ID: 920193794

View in Genome Browser
Species Human (GRCh38)
Location 1:204212867-204212889
Sequence AACAAGGAGGTGGGTATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920193794_920193799 13 Left 920193794 1:204212867-204212889 CCAGGTATACCCACCTCCTTGTT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 920193799 1:204212903-204212925 ACCAAGTATGCTAATGCCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 113
920193794_920193801 14 Left 920193794 1:204212867-204212889 CCAGGTATACCCACCTCCTTGTT 0: 1
1: 0
2: 0
3: 9
4: 150
Right 920193801 1:204212904-204212926 CCAAGTATGCTAATGCCTCAGGG 0: 1
1: 0
2: 3
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920193794 Original CRISPR AACAAGGAGGTGGGTATACC TGG (reversed) Intronic
902094060 1:13927896-13927918 ATCAAGGAGGAGGGCATCCCAGG + Intergenic
902174829 1:14641192-14641214 TATAGGGAGGTGGGAATACCAGG + Intronic
902620588 1:17648521-17648543 AGGAAGGAGGTGGGTAGAGCTGG - Intronic
902788579 1:18749535-18749557 AGCAAAGAGGTGGTTTTACCTGG + Intergenic
903291579 1:22317557-22317579 AAAAAGAAGGTGAGTATGCCTGG - Intergenic
903979561 1:27176198-27176220 AACAAGGAGCTTTGCATACCTGG - Intergenic
908869349 1:68590766-68590788 AAAAAGGAGGTGGGAATTGCTGG - Intergenic
912702800 1:111890749-111890771 AACAGCAAGGTGGGTAGACCTGG + Intronic
916913794 1:169384012-169384034 AACAAGTAGATGGAAATACCTGG - Intronic
917255841 1:173115308-173115330 GACAAGGAGTTCTGTATACCTGG + Intergenic
918065201 1:181095877-181095899 AACAAGCAGGTGGGAACACATGG - Intergenic
919856195 1:201707864-201707886 CACAAGTAGGTGTGTATATCTGG + Intronic
920193794 1:204212867-204212889 AACAAGGAGGTGGGTATACCTGG - Intronic
920209305 1:204316450-204316472 AACAAGGGGTTGGGTACCCCTGG - Intronic
921871182 1:220141618-220141640 TTCAAGGAGGTGGGTACACCTGG + Intronic
1066130549 10:32389196-32389218 AACAAAGATGTGGGAATCCCAGG + Intergenic
1066586928 10:36945748-36945770 AACATGGAGGTGGGTAGAGATGG - Intergenic
1070789807 10:79182322-79182344 AAGAAGGAGGTGGGTGCATCAGG - Intronic
1072185496 10:93034343-93034365 AACAAGGAGGTGGGTGCCCAGGG - Intronic
1072814591 10:98492697-98492719 AAAAAGGAGATGAGGATACCTGG + Intronic
1073023538 10:100468304-100468326 ATCAAGAAGGTGGGTGTACATGG - Intronic
1074138916 10:110653874-110653896 TAGAAAGAGGTGGGTATACTTGG - Intronic
1077955379 11:7013643-7013665 GAAAAGGAGGTGGGAACACCAGG - Intronic
1078547952 11:12259894-12259916 AAGAAGGAGGTGGAGATACCTGG - Exonic
1079639355 11:22784839-22784861 AACAATGAGTTGGGGAAACCAGG - Intronic
1080662943 11:34312188-34312210 AACAAGCAGGTGGTTCTGCCTGG + Intronic
1082857200 11:57818545-57818567 AACCAGAAGGAGGTTATACCAGG + Exonic
1083159747 11:60847801-60847823 AGCAAGGAGGTGGTTCTGCCTGG + Intronic
1085704925 11:78778402-78778424 CACAAGGTGGTTGATATACCTGG - Intronic
1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG + Intergenic
1086203111 11:84227135-84227157 AACAAGGAAGAGGGTGTACATGG + Intronic
1090629600 11:128634589-128634611 AAGAAGGAAGTGGGGAGACCAGG + Intergenic
