ID: 920195985

View in Genome Browser
Species Human (GRCh38)
Location 1:204227778-204227800
Sequence CCTGACCTGCCCAAGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920195985 Original CRISPR CCTGACCTGCCCAAGCAGAA TGG Intronic
900886883 1:5421448-5421470 CCTGAACATCCCAAGCCGAAAGG - Intergenic
902549834 1:17212663-17212685 CCTGAACTGTCAAAGCAGAGAGG + Intronic
902934142 1:19752353-19752375 CCTGAGCTGCCCAAAGACAAAGG + Intronic
903388315 1:22944623-22944645 TTTCCCCTGCCCAAGCAGAAGGG + Intergenic
903467295 1:23560457-23560479 CCTGCCCTTCCATAGCAGAAAGG - Intergenic
904313582 1:29645351-29645373 GCAGAACTGGCCAAGCAGAAAGG - Intergenic
904411637 1:30328468-30328490 GCTGACCGGCTTAAGCAGAAAGG - Intergenic
904545885 1:31271494-31271516 CCAGACCTGCAAAAACAGAAAGG + Exonic
906818027 1:48899134-48899156 CCACACCTGCCCAGGTAGAACGG + Intronic
912204372 1:107493966-107493988 GCTGACCAGGCCAAGCACAAAGG + Intergenic
912305320 1:108560593-108560615 CAAGCCCTGGCCAAGCAGAAAGG - Intronic
912332780 1:108834766-108834788 CCTCACCTGCCCCACCAGCAGGG - Intronic
913972114 1:143423461-143423483 CCTGGCCTCCCCAGGCAGAGAGG - Intergenic
914066495 1:144249074-144249096 CCTGGCCTCCCCAGGCAGAGAGG - Intergenic
914112658 1:144717280-144717302 CCTGGCCTCCCCAGGCAGAGAGG + Intergenic
914770806 1:150683199-150683221 CATGACCTGCCCAGGCAACATGG + Intronic
916430535 1:164723627-164723649 CCTGGCTGGCCCAGGCAGAAAGG - Intronic
917498458 1:175564266-175564288 TCTGACCACCCCAAGCAGGACGG + Intronic
919396619 1:197057800-197057822 CATGAGCTTCCAAAGCAGAACGG + Intronic
920195985 1:204227778-204227800 CCTGACCTGCCCAAGCAGAATGG + Intronic
920308326 1:205032909-205032931 GCTCACCTGGCCAAGCAGATGGG + Intergenic
921203120 1:212825626-212825648 ACTGACCTTCCCAAGCAAGAAGG + Intergenic
921258349 1:213362842-213362864 ACTGACCTCCCCAAGCAAGAGGG + Intergenic
921574796 1:216821980-216822002 CATTGCCTGGCCAAGCAGAAGGG + Intronic
924942850 1:248824637-248824659 CCTTTCCTGCCCCAGCAGACTGG + Intronic
1062801717 10:385908-385930 CCTTACCTCCCCCAGCAGAGTGG - Intronic
1065659418 10:27990261-27990283 CCTCAGCTTCCCAAGCAGATGGG + Intronic
1067275238 10:44828022-44828044 CCTGACCTACCCAGGCTGGAGGG - Intergenic
1067467711 10:46513418-46513440 CCTGTCCAGCCCAACCAGAGGGG + Intergenic
1067619475 10:47871187-47871209 CCTGTCCAGCCCAACCAGAGGGG - Intergenic
1067694458 10:48524537-48524559 CCTGGCCTCCCCGCGCAGAATGG + Intronic
1067719319 10:48715204-48715226 CATTAGCTGCCCTAGCAGAATGG + Intronic
1069983155 10:72266305-72266327 CCAGACCTACCCAATCAGAATGG + Intergenic
