ID: 920192678

View in Genome Browser
Species Human (GRCh38)
Location 1:204203518-204203540
Sequence CAGGGCAATTCTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920192678_920192688 16 Left 920192678 1:204203518-204203540 CCTTCCTCCTCAGAATTGCCCTG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 920192688 1:204203557-204203579 GTGACATTTCCCACTGGATTGGG 0: 1
1: 0
2: 1
3: 10
4: 152
920192678_920192686 10 Left 920192678 1:204203518-204203540 CCTTCCTCCTCAGAATTGCCCTG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 920192686 1:204203551-204203573 CAGGTGGTGACATTTCCCACTGG 0: 1
1: 0
2: 0
3: 19
4: 132
920192678_920192682 -6 Left 920192678 1:204203518-204203540 CCTTCCTCCTCAGAATTGCCCTG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 920192682 1:204203535-204203557 GCCCTGTCTCCACTCTCAGGTGG 0: 1
1: 0
2: 3
3: 25
4: 248
920192678_920192681 -9 Left 920192678 1:204203518-204203540 CCTTCCTCCTCAGAATTGCCCTG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 920192681 1:204203532-204203554 ATTGCCCTGTCTCCACTCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 237
920192678_920192687 15 Left 920192678 1:204203518-204203540 CCTTCCTCCTCAGAATTGCCCTG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 920192687 1:204203556-204203578 GGTGACATTTCCCACTGGATTGG 0: 1
1: 0
2: 2
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920192678 Original CRISPR CAGGGCAATTCTGAGGAGGA AGG (reversed) Intronic
900316744 1:2060795-2060817 CAGGGCGAGTGTGAGGAGGCAGG + Intronic
901443261 1:9292464-9292486 CTGGGCACTTCAGAGGAGGCCGG + Intergenic
903533118 1:24047344-24047366 TGGGGCAATTCCCAGGAGGAGGG + Intergenic
903656910 1:24955117-24955139 AAGGGCAGATCTGGGGAGGAAGG - Intronic
903888226 1:26553553-26553575 CAGGGCCATCCTGAGGTGGGTGG + Intronic
904663310 1:32101200-32101222 CAGGGTAAGGCTGAGTAGGAAGG - Intronic
904824435 1:33265394-33265416 CAGGGCTAATCAGAGCAGGAGGG - Intronic
906305963 1:44719338-44719360 AAGGGCAATTTCGAGGAGGCAGG + Intronic
906734471 1:48111567-48111589 CATTGCAGTTCTGAGGAGGCTGG - Intergenic
909075270 1:71045643-71045665 CAGAGCAATGCAGAGGAGCAAGG - Intronic
909293589 1:73914942-73914964 AAGGTTAATTCTTAGGAGGAGGG - Intergenic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
911040277 1:93585716-93585738 CAGGGCAATTGCAAGGAGGGAGG - Intronic
911778674 1:101847130-101847152 CAGGGCACTTCCCACGAGGATGG - Intronic
913148142 1:116012488-116012510 CAGGGCTATTCGGTGGAGGAAGG + Intronic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
913496568 1:119433263-119433285 CAGGGCAATTTTCACAAGGAAGG + Intergenic
914335981 1:146715270-146715292 CAGGGCAATGCTCCAGAGGAAGG + Intergenic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
915263834 1:154700228-154700250 AAGGCCAATTCTGATGAAGAAGG + Exonic
915441247 1:155946809-155946831 TCTGCCAATTCTGAGGAGGATGG - Intergenic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
915625090 1:157109550-157109572 CAGGGCCTTCCTGAAGAGGAGGG - Intergenic
915729140 1:158040743-158040765 CTGGTCTATTCAGAGGAGGAGGG + Intronic
916454969 1:164961701-164961723 CAGGCCAGGTGTGAGGAGGAGGG - Intergenic
