ID: 920198804

View in Genome Browser
Species Human (GRCh38)
Location 1:204246646-204246668
Sequence CTGGGTGAAGAAAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 534}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920198804 Original CRISPR CTGGGTGAAGAAAAGGCAGA GGG Intronic
901962797 1:12840790-12840812 CAGGATGGAGAAAAGACAGAAGG - Intergenic
901989988 1:13105093-13105115 CAGGATGGAGAAAAGACAGAAGG - Intergenic
902778919 1:18692192-18692214 AGGGGGGAAGAAAAGGAAGAAGG + Intronic
903552320 1:24166514-24166536 AAGGCAGAAGAAAAGGCAGATGG - Intronic
903706855 1:25292315-25292337 CTGGGTTCAGAAAAGACTGAAGG + Intronic
903720379 1:25401027-25401049 CTGGGTTCAGAAAAGACTGAAGG - Intronic
904292282 1:29495692-29495714 CTTGATGAAGAAAGGGTAGAGGG + Intergenic
905089440 1:35416878-35416900 CTGGGGGAGGGAAAGGCAGGTGG + Intronic
905371399 1:37484420-37484442 CTGGGTGAGGAAAGGCCAGCAGG + Intergenic
905554331 1:38870412-38870434 CTTGGGGAAGCTAAGGCAGAAGG + Intronic
905807591 1:40888081-40888103 CTGCGTGAAGAATAGGTCGAAGG - Intergenic
907062979 1:51449927-51449949 CAGGGTGTGGAAAAGGCATAAGG + Intronic
907072704 1:51551368-51551390 ACGGATGAAGAAAAGGAAGATGG - Intergenic
907337027 1:53706522-53706544 CTGGTTGCAGAAAATGCTGAAGG - Intronic
907999972 1:59670222-59670244 CTGGGTGAAGGAGAGGAAGAGGG - Intronic
908020649 1:59894511-59894533 GTGGGTGAACTGAAGGCAGAAGG + Intronic
908166150 1:61461512-61461534 TTTGGGGAATAAAAGGCAGATGG - Intronic
909662543 1:78100005-78100027 CTGGGCAATGAAGAGGCAGAGGG + Intronic
910291542 1:85604629-85604651 CTGAGTGATGAAAAGCCACAAGG - Intergenic
910548845 1:88453337-88453359 GTGGGAGAAATAAAGGCAGATGG - Intergenic
910663258 1:89696446-89696468 CTGAGTAAAGAACAGACAGAGGG + Intronic
911335251 1:96573832-96573854 CTGGGTGAAGAACGGGGACAGGG - Intergenic
912518132 1:110228510-110228532 CTTGGTGAAGAAAAGGCACATGG - Intronic
912871526 1:113311237-113311259 CTGCTTGAAAAAAAGGCAGAGGG + Intergenic
913327879 1:117643351-117643373 ATGGAAGAAGAAATGGCAGACGG - Intergenic
913680568 1:121185138-121185160 CGGGAGGAAGAAAAGGAAGAGGG - Intronic
914032399 1:143972780-143972802 CGGGAGGAAGAAAAGGAAGAGGG - Intergenic
914157046 1:145095187-145095209 CGGGAGGAAGAAAAGGAAGAGGG + Intronic
914679847 1:149931427-149931449 CTGGGTGATAAAGAGGAAGAAGG + Intronic
914889685 1:151612033-151612055 CGGGGTGAAGAGGAGGCAGGGGG - Intergenic
915853406 1:159352724-159352746 CTGGCTGAAGATAAGCCACATGG + Intergenic
915949847 1:160181877-160181899 GAGGGAGAAGAAAAGGCAGGGGG - Intronic
916618186 1:166467035-166467057 CTGTGTGAAGAATAGACTGAAGG + Intergenic
917500667 1:175582355-175582377 CTGTGGCAAGAAAAGGCTGAAGG + Intronic
918252443 1:182715441-182715463 CTGGGTGAAGCATAGACACAGGG - Intergenic
919509646 1:198446193-198446215 CTGAGCAAAAAAAAGGCAGATGG - Intergenic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
919914776 1:202132630-202132652 CAGGGTGAAGGAGAGGCCGAGGG + Exonic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920364026 1:205438680-205438702 CTGGGTGAAGAAGGGGCTGCCGG + Intronic