1070289409 10:75104839-75104861 CATAGCCAGCCCAAGCAGAAGGG - Intronic
1070923595 10:80204408-80204430 CCTGCCCTGCCCACGCAACAGGG - Intronic
1071328885 10:84541487-84541509 GCTGCCCTGCTCAGGCAGAAGGG + Intergenic
1071449568 10:85781109-85781131 CCTGATCTCCCCAACCAGAAGGG + Intronic
1071819545 10:89265319-89265341 CCTGACCTGCCAACTCGGAAGGG + Intronic
1072526137 10:96273115-96273137 AGTGTCCTGGCCAAGCAGAAGGG - Intergenic
1074310466 10:112317987-112318009 CCTTCCCTGCCCGAGGAGAAGGG - Intergenic
1075285970 10:121186301-121186323 CATGACCTGTCCAAGCTGGAAGG + Intergenic
1075585152 10:123651986-123652008 GCTGACCTGCCCAGGAAGACAGG + Intergenic
1077288493 11:1778138-1778160 CCTGACTTCCCCACCCAGAAGGG + Intergenic
1077530692 11:3093465-3093487 CCTGACATGGCCAAGCAGGCAGG - Intronic
1080208423 11:29756877-29756899 CCTGCCCTGCCAACTCAGAAAGG + Intergenic
1080798575 11:35588622-35588644 CCTCTTCTCCCCAAGCAGAAAGG + Intergenic
1081890706 11:46539945-46539967 CCTCAGCTTCCCAAGCAGATGGG + Intronic
1082883081 11:58057536-58057558 CCTGAGCAGCCCATGAAGAATGG + Intronic
1084630007 11:70341853-70341875 CCTGACCTGGCCCATCAGCAGGG - Intronic
1084708416 11:70829409-70829431 CCTGGGCTGCCCAGGGAGAAGGG + Intronic
1086015897 11:82167148-82167170 CCAGTACTGCCCAAGCAGCAGGG + Intergenic
1091235538 11:134019912-134019934 CCTGACCCGACCAAGGGGAAGGG + Intergenic
1091833013 12:3563542-3563564 CCTGACCAGCCGCAGGAGAAGGG + Intronic
1094133046 12:27095286-27095308 CATGACCTGCACAGCCAGAATGG + Intergenic
1094182821 12:27610096-27610118 CATGACCTGCACAGCCAGAATGG + Intronic
1095491122 12:42734695-42734717 GCCGACTAGCCCAAGCAGAACGG - Intergenic
1096215699 12:49796524-49796546 CCTGAGCTTCCCCAGGAGAAGGG + Exonic
1096339447 12:50785169-50785191 CCTGAGCCTCCCAAGCAGAGGGG - Intronic
1098018649 12:66132666-66132688 CCTGATCTGCACAATCAGTAAGG + Intronic
1101553426 12:105784729-105784751 CCAGGCCTGTCCATGCAGAAGGG - Intergenic
1103552773 12:121748420-121748442 GCCTACCTGCCCAAGAAGAACGG + Exonic
1103881188 12:124167124-124167146 CCTGACCTGTCCAAACAGTAGGG - Intronic
1104616626 12:130275783-130275805 CATAACCTGCCCAAGAAGGATGG - Intergenic
1106317648 13:28609135-28609157 CCTCACCTGCCAAGGCCGAAAGG - Intergenic
1109396653 13:61766899-61766921 CCTGCCCTGCCAACTCAGAAGGG + Intergenic
1113266061 13:108619637-108619659 GCTAACCTGGCCAAGAAGAAAGG + Intronic
1113970568 13:114185473-114185495 CCTGACATGCCAACTCAGAAGGG - Intergenic
1114346845 14:21805520-21805542 CCTGAGCTTCCCAAGCAGCTGGG - Intergenic
1114719548 14:24866180-24866202 ACTGACCTCCCCAAGCAAGAAGG + Intronic