917008344 1:170441688-170441710 CAAGGCAATTCTGCAGAGAAGGG + Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920232441 1:204479661-204479683 CGAGGCAAAGCTGAGGAGGATGG - Intronic
921670294 1:217917454-217917476 CAGGGCCTGTCTGAGCAGGAGGG - Intergenic
1065815045 10:29475605-29475627 GAGGGCCTTTCTGAGGAGGTGGG + Intronic
1066616416 10:37299539-37299561 CTGGGCAAGTTTGAGGAGCATGG - Intronic
1067905855 10:50290262-50290284 CGGGGTAATTCTGACTAGGATGG - Intergenic
1069521609 10:69125787-69125809 CATTGCATTTCTGAGGTGGAAGG - Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070815705 10:79321739-79321761 CAGGGCAATTCTCCAGAGAAAGG - Intergenic
1070816349 10:79326997-79327019 CAGTGCAATTCAGAGCAGGAAGG + Intergenic
1071432674 10:85618660-85618682 CAAGGGAAGGCTGAGGAGGAGGG - Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071848263 10:89541942-89541964 AAGAGCAATTCTTTGGAGGAAGG + Intronic
1072028164 10:91486176-91486198 CAGGCCAATTCTGATAAAGAGGG - Intronic
1072546369 10:96442505-96442527 CAGGGCAGTCCTGAAGAGGAAGG - Intronic
1073772703 10:106752756-106752778 CAGGGTAATGCTAAGGAGAATGG + Intronic
1074204091 10:111266894-111266916 TAAGGCAATTCTGGGGAGGTGGG - Intergenic
1075341361 10:121649018-121649040 CAGGGGATTTCTGATGTGGAGGG - Intergenic
1075549081 10:123378975-123378997 CAAGGCCATGCTGAGCAGGAGGG + Intergenic
1076807296 10:132865370-132865392 CAGGGCCAGTCCCAGGAGGAGGG + Intronic
1077485399 11:2836164-2836186 CAAGGCATTTCTGAGGGAGAGGG + Intronic
1079151673 11:17905497-17905519 CAGGCTTAGTCTGAGGAGGAAGG + Intronic
1079395612 11:20060525-20060547 CAGGGCATTGCTAAGGAGGGTGG + Intronic
1080535901 11:33221355-33221377 GTGGGTAATTTTGAGGAGGAGGG + Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081648208 11:44804781-44804803 GATTGCATTTCTGAGGAGGAAGG + Intronic
1082807735 11:57461046-57461068 CAGGGCTGTTCTCAGCAGGAGGG + Intronic
1086239945 11:84677507-84677529 CAGGGCTATTCTTATAAGGAAGG - Intronic
1086461818 11:87013508-87013530 CAGGGGAACTCAGAGGAGGGGGG + Intergenic
1087594041 11:100231583-100231605 CAGGACAATTTTGAGGATAAAGG - Intronic
1089018994 11:115192218-115192240 CAGGTCAATTCTGTGAAAGACGG + Intronic
1090739130 11:129641310-129641332 CAGGGCATTTGGGAGGAGGCAGG - Intergenic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091178365 11:133581358-133581380 CTGGTTAATTCTGAGGATGATGG + Intergenic
1091755633 12:3049607-3049629 CAGGGCAAGTGTGTGGAGGCAGG + Intergenic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1098306028 12:69103518-69103540 CAGGGAACTTCTTAGGAAGATGG - Intergenic
1101446653 12:104741795-104741817 CAGGCCAATTCTGAGGCTGGTGG - Intronic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1102626567 12:114239960-114239982 GAGGGGGATTCTGAGGAGGCAGG - Intergenic
1104169704 12:126268278-126268300 CAGGGCAATTTTGTGGATGGTGG - Intergenic
1104492920 12:129209861-129209883 CAGGGCAACTATGATGGGGAAGG + Intronic
1104965332 12:132506432-132506454 GAGGGCAGATCTGAGGAGGCGGG - Intronic
1106388131 13:29307878-29307900 CATGGAAACTCTGAGGAGGGGGG - Intronic
1111676410 13:91394737-91394759 CAGGGCCATACAGGGGAGGAGGG + Intergenic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1112837480 13:103533787-103533809 GAGGGCAATTCTCTGGAGAAGGG - Intergenic