1091555685 12:1571833-1571855 AACAAGGAGATGGGAAGATCTGG - Intronic
1093630795 12:21407008-21407030 AACAAGGAGGTAGGTATGGGTGG - Intronic
1093758609 12:22880722-22880744 TACTAGGAGGTGGGAATAACTGG - Intergenic
1101407561 12:104441961-104441983 AACACTGAGGTGGGAATACATGG + Intergenic
1103963188 12:124622145-124622167 AACAAGGATGTGGGAAATCCTGG + Intergenic
1104022447 12:125002335-125002357 GACAAGGATGTGGGGAAACCAGG - Intronic
1108597200 13:51959863-51959885 AGCAAGGAGGTTGCTATTCCAGG + Intronic
1110432524 13:75441260-75441282 AACAAGGAGGAGGGGGTACAAGG + Intronic
1113763850 13:112868638-112868660 AAAAAGGAGATTGGTATCCCAGG + Intronic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1116999843 14:51361279-51361301 AGCAAGGAGATGGGGATTCCAGG + Intergenic
1117540759 14:56744452-56744474 ATTAAGGTGGTGTGTATACCAGG + Intergenic
1118705784 14:68479075-68479097 AAGAAGGATTTGGGTAGACCTGG + Intronic
1119518538 14:75267950-75267972 AACAAGGAGCAGGGTATTCAGGG - Intronic
1120970805 14:90205367-90205389 AGCAGGGAGGTGGGAATCCCAGG + Intergenic
1121473898 14:94175900-94175922 ATCAAGGAGCTGAGGATACCAGG - Intronic
1121855413 14:97265098-97265120 AACAAGGAAGTGGGCTTACTGGG - Intergenic
1122161119 14:99784741-99784763 AACAAGGAGCTGGCTTCACCAGG + Intronic
1122356830 14:101127861-101127883 AACAAGGAGGTTTGTATGGCTGG - Intergenic
1124631260 15:31338902-31338924 AAGCAGCAGGTGGGTATACAGGG + Intronic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1132237399 15:100232496-100232518 AAGAAGAAGGTGGGTTTACTGGG - Intronic
1133513766 16:6486209-6486231 AACAATGAGGAGTGTGTACCTGG - Intronic
1135192776 16:20368317-20368339 AACAAGGAGGTGGGAGCACAGGG + Intronic
1136476832 16:30518716-30518738 TCCAAGGAGGTGGAGATACCTGG - Exonic
1138022883 16:53500803-53500825 GAAAAGGAGGTGGGTATAGAAGG - Intronic
1140353192 16:74282217-74282239 AACAAGCAGGTAGGTATCCAAGG + Intergenic
1140357929 16:74321733-74321755 ACCATGAAGGTGGGAATACCAGG + Intergenic
1140421887 16:74826090-74826112 CACAAGGATGTGGGTATAAAGGG - Intergenic
1142298898 16:89244827-89244849 ACCGAGGACGTGGGTATCCCTGG - Intergenic
1142299299 16:89247340-89247362 AGCAAGGAAGTGGGTGCACCTGG + Intergenic
1146218351 17:30997059-30997081 AACATGGAGGTGCACATACCTGG + Intronic
1148073600 17:44922617-44922639 AGCAAGGAGGTGGGCATAAAAGG + Intergenic
1151126485 17:71851049-71851071 AAAAAGGAGGTGTGCATAACTGG + Intergenic
1153787402 18:8546859-8546881 AACAATGAGGCGGGAAAACCAGG - Intergenic
1154015307 18:10611060-10611082 AACAAAAAGGTGGATATACAGGG + Intergenic
1154190215 18:12224581-12224603 AACAAAAAGGTGGATATACAGGG - Intergenic
1155159124 18:23181602-23181624 ACCAGGTAGGTGGGTATTCCTGG - Intronic
1157210696 18:45739630-45739652 AGCCAGGAGGTGGGTTTGCCAGG - Exonic
1157271458 18:46279536-46279558 AACAAGGAGGTATTAATACCAGG - Intergenic
1163777531 19:19227046-19227068 ACCAATGAGGTGGATATGCCTGG + Exonic
1164732021 19:30513648-30513670 GACAGGGAGGTGTGTCTACCAGG + Intronic