1116167161 14:41349381-41349403 CCTGCCCTGCCAACTCAGAATGG - Intergenic
1119200053 14:72745669-72745691 GCTGACCTTCCCAAGGAGAGGGG - Intronic
1122596558 14:102897495-102897517 CTTGACCTTTGCAAGCAGAAAGG + Intronic
1122889654 14:104726394-104726416 CCTGACCTTCCCTTGCAGAGCGG - Intronic
1122899114 14:104774839-104774861 CCTCACGTGCCCAAGAAGACAGG + Intronic
1124002176 15:25768657-25768679 CCTCACCTGCCCAAGTAGCTGGG + Intronic
1126670406 15:51110698-51110720 CCTGCCCTGCACAAGCAGTGGGG + Intergenic
1128715430 15:69904427-69904449 CCTAACCTCCGAAAGCAGAAGGG - Intergenic
1128978648 15:72170597-72170619 CCCGACCTGCCCAGGGAGAGAGG - Intronic
1129243091 15:74263218-74263240 CCTGAGCTCCCCCAGGAGAATGG - Intronic
1130161471 15:81405261-81405283 ACTGCCCTCCCCAAGCAGGAAGG + Intergenic
1132387668 15:101411788-101411810 CCTGACATGCCCCAGCAGTGAGG - Intronic
1132428515 15:101741587-101741609 CCTCAGCTGCCCAAGTAGATGGG - Intronic
1137044231 16:35641392-35641414 CCTGTCCTGGCCAAGCTGCAGGG + Intergenic
1139239419 16:65375600-65375622 CTCCACCTGCCCAAGCAGAGTGG + Intergenic
1139596703 16:67962319-67962341 CCTGACCTGGGAAAGCAGCAAGG - Intronic
1142024306 16:87804381-87804403 CCTGCCCCGCCCAACCTGAAGGG + Intergenic
1143099301 17:4496720-4496742 CCTGGGCTGCACAACCAGAAAGG + Intergenic
1144064289 17:11610877-11610899 CCTCAGCTGCTCAAGGAGAAGGG - Intronic
1144685587 17:17223958-17223980 CCGGACCTTCCCCAGCAGGAAGG + Exonic
1144963846 17:19063108-19063130 CCTCAGCTGCCCAAGTAGCAGGG - Intergenic
1144964451 17:19067323-19067345 CCTCAGCTGCCCAAGTAGCAGGG - Intergenic
1144971312 17:19111434-19111456 CCTCAGCTGCCCAAGTAGCAGGG + Intergenic
1144983516 17:19184851-19184873 CCTCAGCTGCCCAAGTAGCAGGG + Intergenic
1144984118 17:19189209-19189231 CCTCAGCTGCCCAAGTAGCAGGG - Intergenic
1144984709 17:19193388-19193410 CCTCAGCTGCCCAAGTAGCAGGG - Intergenic
1145081912 17:19901184-19901206 CCAGTCCTGCCCAAGCAGAGGGG + Intergenic
1147190046 17:38733219-38733241 CCTGCCCTGCCCCAGCAGGTGGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148544173 17:48504281-48504303 CCTAACCTGGCCAAGGTGAAAGG - Intergenic
1150476352 17:65478843-65478865 CCTGACCTGGCCATGGAGTAAGG + Intergenic
1150615463 17:66767484-66767506 CCTGTCCTGACCAAGTAGAAGGG - Intronic
1150746026 17:67817426-67817448 CCTCACCTTCCCAAGTAGCAGGG - Intergenic
1151702267 17:75749849-75749871 CCTGAGCTGCCAAGGGAGAAAGG + Intronic
1152039463 17:77893577-77893599 CATGGCCTGCCCCAGCAAAAGGG + Intergenic
1152041493 17:77906607-77906629 CCTGGTCTGCCCAAGGAGGAAGG + Intergenic
1152045070 17:77930135-77930157 CCTGCCATGGACAAGCAGAAAGG - Intergenic