1113269129 13:108654138-108654160 CAGGGCAATTGTCTAGAGGAGGG + Intronic
1114218409 14:20675341-20675363 AAGGGCAATTCAGTGGAGAAAGG + Intergenic
1117057565 14:51928640-51928662 CAAGCCAAAACTGAGGAGGAAGG + Intronic
1117057679 14:51929648-51929670 CAAGCCAAAACTGAGGAGGAAGG - Intronic
1118490584 14:66255501-66255523 CAGGGAAATTCTGAGGACCTTGG - Intergenic
1118734492 14:68691709-68691731 CGGGGCGATTGTGAGGAAGAGGG + Intronic
1119886612 14:78148933-78148955 CATGGCTATTTTGAAGAGGAAGG + Intergenic
1119935774 14:78591146-78591168 GAGGCCATTTCTGAGCAGGATGG + Intronic
1125423257 15:39525673-39525695 CAGGGCAAATATGAGGAAGGAGG + Intergenic
1125444306 15:39736948-39736970 CAGGGAAATTCTCAGGGGAAGGG + Intronic
1125770356 15:42161164-42161186 CAGGCTAATTCTGAAAAGGACGG + Intronic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126328978 15:47511573-47511595 CAGGCCAACTCTATGGAGGAGGG - Intronic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126386705 15:48100707-48100729 CAGGGCACTGCTGGGGAGCAGGG + Intergenic
1127251138 15:57239552-57239574 CAGGGCAATTATGTATAGGATGG + Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128795739 15:70465242-70465264 CAGGGCAGTTCTGAAGACTAAGG + Intergenic
1130033173 15:80333981-80334003 CAGAGGAATGCTGGGGAGGAGGG + Intergenic
1130117271 15:81016011-81016033 CAGGACTATTCTGAGAAGGTTGG - Intronic
1130323306 15:82857745-82857767 ATGGGCAACTCTGAGGAGGGGGG + Intronic
1131687010 15:94779120-94779142 GAGGGAAATTCTGTGGAGGGGGG - Intergenic
1131724989 15:95211951-95211973 CAGGGCAATTTTGCAGGGGAAGG - Intergenic
1132091972 15:98954369-98954391 CAGGTCAGTTCTGGGGAGGCTGG - Intronic
1132610974 16:816206-816228 CTGGGCGGTTTTGAGGAGGAAGG + Intergenic
1132749438 16:1450704-1450726 CAGGGCAGTCCTGCGGAGGCGGG - Intronic
1133027499 16:2995151-2995173 CAGGGCCATTCTGAGGTGGGGGG - Intergenic
1133294091 16:4742107-4742129 CAGAGTGAGTCTGAGGAGGAGGG - Intronic
1135173005 16:20203151-20203173 CAAGGCAAATCTGAGGAGGTGGG + Intergenic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1135773961 16:25239863-25239885 CAGGGCAATACAGAGATGGAGGG + Exonic
1136920503 16:34267353-34267375 CACCGGAATACTGAGGAGGAAGG - Intergenic
1139336259 16:66233711-66233733 CAGGGCAATGCTGAGGCTCAAGG - Intergenic
1139997643 16:70995953-70995975 CAGGGCAATGCTCCAGAGGAAGG - Intronic
1140426553 16:74866184-74866206 CCGGGGAAATCTGAGGAAGATGG - Intergenic
1141450414 16:84096358-84096380 CAGGGAATTTCTGAGGGTGATGG + Intronic
1142324357 16:89404779-89404801 CAAGGTCATTCTGAGGATGAAGG + Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148729898 17:49827619-49827641 CAGGACAGTCCTGAGGGGGATGG - Exonic
1148989500 17:51653172-51653194 CAGAGCAATTGTGAGGAAGCTGG + Intronic
1151020292 17:70608375-70608397 CAAGGTATTTCTGAGGAGAATGG + Intergenic
1151045037 17:70909887-70909909 CAGCGAAATTGAGAGGAGGAAGG - Intergenic
1151193412 17:72414945-72414967 CAGCACATTTCTGAAGAGGAAGG + Intergenic
1151209420 17:72533263-72533285 CAGGCCACTCCCGAGGAGGAAGG - Intergenic
1151408417 17:73904232-73904254 CAGGGCAAGTCTGAGGATAAAGG - Intergenic
1151531841 17:74711601-74711623 CTGGGCACGTCTGAGGAAGAGGG - Intronic