1165439775 19:35818510-35818532 ATCAAGAGGGTGGGTATCCCAGG + Intergenic
1166871405 19:45873070-45873092 AACATGGTGGTGGGTATGGCTGG + Exonic
925442505 2:3900590-3900612 AACATGGAGGTGCCTACACCAGG - Intergenic
925858433 2:8152691-8152713 TACAAGGAGGGGCGTATACAAGG + Intergenic
929536484 2:42787402-42787424 ACTGAGGAGGTGGGTAGACCTGG - Intronic
931177587 2:59869617-59869639 AAAAAGGAGGAGAGTATACAAGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
938385830 2:130866392-130866414 AAGAAGAAGGTGGGTATGGCAGG + Intronic
938403021 2:131009166-131009188 AAGAAGGAGGTGCGTGTCCCTGG - Intronic
939378169 2:141398423-141398445 AACAAGCAAGCGGGTATAGCAGG + Intronic
940048660 2:149437513-149437535 CACAAGGAAGTGGGTAGACATGG - Intronic
1168901964 20:1372370-1372392 CACAAGGAGGTGGTGATGCCTGG - Intronic
1168969438 20:1920904-1920926 GACAAGGAGCTGGGTGTGCCAGG + Intronic
1169314443 20:4576800-4576822 AACAAGGAGGTGGGGATCACTGG + Intergenic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1170445363 20:16421373-16421395 AAGAAGGAGGGGGTTATATCAGG - Intronic
1171180613 20:23088055-23088077 CACCAGGAGGTGGGTGTACAAGG + Intergenic
1173028649 20:39333783-39333805 AACTATTAGGTGGGTAAACCTGG + Intergenic
1174886578 20:54341793-54341815 AGAAAGGATGTGGGTAAACCTGG + Intergenic
1176268899 20:64225206-64225228 AGCAAGGAGGTTGGTACACCAGG - Intronic
1178851578 21:36216740-36216762 TACCAGGAGGTAGGTACACCTGG - Intronic
1179357847 21:40677846-40677868 ATCAAGGAGGTGGGTAGATTTGG - Intronic
1180714855 22:17864880-17864902 AACAAGGAAGTGAGGCTACCTGG + Exonic
1182260211 22:29068734-29068756 GACAAGGAGGTGGCTCAACCTGG + Intergenic
1183107830 22:35627562-35627584 AAGAAGGAGGTGGACAAACCTGG - Intronic
1184711553 22:46253303-46253325 AACAAGAAGATGGATATTCCTGG - Intergenic
949777316 3:7647427-7647449 TACAAGGAGGCTGGTATACTAGG + Intronic
953434598 3:42868465-42868487 AACAAGGGTGAGGGAATACCTGG - Intronic
955456698 3:59129412-59129434 AAGAAGGAGTTGGGGATACTTGG - Intergenic
955556131 3:60139425-60139447 AACAAGGTGGAGGATATAGCTGG + Intronic
957658437 3:83113528-83113550 AACAAGTAGATGGGTAAAACAGG + Intergenic
960136512 3:114111057-114111079 AAGAAGGAGGTGGTTATACAGGG + Intergenic
960171835 3:114471503-114471525 AACAAGGTGGTGGGTCCAGCAGG + Intronic
960350640 3:116588658-116588680 AGCAAGCAGGCTGGTATACCTGG - Intronic
963140902 3:141945422-141945444 ACAAAAGAGGTGGGTATGCCAGG - Intergenic
963859417 3:150292980-150293002 AACATGGTGGTGGTTATAGCTGG - Intergenic
964826049 3:160829185-160829207 AACAAGGAGGAGGGCATTCCAGG - Intronic
965509873 3:169556530-169556552 AACCAGGAGGTGGGGATCACTGG - Intronic
966249453 3:177846743-177846765 AACAAGGAGGCAAGTATAGCTGG + Intergenic
969330032 4:6469279-6469301 AGGCAGGAGGTGGGTATTCCAGG + Intronic
974458312 4:62156766-62156788 AACTAGGAGGATGGTATGCCAGG + Intergenic
976948548 4:90799718-90799740 ACCAAGGGGGTGGCTATCCCTGG + Intronic
979984138 4:127294492-127294514 AGCAAGGAGGCTGGTATCCCGGG + Intergenic
982403543 4:154995549-154995571 ATCAAGGAGGTGAGTACAGCTGG - Intergenic