1152351723 17:79787296-79787318 TCTGGCCTGCCCAGGCAGACAGG - Exonic
1152708650 17:81859249-81859271 TCTGACCTGGCCCAGCAGTACGG - Exonic
1153372732 18:4337391-4337413 CCAGACCAGCCTAAGCAGCATGG - Intronic
1153425658 18:4960567-4960589 CCTGTCCTGTTCAAGCAGAAAGG + Intergenic
1153837697 18:8978807-8978829 CCTGACCTGCCCAACCCCATGGG + Intergenic
1155213959 18:23626047-23626069 CCTGCCCTTGCCAAGCAGCAAGG + Intronic
1158641984 18:59211855-59211877 ACTGACCTGTCCAAGCAAGAAGG + Intergenic
1158684810 18:59603875-59603897 CCTGACCTCCTCAGGCCGAAAGG + Intronic
1159116827 18:64123970-64123992 CCTCACCTCCAAAAGCAGAAGGG - Intergenic
1160292732 18:77609174-77609196 CCTGCCCTGCCAACTCAGAAGGG - Intergenic
1160576245 18:79855608-79855630 TTTGACCTGGCCAAGCAGAGAGG + Intergenic
1162721183 19:12663896-12663918 CCTGCCCCTCCCAAGCAGAGGGG - Intronic
1163002604 19:14377970-14377992 CCTCAGCTGCCCAAGCAGCTGGG + Intergenic
1163529859 19:17842826-17842848 CCTGACCTCCCCCAGCTAAAAGG - Intronic
1164490938 19:28714019-28714041 GCTGTCCTGCCACAGCAGAAAGG + Intergenic
1164753808 19:30674895-30674917 CGTGACCTGTTCAAGCAGCAGGG - Intronic
1164879164 19:31716232-31716254 CCCGACCTCCCAAAGTAGAATGG - Intergenic
1166552664 19:43676725-43676747 CCTCAGCTGCCCAAGCAGGTGGG + Intergenic
1168001655 19:53451407-53451429 TCTGACCTGCCTAACCAAAAAGG - Intronic
1168121517 19:54254698-54254720 CCTGTCCTGTCCAAGCTCAAAGG - Intronic
1168267079 19:55228980-55229002 CCTAACCTCCCCAGGCAGATAGG - Exonic
925526238 2:4805411-4805433 CCTGACCAGTGCACGCAGAATGG - Intergenic
925659452 2:6186967-6186989 CCTGACCTGTGCAAGCACAAGGG + Intergenic
925857901 2:8148366-8148388 CCTGACTTACAGAAGCAGAAAGG + Intergenic
928071684 2:28223428-28223450 CCTGAGCTGCATCAGCAGAATGG + Intronic
928404036 2:31000635-31000657 ACTGACCTCCCCAAGCAAGAAGG - Intronic
928606571 2:32948703-32948725 CCAAAGCTGCCCAAGCAGAGGGG - Intronic
928903642 2:36348251-36348273 CCTGCCATCCCCCAGCAGAATGG + Intergenic
931755513 2:65370791-65370813 CCTGACCAGCCCATTCAGAAAGG + Intronic
931757993 2:65390970-65390992 CCTCACCTGCCCAAGTAGCTGGG - Intronic
934176813 2:89584398-89584420 CCTGGCCTCCCCAGGCAGAGAGG - Intergenic
934287120 2:91658758-91658780 CCTGGCCTCCCCAGGCAGAGAGG - Intergenic
935512166 2:103989575-103989597 CCTGGCCTTCCCAAGCAAGAGGG - Intergenic
937357117 2:121204872-121204894 CCTCAGCTGCCCAAGCAGCTGGG - Intergenic
940808993 2:158221655-158221677 CCTGACTTGCCCTAGCAACATGG + Intronic
943649262 2:190439157-190439179 GCTCATCTGCCCAAGCTGAAGGG - Intronic
946329916 2:219003129-219003151 CCTTACCTGGGCACGCAGAACGG + Exonic