1151840977 17:76617162-76617184 CAGGGCAGTTCTGAAGCGGCAGG - Intergenic
1152022050 17:77785108-77785130 CAGGCCAGTTCTGAGGATGGGGG - Intergenic
1153628356 18:7043305-7043327 CTGGACAGTTCAGAGGAGGAGGG - Exonic
1153676230 18:7458259-7458281 CACGGCAATGCTTAGGAGCAGGG + Intergenic
1154328579 18:13410668-13410690 CAAGGCAAATCTGAGGAAGGAGG - Intronic
1154497239 18:14970959-14970981 CAGGCAAATGCTGAGGAGGCTGG - Intergenic
1155239703 18:23853713-23853735 AATGGCAATTCTGGGGAGGCAGG - Intronic
1156279007 18:35614559-35614581 CAGTGCAATTGTGAAGAGGCAGG - Intronic
1158129940 18:54141170-54141192 CAGGGCAAGTCAGAGAAAGATGG - Intergenic
1158393490 18:57062217-57062239 CAGGGGATTTCAGAGGATGAGGG + Intergenic
1160350606 18:78174981-78175003 CTGGGCACCTCTCAGGAGGAGGG + Intergenic
1160620581 18:80167713-80167735 CAGGGGATTTCTGAGCAGCAGGG + Intronic
1160828635 19:1092196-1092218 CTGGGCAGTTCTGGGGAGGCGGG + Intronic
1161158191 19:2745723-2745745 CTGGACAGTTTTGAGGAGGACGG + Intergenic
1162825612 19:13249736-13249758 CAGGGCTCTGCTGAGGTGGAGGG + Intronic
1163084250 19:14968154-14968176 ACGGGCACTTCTAAGGAGGAGGG - Intronic
1165379585 19:35468876-35468898 CAGGCAGAATCTGAGGAGGATGG - Intergenic
1166550889 19:43665306-43665328 CAGGGCAACTCTGGTGAGTAGGG - Exonic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1168025209 19:53638851-53638873 CAGGGGATTTCAGAGGTGGAGGG + Intergenic
1168148764 19:54433915-54433937 CAGGGCTGTTGTGAGGATGAAGG + Intronic
925104353 2:1277784-1277806 CAGGGCTATGCAGGGGAGGAGGG + Intronic
925423847 2:3732772-3732794 GGGGCCATTTCTGAGGAGGATGG + Intronic
926326271 2:11786850-11786872 CAGGGCAAGGCTGAGGATGTTGG - Intronic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
927867647 2:26601401-26601423 CATGGCAATGCTGTGGGGGAAGG + Intronic
927915498 2:26933470-26933492 CAGGGCAGCTCTGAGGAAGACGG - Intronic
929450932 2:42036607-42036629 CAGGTAAATTCTGAAGAGCAGGG + Intergenic
933232978 2:79830340-79830362 AAGGGAAGTTCTGGGGAGGATGG + Intronic
933352972 2:81178709-81178731 CAGGGAAATACTGGGGAGAAGGG - Intergenic
935665615 2:105509726-105509748 CAGGGCAATTATCGGGAGGAGGG - Intergenic
937358676 2:121214065-121214087 CAGGGGAGGTCAGAGGAGGAGGG - Intergenic
937424752 2:121789663-121789685 CAGGGCACTGCTGGGGCGGAGGG + Intergenic
937957903 2:127432551-127432573 CAAAGCAATTCAGTGGAGGAAGG + Intergenic
939351238 2:141040758-141040780 CAGGGCAATTCTGAAGATGCTGG + Intronic
943384552 2:187185064-187185086 CAGGGAAATTCTGGGCAGAAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945368985 2:208993093-208993115 CAGGACAATTCTTTGGGGGAAGG - Intergenic
945509578 2:210684156-210684178 CAGGGCAAGGCTGAGGCTGAAGG - Intergenic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
948803151 2:240441865-240441887 GAGGGCTATGCTGAGGAGCAGGG + Intronic
1168797292 20:620174-620196 CAGGGCGAGTCTGGAGAGGATGG - Intergenic
1169794157 20:9443458-9443480 CAGGGCAATTCTATGGAGAAGGG - Intronic
1171461692 20:25301646-25301668 CAGGGCAGTACAGAGGAGGCCGG + Intronic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172883791 20:38218153-38218175 CAGGGCAAAGCTGTGGAGGTGGG - Intronic