982812546 4:159844242-159844264 AACAAGGAAGTCAGTGTACCTGG - Intergenic
991500761 5:67274372-67274394 TACAAGGATATGGGTATACATGG - Intergenic
991515684 5:67432464-67432486 CACATGGAGGTGGGCACACCAGG - Intergenic
991947034 5:71908160-71908182 AACACAGAGGTGTGAATACCAGG + Intergenic
996144368 5:119955555-119955577 ACCAAGGAGGTGGGGAAAGCTGG + Intergenic
997206469 5:132053245-132053267 AACAAGGAGTGGAGTATTCCTGG + Intergenic
999519447 5:152335706-152335728 ATCAAGGAGGTTGTTATAACTGG + Intergenic
1002027529 5:176405673-176405695 AACAAGTAGCTGGGTACACAGGG + Intronic
1003450832 6:6230171-6230193 AGCTGGGAGGTGGGTAGACCGGG + Intronic
1004389939 6:15201685-15201707 AGCAAGGAGGTGGGTCTACAAGG - Intergenic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1012759782 6:103284579-103284601 AAGATGGAGGAGGTTATACCCGG + Intergenic
1013936237 6:115598376-115598398 AACTAGGAGGAGAGTATAGCAGG - Intergenic
1016012745 6:139155433-139155455 AAAAATGAGGTAGGTATACTAGG + Intronic
1019451844 7:1102945-1102967 TACAGGGAGGTGGGCACACCAGG + Intronic
1019625497 7:2013837-2013859 AAGAAGGAGCTGGGTATCGCAGG - Intronic
1023189417 7:37563599-37563621 CACAATGATGTGGGTATTCCTGG + Intergenic
1023394057 7:39735920-39735942 AACCTGGAGGTGGGTGAACCAGG + Intergenic
1024251704 7:47510359-47510381 AAAAAGGAGGCGGGTCTGCCTGG - Intronic
1032634579 7:133692944-133692966 AACAAGGAGGAGGATACAACAGG - Intronic
1038545504 8:28423088-28423110 AACTAGGAGGTGAGTGTACAAGG - Intronic
1040019260 8:42725590-42725612 CTCAAGGAGATGGGCATACCTGG - Intronic
1040030484 8:42819381-42819403 AACAAGGTGGTGGGTAAGCGGGG - Intergenic
1042452527 8:68965376-68965398 AACAAGGAGGTGAGTAGAAGCGG - Intergenic
1046379125 8:113431110-113431132 GGCATGGAGGTAGGTATACCTGG + Intronic
1046389015 8:113543225-113543247 AACAAGGAGGATGATACACCTGG - Intergenic
1048134026 8:131728541-131728563 AGCCAGGGGGTGGATATACCTGG + Intergenic
1048286426 8:133145354-133145376 AGCAAGGAGCTGGTTCTACCTGG + Intergenic
1050254113 9:3776369-3776391 AACAGGGAGGTGAGTGTCCCAGG - Intergenic
1054970719 9:71082769-71082791 ACCAAGGGGGTGGTTTTACCAGG + Intronic
1056306529 9:85296094-85296116 AACAATGAGGAGGGTATACATGG - Intergenic
1059570123 9:115425296-115425318 AACAAGGTGCTGGGTATAGCTGG + Intergenic
1060107139 9:120879760-120879782 AATAGGGAGGTGGGTGTGCCAGG + Intronic
1061946321 9:133910203-133910225 AACAAGAAGCTGGGTGCACCTGG + Intronic
1185529683 X:807477-807499 AACAAATAGGTGGATATACATGG + Intergenic
1186151701 X:6681373-6681395 AATATGGAGGTGGGTTGACCTGG - Intergenic
1186829374 X:13375614-13375636 AAAAAGAAGGTGGGCAGACCTGG + Intergenic
1187083920 X:16021942-16021964 ACCAAGGAGGAGGGTATAGGAGG + Intergenic
1187398845 X:18941686-18941708 AACAAAGAGGTGGTTTAACCTGG + Intronic
1190707204 X:53039760-53039782 AACAAGGGAGGGGGTATAACAGG + Intergenic
1194031987 X:88828786-88828808 AACAAAGGGGTGAGTTTACCTGG + Intergenic
1199838485 X:151618812-151618834 AATGAGGAGTTGGGTGTACCTGG + Intronic