948846486 2:240685183-240685205 CCTGAACTTCCCCAGCAGGAGGG + Intergenic
948847376 2:240689550-240689572 CCTGAACTTCCCCAGCAGGAGGG - Intergenic
948862814 2:240761079-240761101 CCTGACCTGGCCCCCCAGAAGGG - Intronic
1168796092 20:610806-610828 CCAGAACTGCTCAATCAGAATGG - Intergenic
1170988021 20:21275820-21275842 CCTCACCTTCCCAAGCAGCTGGG - Intergenic
1172488313 20:35313733-35313755 CCTCACCTTCCCAAGCAGGTGGG + Intronic
1173700561 20:45067296-45067318 TCTGACTCGCCCAACCAGAAGGG + Intronic
1174364354 20:50047439-50047461 TCTCACCTGCCCAAGCAAGATGG + Intergenic
1174667970 20:52278097-52278119 CCCCACCTGCCCAAGCAGATGGG + Intergenic
1175099571 20:56569265-56569287 CCTCAGCTGCCCAAGCAGCTGGG + Intergenic
1175263549 20:57689386-57689408 CCTGGCCTTCCCAGGCAGAAAGG + Intronic
1175930784 20:62492877-62492899 ACTGTCCTGCCCAAACAGGAGGG - Intergenic
1177456232 21:21343610-21343632 CCTGACCTGTTAGAGCAGAAAGG + Intronic
1178513539 21:33227555-33227577 CCTAAACTGACCTAGCAGAAGGG - Intergenic
1178724896 21:35042647-35042669 TCTGATCTGTCCAGGCAGAAAGG - Intronic
1179507649 21:41852473-41852495 CCTGGCCTGGCCCAGCACAAGGG - Intronic
1179525640 21:41974261-41974283 CCTGACCTGCCCCAGGGGACCGG - Intergenic
1180061339 21:45386515-45386537 CCTGGCCAGCCCAGGCAGACAGG + Intergenic
1181053129 22:20247018-20247040 CATGTCCTGCCCAAGCAGGAAGG + Intronic
1183537853 22:38413524-38413546 CCTTACCTGGCCCAGCAGAGCGG + Intergenic
1183710124 22:39498431-39498453 CCTGATATCCCCAGGCAGAAGGG - Intergenic
1184245424 22:43233416-43233438 CCTGACTTGCAGAAGCAAAAAGG + Intronic
1184288280 22:43484163-43484185 CCTCACCTGCCCAAACAAACTGG - Intronic
1184942324 22:47778107-47778129 CAGGAGCTTCCCAAGCAGAAGGG - Intergenic
1185370194 22:50457285-50457307 CCTGCCCTGCCCTGGCAGAGAGG - Intronic
950602944 3:14051110-14051132 CCAGACCAGCCCAAGCAACATGG - Intronic
953159452 3:40404803-40404825 CCTGTCTTGGCCAAACAGAAGGG + Intronic
953318433 3:41950200-41950222 CCTCACCTTCCCAAGCAGCTGGG + Intronic
954067534 3:48118735-48118757 CCTCACCCGCCCAAGCAGCTGGG - Intergenic
954363672 3:50135263-50135285 TCTGTCCTGCCCCAGCAGAGGGG - Intergenic
954373944 3:50184543-50184565 CCTGCCCTGCCCAGGCAGCCTGG + Intronic
956254982 3:67273810-67273832 CCTGACCTGCCCACCTTGAAAGG - Intergenic
964927382 3:161975442-161975464 CCTGCCCTGCCAACTCAGAAGGG + Intergenic
965260508 3:166478077-166478099 TATGACCTGCCCAAGCACAAGGG + Intergenic
965350793 3:167609431-167609453 GCTGTCCTGGCAAAGCAGAAAGG + Intronic
967197299 3:187039516-187039538 ACTGACCTTCAGAAGCAGAAAGG + Intronic