1173733961 20:45346779-45346801 CAAAGGAATTCTGAGGTGGAAGG - Intronic
1174340279 20:49891064-49891086 CAGGCCACTTCTGCTGAGGATGG + Exonic
1176222002 20:63974213-63974235 CAGGGCAAGACAGAGGAGAAGGG + Exonic
1177244036 21:18498759-18498781 CAGAGCAAGGCTGAGAAGGATGG + Intergenic
1178271420 21:31193405-31193427 CAGGGCTTTTCTGGGGAGGCTGG - Intronic
1179137822 21:38696169-38696191 CATGGCAGAGCTGAGGAGGAAGG + Intergenic
1180061911 21:45389984-45390006 TAGGACACTTCTGAAGAGGAAGG - Intergenic
1180700060 22:17776360-17776382 CAGGGAAATTCCGGGGATGATGG + Intergenic
1183678639 22:39313815-39313837 CAGGGCTGTTCTCAGAAGGAAGG + Intronic
1185294349 22:50046046-50046068 CCAGGCAAGTCTGAGGTGGACGG - Intronic
949807818 3:7974820-7974842 CAGGACAATTCTCAGAAGAAGGG - Intergenic
950011315 3:9726048-9726070 CAGCGTGAGTCTGAGGAGGAGGG + Exonic
950802267 3:15562840-15562862 CATGGCAAGTCTGAGGAAGAGGG - Intronic
952935607 3:38396250-38396272 CAGGGCAGTGCAGAGGAAGAAGG + Intronic
953234953 3:41098007-41098029 CAGGGAAAATCTGAGCAAGAAGG - Intergenic
954084304 3:48231911-48231933 CAGGGCAATGCAGAGGAGGCAGG - Intergenic
954361815 3:50126206-50126228 CAGCACAGTTCTGGGGAGGAAGG + Intergenic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
954575559 3:51674169-51674191 CAAGGCAGGTCTGAGGAGGTTGG + Intronic
959521273 3:107325711-107325733 GAGAGCAATTCTCAGGAGAAGGG - Intergenic
963549579 3:146702835-146702857 CAGGGCCAATCTGGGAAGGATGG - Intergenic
967065113 3:185908249-185908271 CACGGCAATTTGCAGGAGGAAGG - Intergenic
967389643 3:188943122-188943144 AAGGCCAATTCATAGGAGGAGGG - Intergenic
967498492 3:190169449-190169471 CCGGGCACTTCTAAGTAGGAAGG - Intergenic
968623232 4:1614002-1614024 CTCGGCGATTCTCAGGAGGAGGG + Intergenic
968655031 4:1774766-1774788 CAGGCCACTTCTGAGCAGGGGGG + Intergenic
969561446 4:7950686-7950708 CTGGGCTGTCCTGAGGAGGATGG - Intergenic
969727060 4:8926292-8926314 CAGGACAACTCTAAGCAGGAGGG - Intergenic
969885527 4:10211984-10212006 GATGTCAATTCTGAGGTGGATGG + Intergenic
970902248 4:21173454-21173476 CAGAGCAGTTCAGGGGAGGAAGG + Intronic
971335669 4:25721681-25721703 CAGGGAAATTCACAGGAGGAAGG + Intergenic
971355442 4:25890906-25890928 CAGGGCAAGTCTCAGGAGAAGGG - Intronic
971851579 4:31991825-31991847 CAGGGCAACTCGAAGGAGGGTGG + Intergenic
972160665 4:36222931-36222953 CAGGGAATTTATGAGGAAGAAGG - Intronic
972484144 4:39526722-39526744 CAGAGCAATTCTGTGGTGTAGGG + Intronic
974461147 4:62189524-62189546 CAGGGTATTTCTGAGGAGTTAGG - Intergenic
975426744 4:74238254-74238276 TAGAGCAGTTCTGAGAAGGAAGG + Intronic
976132344 4:81897980-81898002 GAGGGCAATTCTCTGGAGAAAGG - Intronic
976217867 4:82731668-82731690 CAGCGCAGTTCTTATGAGGATGG + Intronic
978074250 4:104509214-104509236 AAGGCAAATTCTGAGGTGGAGGG + Intergenic
978113374 4:104989641-104989663 GTGGGTAATTCTCAGGAGGAAGG - Intergenic
978190043 4:105900188-105900210 CAGAGCACCTCTGATGAGGAAGG - Intronic
978937398 4:114394845-114394867 AAGGGCAATTCTCTGGAGAAGGG + Intergenic
981290017 4:143063663-143063685 CTGGGCAATTCTTAGGAAGTTGG + Intergenic
984674836 4:182535044-182535066 CTGGGCTAATTTGAGGAGGAGGG - Intronic
985368911 4:189264113-189264135 CAGGGCAATTCTGAAGGAGCTGG + Intergenic