920467877 1:206203664-206203686 CGGGAGGAAGAAAAGGAAGAGGG - Intronic
920884250 1:209911161-209911183 ATGGGTGAATAGAAGGCTGAGGG + Intergenic
921915992 1:220611145-220611167 ATGGTTGAACAAAAGGCAGCAGG - Intronic
921941462 1:220844307-220844329 CTGTGCGAAGAAAAGCCAGCAGG + Intergenic
922301430 1:224304625-224304647 CTGGGTGTAGAAAAGGAAACTGG - Intronic
923357634 1:233176352-233176374 ACGGGAGAAGAAAAGGAAGAAGG - Intronic
924011733 1:239672411-239672433 CTAGGTCAAGAAAATGCAAATGG + Intronic
1062906552 10:1183467-1183489 GTGGGAGAAAGAAAGGCAGAAGG - Intronic
1063885259 10:10571083-10571105 ATGGCTGATGAAAAGGCCGACGG - Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1067407438 10:46036095-46036117 TTGGGTGAGGAAAAGGGAGTGGG - Intronic
1067660362 10:48232847-48232869 GTGGGAGATGAAGAGGCAGAAGG - Intronic
1068226671 10:54115278-54115300 CTGGGTAGGGAAAATGCAGAAGG + Intronic
1068573877 10:58661389-58661411 CTGGAAGGAGAAAAGGTAGAGGG + Intronic
1069847339 10:71381570-71381592 ATGGATGGAGAAAAGGCAAAGGG + Intergenic
1070034638 10:72710458-72710480 CTAGTGGAAGAAAAGGCAGAAGG + Intronic
1070341068 10:75498937-75498959 GTGGGTGGAGAAAAAGCAGGTGG + Intronic
1070379722 10:75869777-75869799 CTGGATCAAGAAGAGGCAGATGG - Intronic
1070739208 10:78891629-78891651 CTGGGTGATGAAGAGGCATTTGG - Intergenic
1071377495 10:85023759-85023781 CTGGATGAAGAACATGCATAGGG - Intergenic
1071627212 10:87184595-87184617 ATGGGTGAAGCAAAGGCAAAGGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072753789 10:98003552-98003574 GTGGGAGAAGAGGAGGCAGAAGG - Intronic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1073164589 10:101434101-101434123 CTGGATTAAGAAAAGACAGCTGG + Intronic
1073177079 10:101563223-101563245 CTGGAAGTAGAAAGGGCAGAGGG - Intergenic
1073732240 10:106303013-106303035 GTGGGTGAACAAAAGACACAGGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1076088335 10:127656253-127656275 CTGGGTGATTAAAATGAAGAAGG - Intergenic
1076151185 10:128163169-128163191 CTGTGGGAATAAAAGGCGGACGG - Intergenic
1076444974 10:130508048-130508070 AAGGGTGCAGAAAAGACAGATGG - Intergenic
1077898900 11:6474245-6474267 CTCCGTCAAGAAAAGGCAGCTGG + Exonic
1078619096 11:12891420-12891442 ATGGCTGAGGAAATGGCAGAGGG + Intronic
1078648478 11:13164765-13164787 GTGGGTGAAGAAGAGCAAGAGGG - Intergenic
1078687669 11:13548447-13548469 CTGGTTGTAGCTAAGGCAGATGG + Intergenic
1079504303 11:21136249-21136271 ATGTGTGAGGAAAAGACAGAAGG + Intronic
1080150046 11:29041563-29041585 ATGGGTGATGACAAGTCAGATGG - Intergenic
1080571921 11:33564640-33564662 GTGGGAGAAATAAAGGCAGATGG - Intronic
1081682699 11:45019371-45019393 CTGGGAGAGGAAAGGGCAGTCGG + Intergenic
1082829110 11:57602239-57602261 CTGGGGAAAGAAAGGACAGAGGG + Intronic
1083327792 11:61881958-61881980 CTGGTAGAAAAAAGGGCAGAGGG + Intronic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084582555 11:70032971-70032993 CTGGGTGAGGACCAGGCACACGG + Intergenic
1084783312 11:71425686-71425708 CTGGGTGCAGAAGAAGCTGATGG - Intergenic
1086072669 11:82816322-82816344 CTCGTTGAAGATAAAGCAGATGG + Intergenic