968283803 3:197496480-197496502 CAAGTACTGCCCAAGCAGAAGGG + Intergenic
968914611 4:3491989-3492011 CCTGCCCTGCCCCAGGAGGAGGG + Intronic
969259560 4:6024824-6024846 CCTGGCCAGCCCAAGCCGTAAGG - Intergenic
969354306 4:6616314-6616336 CCTGATCTTCCCACTCAGAAAGG - Intronic
970959516 4:21856517-21856539 CCTGCCCTGCCAACTCAGAAGGG - Intronic
972226936 4:37024307-37024329 CATGATTTACCCAAGCAGAATGG + Intergenic
977833740 4:101622864-101622886 CCACACCTGTCCAAGAAGAATGG + Intronic
978498341 4:109384044-109384066 CCTGCCCTGCCAACACAGAAGGG - Intergenic
978903041 4:113975866-113975888 CCGGACCTACCAAAGCTGAAGGG + Intronic
979186770 4:117806253-117806275 CGTGACCAGGCCAAGCAGGATGG + Intergenic
982706338 4:158713929-158713951 CCTCACCTTCCCAAGTAGCAGGG - Intronic
983636850 4:169906287-169906309 CCTCTGTTGCCCAAGCAGAAGGG - Intergenic
988487549 5:31679108-31679130 ACTGAACTGACCAAGGAGAAAGG + Intronic
990574175 5:57108806-57108828 CCTCAGCTTCCCAAGTAGAAGGG - Intergenic
994318492 5:98361377-98361399 CCTGTCCTCACCAAGCAGAGGGG + Intergenic
994343466 5:98659544-98659566 CCTGACCTGCTCAAGTAGGGAGG + Intergenic
1000185849 5:158857173-158857195 ACTGAGTTGGCCAAGCAGAAGGG - Intronic
1001141538 5:169148006-169148028 CCTGACCTGCAAAAACAGACAGG - Intronic
1002001543 5:176199125-176199147 GCTGCCCAGCGCAAGCAGAAAGG + Intergenic
1002252797 5:177939854-177939876 GCTGCCCAGCGCAAGCAGAAAGG - Intergenic
1002601883 5:180358467-180358489 CCTTTCCTGGCCAAGCAGAGTGG - Intergenic
1002763612 6:220056-220078 TCTGTCCTGCCCACACAGAATGG + Intergenic
1003425010 6:5993111-5993133 CCTGACCTTCCAGAGCAGCAAGG + Intergenic
1003718941 6:8678623-8678645 ACTGACCTGCCCTAGCAAAGAGG - Intergenic
1005339579 6:24830829-24830851 CCTGAGCTTCCCAAGTAGCAGGG + Intronic
1007574222 6:42914636-42914658 CCTCACCTTCCCAAGCAGCTGGG - Intergenic
1007875032 6:45088285-45088307 CATGACATGCTAAAGCAGAAGGG + Intronic
1010393920 6:75368927-75368949 CCTGGCCTGCCCCAACAGACTGG - Intronic
1012896033 6:104950615-104950637 CCTGTCTTGCCAAAGTAGAAAGG - Intergenic
1016521963 6:144955533-144955555 CCTGACCTGAGCCTGCAGAAAGG - Intergenic
1017831813 6:158137469-158137491 TGTGATCTGCCCAAGCAGAATGG + Intronic
1018673132 6:166195868-166195890 CCTGGCCTGGCCCAGCAGTAAGG + Intergenic
1018895523 6:168013732-168013754 TCAGATCTGCCCAGGCAGAAGGG - Intronic
1019537473 7:1536880-1536902 CGTGACCTGCCCAAGGAGGTGGG + Intronic
1019768780 7:2870472-2870494 CCTGTCCTGCTCAGGCAGAGAGG - Intergenic
1023743587 7:43302320-43302342 CCTGCCCTGACCACGCAGCAGGG - Intronic
1026359704 7:69591843-69591865 CCTGCCCTGCCAACTCAGAAGGG + Intergenic