986104342 5:4645411-4645433 CAGAGCCATGCTGAGGAGCAGGG + Intergenic
986784574 5:11102081-11102103 GAGTAAAATTCTGAGGAGGAAGG - Intronic
988827264 5:34950777-34950799 CAGGGCTCCTCTGAGCAGGAAGG - Intronic
991258991 5:64646441-64646463 TGGGGCAATTCTCAGGAGAAGGG + Intergenic
991642508 5:68769058-68769080 CAGGCCAATTCTCAGTAGAAAGG - Intergenic
992594000 5:78327151-78327173 CATGGCCACTCTCAGGAGGATGG - Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
993774021 5:91968655-91968677 AAGGGCAATTCTGTGGAGAAGGG + Intergenic
995331254 5:110949480-110949502 CACCGGAATACTGAGGAGGAAGG - Intergenic
995948791 5:117684101-117684123 CAGGACATTTATGAGGAGAATGG - Intergenic
996029131 5:118685363-118685385 CTGGGCAACTCTGAGCTGGAGGG - Intergenic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
997647156 5:135489261-135489283 CGGGGCAAGTCTGGGGAAGACGG - Intergenic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
998193377 5:140045040-140045062 CATGGCAATACAGAGGAGGAAGG - Intergenic
998581117 5:143377128-143377150 CAGTGGAATACTGAGGAGTAAGG - Intronic
999643743 5:153697986-153698008 CAGGCCAGTTCAGAGGAGGCTGG + Intronic
1001948573 5:175800012-175800034 CAGGGCAAATCGGAAAAGGAAGG - Intronic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1002993403 6:2258821-2258843 AAGGGCAATTCTGAGAAGGTTGG + Intergenic
1006367571 6:33624570-33624592 CAGAAGGATTCTGAGGAGGATGG - Intronic
1006470512 6:34226221-34226243 CAGGCCAATGCTGAGGTGGGTGG + Intergenic
1007765929 6:44159617-44159639 CAGGGCACTTCTGAAGAACAAGG - Intronic
1007825184 6:44594831-44594853 CAAGGCTATTCTGGGAAGGAGGG + Intergenic
1007926145 6:45651295-45651317 CAGAGGAATTCTTAGGAGAAAGG + Intronic
1008291713 6:49723811-49723833 CAGGGCAACTCGAAGCAGGAGGG - Intergenic
1008492671 6:52102571-52102593 GAGGGTAATTCTTGGGAGGAGGG - Intergenic
1010234794 6:73566453-73566475 CAGGCCAATTTTGGGGAGGTGGG - Intergenic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1013139010 6:107312243-107312265 AAGGGTATTTCTGGGGAGGATGG - Intronic
1013631713 6:111992174-111992196 CAAGGCATTTCTGGGGAGCACGG + Intergenic
1015723711 6:136276221-136276243 CACCGGAATACTGAGGAGGAAGG - Exonic
1016035310 6:139377356-139377378 CAGGGCAGTACTGTGGAGAATGG + Intergenic
1017026414 6:150185239-150185261 CAGGGTAGTTGTGAGGATGAAGG + Intronic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1021619918 7:22541337-22541359 CATGTCAACTCTGAGGAGGTTGG - Intronic
1023938067 7:44753932-44753954 GAGAGCAATTCAAAGGAGGAAGG - Intronic
1024023683 7:45392862-45392884 CAGAGCAATTCAGTGGAGAAAGG - Intergenic
1025122457 7:56316875-56316897 CAGGTCAGTTCTTATGAGGAAGG + Intergenic
1026445886 7:70484452-70484474 CAGGGGAGTTCTGAGGTGGTTGG + Intronic
1026867884 7:73834614-73834636 CAGGGCATTTCTGAGGGGCAGGG + Exonic
1026911492 7:74094061-74094083 CGGGGCAGTTCTGAGGATGCTGG + Intronic
1026955074 7:74371975-74371997 CAGGGCAGTTCTGAAGGGGCGGG - Intronic
1029288916 7:99486724-99486746 CAGGGCAGATATGATGAGGATGG + Exonic
1033472347 7:141661412-141661434 CAGAGCACTTCAGAAGAGGATGG + Exonic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034711017 7:153191565-153191587 AGGGGCAATTCTGAGGGTGAAGG - Intergenic