1086335802 11:85799656-85799678 CTGGGTGAATAAGAATCAGAAGG - Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086869041 11:92015107-92015129 ATAGGTGAACAAAAGGCAGCAGG - Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087586934 11:100133637-100133659 ATGAGTGAAGAAGAGGCATATGG - Intronic
1087917050 11:103823171-103823193 CTGGGAGTAGAGAAGGTAGAAGG + Intergenic
1088044297 11:105428840-105428862 CTGAGTGAAGAAGGGGCAGATGG - Intergenic
1088143465 11:106646979-106647001 GTATGTGAAGAAAAGGCAAAGGG - Intergenic
1088415731 11:109586905-109586927 CTGGGAGAAGCAAAGGAAAAAGG - Intergenic
1089058439 11:115606783-115606805 GGAGGTGAAGAAGAGGCAGAGGG + Intergenic
1089972038 11:122701781-122701803 CAGAGTTCAGAAAAGGCAGATGG - Intronic
1090219447 11:125005335-125005357 CTGGGTGAAGTATTGGAAGATGG + Intronic
1090518123 11:127450325-127450347 ATGGGAGGAGAAAAGGGAGAAGG - Intergenic
1090626069 11:128610010-128610032 ATAGGTAAAAAAAAGGCAGAGGG + Intergenic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1091050007 11:132358841-132358863 ATGGGTGAAGAGAAGAGAGAGGG - Intergenic
1091204556 11:133810890-133810912 CTGGGAGTAGGAGAGGCAGAAGG + Intergenic
1091262049 11:134242367-134242389 ACAGGTGAAGAAAAGGCAGTTGG - Intronic
1092020089 12:5194590-5194612 GTGGGTGCTGAAAAGGGAGATGG - Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1095907394 12:47392006-47392028 CTGGGAGATGGAAAGGGAGAAGG - Intergenic
1096011197 12:48216916-48216938 CTTGCTGAAGAAAAGGGAAATGG + Intergenic
1097087367 12:56478273-56478295 GTGGGTAGAGAAAAGGGAGATGG + Exonic
1098594334 12:72254575-72254597 CTGAGTGAAGATGAGGAAGAAGG - Intronic
1100466191 12:94848042-94848064 CAATGTGAAGCAAAGGCAGAAGG - Intergenic
1100840999 12:98611706-98611728 CTGGATAGAAAAAAGGCAGAAGG + Intergenic
1101192071 12:102344690-102344712 CTGGGGTAAGAAAAGGGAAAGGG - Intergenic
1101700212 12:107166857-107166879 CTGGGTGCAGAATAGGCATGAGG - Intergenic
1102409424 12:112704422-112704444 CTGGGTGATGGAGAGACAGAGGG + Intronic
1102793713 12:115670567-115670589 CTGAGGGAGGAAGAGGCAGAGGG - Intergenic
1103242483 12:119425928-119425950 CTGAGTGAAGGAAAGGCAAAGGG + Intronic
1104326731 12:127805786-127805808 CTGGCTGAAGAAAGAGCAGATGG - Intergenic
1104575941 12:129965896-129965918 TTGGGGGAAGAAAAGGAAGCTGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105203559 13:18200271-18200293 CTCAGTGAAGAAAGGGCAAAGGG - Intergenic
1105273967 13:18904132-18904154 GTGGGGAAAGAAAAGACAGACGG - Intergenic
1105795560 13:23848857-23848879 CTTCCTGAAGAAAAGCCAGAAGG + Intronic
1105925710 13:25005916-25005938 CTAGGTGAAGAAGAGGGAGAGGG - Intergenic
1106014634 13:25857118-25857140 CTGGGAGAAGGAAAAGGAGAAGG - Intronic
1106038989 13:26071699-26071721 CTAGGTGAAGAAGAGGGAGAGGG + Intergenic
1107014003 13:35694740-35694762 GTGGGTGATGCAGAGGCAGAGGG + Intergenic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1107864812 13:44693334-44693356 CTAGGAGAGGAAAAGGCAGTGGG - Intergenic
1108561231 13:51646220-51646242 CTGGACAAAGAACAGGCAGAAGG - Intronic
1108987319 13:56609213-56609235 CTGGTGGAAGAAAAGACACATGG - Intergenic