1026787971 7:73313587-73313609 CCTGAACTCCCCAAGGAGAGGGG + Intronic
1027717639 7:81693034-81693056 CCTCAGCTTCCCAAGCAGATGGG - Intergenic
1027762181 7:82293415-82293437 GCAAACCTGCCCATGCAGAATGG - Intronic
1028290952 7:89064646-89064668 CATGACATGCCCCACCAGAAGGG - Intronic
1030777534 7:113552782-113552804 CCTGGCCTGACGAAGCAGGATGG - Intergenic
1031006419 7:116477853-116477875 CCTCAGCTGCCCAAGTAGATGGG + Intronic
1031220193 7:118955893-118955915 CCTCAGCTGCCCAAGCAGCTGGG - Intergenic
1031862479 7:126996177-126996199 CCAGACCTGCCCTAAAAGAAAGG + Intronic
1032669971 7:134073817-134073839 CCTGACCTGCTTCAGCAGCAGGG - Intergenic
1033655082 7:143367803-143367825 GTTGACCTGCCCATGCAGGAGGG - Intergenic
1033734925 7:144212753-144212775 CCTGACTTCTCCAAGTAGAATGG + Intergenic
1033748131 7:144338216-144338238 CCTGACTTCTCCAAGTAGAATGG - Intergenic
1033928078 7:146488742-146488764 CCTCACCTGCCCAAGTAGCTGGG + Intronic
1036153128 8:6316960-6316982 CTGGCCCTCCCCAAGCAGAAAGG + Intergenic
1037400783 8:18493504-18493526 CCTCACCTTCCCAAGTAGATGGG + Intergenic
1037818157 8:22122677-22122699 CTTGGCCTTGCCAAGCAGAAGGG + Intronic
1037828203 8:22172457-22172479 CTTAGGCTGCCCAAGCAGAAAGG - Intronic
1038332708 8:26621789-26621811 CCTGACCTGCTCACCCACAATGG - Intronic
1039292487 8:36111481-36111503 CTTGATCTGCATAAGCAGAAGGG - Intergenic
1044433870 8:92139553-92139575 CCTTACTTCCCCAAGTAGAACGG - Intergenic
1045760645 8:105602471-105602493 CCTGACCTTCTCTAGAAGAAAGG + Intronic
1046731080 8:117727120-117727142 TCTGACCTGCTGAATCAGAAGGG - Intergenic
1047953251 8:129953240-129953262 CCTGACCTTCCCAAGCTGGAAGG - Intronic
1050004254 9:1113064-1113086 ACTTCCCTGACCAAGCAGAAAGG + Intergenic
1050476504 9:6046300-6046322 CCTGGTCTGCCCAAGAAGCAGGG + Intergenic
1051359315 9:16267917-16267939 TATGAGCTACCCAAGCAGAAAGG + Intronic
1051869558 9:21721576-21721598 CCTGAGCTAGCCAAGCAGGACGG + Intergenic
1052876378 9:33569741-33569763 CCACACCTGGCCAAGCACAAAGG - Intronic
1053459770 9:38259178-38259200 CCTGGCCTGCCCAAGCTCATAGG + Intergenic
1057312186 9:93949469-93949491 CCTGAGCTGCCCAAACACAATGG + Intergenic
1057973919 9:99583710-99583732 AGTGACCTGCCCAAGCCCAAAGG + Intergenic
1059107964 9:111527700-111527722 CCTGATCTCCCCAGGCAAAATGG - Exonic
1186969940 X:14830982-14831004 CCTGACCTGGCAAAACAAAAAGG + Intergenic
1196238655 X:113313228-113313250 CCTGGCCTCCCCAAGCAAAAGGG + Intergenic
1197896307 X:131319202-131319224 CCTGAACCACCCAAGCAGAAGGG - Intronic
1199859879 X:151791903-151791925 GCTGACCTACCCAGACAGAATGG + Intergenic