1034830731 7:154305352-154305374 CAAGGCTATTTTGGGGAGGATGG - Exonic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1037148315 8:15601684-15601706 CAAGGCAAATCTTAGGAGGCTGG + Intronic
1037255483 8:16947980-16948002 CAGGGCAATTAGGCAGAGGAAGG + Intergenic
1038573816 8:28686704-28686726 TAGGGCAATTAGGAGGAGAAAGG + Intronic
1038669792 8:29573608-29573630 CAGGGAAAATCTTTGGAGGAAGG - Intergenic
1038880759 8:31608167-31608189 CTTGGGAATTCTGGGGAGGAGGG + Intergenic
1040143566 8:43959019-43959041 CAGGGCAATTCTGCAGGAGAAGG + Intergenic
1040272270 8:45966247-45966269 CAGGGCAATTCTGCAGGAGAAGG + Intergenic
1041460819 8:58109560-58109582 TATGGAAATTCTGGGGAGGAAGG + Intronic
1042990087 8:74629615-74629637 GAGGGCAATTCTTTGGAGAAGGG + Intronic
1043379027 8:79683334-79683356 AAGGGCAGTTATGAGGGGGATGG - Intergenic
1043761556 8:84075401-84075423 CAGAGCCACTCTGTGGAGGAAGG + Intergenic
1044152696 8:88800979-88801001 CAGGGCAATGCAGAGGGGGAAGG + Intergenic
1044906682 8:97011804-97011826 CAGGGCAAAACTGGGGAGAAGGG - Intronic
1045339415 8:101239679-101239701 CAGGGCAATTCTCAGGATTCAGG - Intergenic
1045887357 8:107114336-107114358 CAGGGCTATACTGAGGATGATGG + Intergenic
1048829655 8:138463797-138463819 CTGAGCAATCCTGAGGAGAAGGG + Intronic
1049155460 8:141063588-141063610 GAGGTCAAGGCTGAGGAGGAAGG + Intergenic
1050462692 9:5890641-5890663 CATGGCAATCCTATGGAGGAGGG + Intronic
1051606511 9:18922586-18922608 CAGGGCAGGTCTGAGGAGCCAGG + Intergenic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1056168709 9:83962385-83962407 CAGGGCAGTTTTTGGGAGGAAGG + Intergenic
1057160310 9:92884332-92884354 CAGGGCAGTTGTGAGGACTATGG + Intergenic
1057296790 9:93850349-93850371 AAGGGCAATTCAGTGGAGAAAGG - Intergenic
1057604492 9:96489385-96489407 AAGGGCGGTTCTGAGGTGGAGGG - Intronic
1058813805 9:108665770-108665792 CAGGGCAACTCTGAGAATCATGG + Intergenic
1059693007 9:116703916-116703938 CAGGGCAACAGTGAGGAAGAAGG + Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061486435 9:130922809-130922831 CAGGGAACATCTGAGGAGCAGGG - Intronic
1062709921 9:137969605-137969627 CAGGGCCACTCTGGGAAGGAGGG - Intronic
1185660825 X:1727657-1727679 CAGGGAAATTCCGACGAGGAGGG - Intergenic
1187076911 X:15944379-15944401 CAGGACAATTCTGCAGAGGAAGG + Intergenic
1187077224 X:15947249-15947271 CAGGGCAATTCTCCAGAGAAAGG - Intergenic
1187104185 X:16223257-16223279 CAAGGCAATGCTGAGAAGAAAGG - Intergenic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1189254740 X:39629175-39629197 GAGGGCAATTGTCAGGAGAAGGG + Intergenic
1189749935 X:44210552-44210574 CAAGGCAATTCAGTGGAGAAAGG + Intronic
1190866309 X:54387627-54387649 AAGGGGATTTCTGAGAAGGAAGG - Intergenic
1192191584 X:68994455-68994477 CAGGGCAGGTCTGGGGAGTAGGG + Intergenic
1192476234 X:71445506-71445528 CAGGGCAATTCAATGGAGGAAGG - Intronic
1194605409 X:95973191-95973213 CAGGACAGTCCTGAGGGGGATGG + Intergenic
1195682347 X:107557750-107557772 AAAGGCAATTCAGTGGAGGAAGG - Intronic
1196806628 X:119593742-119593764 CAAGGCAATTCAATGGAGGAAGG + Intronic
1198518038 X:137428098-137428120 CAGGGCAACTCCGAGGAGCTTGG - Intergenic
1201263201 Y:12180568-12180590 AAGGGCAACTCTAAGGTGGAAGG - Intergenic