189867719 X:45348812-45348834 CATGCTAAATAGGGGATTTCAGG - Intergenic
1199593476 X:149488834-149488856 CAGGCAGCTCAGGAGGTTTCTGG + Intronic
1200779274 Y:7199605-7199627 CCGCCAAATAAGGGGGTTTCTGG + Intergenic