1109093447 13:58078986-58079008 ATGGGGGAAGAAAAGGGAAAAGG + Intergenic
1110095994 13:71521666-71521688 CTGGGTGAAGAAAAGACATGAGG - Intronic
1110436849 13:75485185-75485207 CAGTGGGAAGAAAAGGCAGTTGG - Intergenic
1111077467 13:83256293-83256315 CTGGTAGAAGGAAATGCAGATGG + Intergenic
1111194699 13:84858604-84858626 CTTTGTGAAGCCAAGGCAGATGG - Intergenic
1111987279 13:95077978-95078000 CTGGGTTGGGGAAAGGCAGATGG + Intronic
1112594481 13:100795464-100795486 CAGGGTCAAGACAAAGCAGAGGG - Intergenic
1112759435 13:102677377-102677399 CTGTGTGGAGAACAGGCAGCGGG - Intronic
1113106510 13:106777516-106777538 CTGGAGGAAGAAGAGGGAGAAGG - Intergenic
1113402172 13:110004349-110004371 GTGGGTGAACAAAATGCTGAAGG + Intergenic
1113473915 13:110566349-110566371 CTAGATGAAGAAAAGGGAGGAGG + Intergenic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115808823 14:37082656-37082678 ATGGGTGGGGAAAAGGAAGAAGG - Intronic
1115914600 14:38297870-38297892 CTGGCTGGAGAAAAGCCAAATGG - Intergenic
1115929384 14:38473748-38473770 CTGTGGGAAGCCAAGGCAGAAGG + Intergenic
1116181886 14:41544879-41544901 CTGGGTGTAGAAAAGAAACAGGG - Intergenic
1116410711 14:44619784-44619806 CTGGTTGAAATAAAGGCAGAGGG - Intergenic
1117422150 14:55557442-55557464 CTGGGTGATGAATAGCCAGAAGG + Intergenic
1118143886 14:63115321-63115343 CTGGCTAAAAAAGAGGCAGAAGG - Intergenic
1118451001 14:65902044-65902066 CTTGGTGAGGAGGAGGCAGAGGG + Intergenic
1120768619 14:88354926-88354948 ATGGGTGAAGGAAGGGTAGATGG - Intergenic
1121255966 14:92530747-92530769 GTGGATGTAGAAAAGGCAGTAGG - Intronic
1121627544 14:95397373-95397395 CTGGGTAAAGAAAAGAGAAAGGG - Intergenic
1122093589 14:99355266-99355288 CTGGGTGAAGTAACTGCTGAAGG - Intergenic
1122755246 14:103973536-103973558 CTGTTTGGAGAAGAGGCAGAGGG + Intronic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1122968856 14:105144315-105144337 CTGGGTGATGGAAGGGCAGTAGG - Intronic
1123776256 15:23583661-23583683 CTGCGTGAAGGAGAGACAGAAGG + Intronic
1124126010 15:26938661-26938683 ATGGGCAAAGAAGAGGCAGAGGG - Intronic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1125960721 15:43827300-43827322 GTGGCAGAAGAAAACGCAGAAGG - Intronic
1125969333 15:43899342-43899364 CTGGGTGAGGAAGAGGCACAGGG + Intronic
1126049272 15:44672062-44672084 CTGGGTGATAAAAGTGCAGATGG - Exonic
1126446142 15:48746992-48747014 CTGGGGGAAGACAAGGTTGAAGG + Intronic
1126644029 15:50856998-50857020 CTGGGGAAAGAAAGAGCAGAGGG + Intergenic
1127586079 15:60379347-60379369 CTGGGGGAAAAAAAAGGAGATGG + Intronic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128182201 15:65613829-65613851 GTAAGTGAAGAAAAGGCTGAGGG + Intronic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1128745574 15:70111812-70111834 CTGCGTGGGGGAAAGGCAGATGG - Intergenic
1128941370 15:71790482-71790504 CTGGATGAAGAACAGGCAAGAGG + Intergenic
1129067587 15:72919625-72919647 ATGGGAGAAGAAAAGGAATAGGG - Intergenic
1130035902 15:80361256-80361278 CTGGGTCAGGAAAAGGGATAGGG + Intronic
1131307154 15:91255078-91255100 AGTGGTGAAGAAAAGGCAGGAGG + Intronic
1131348989 15:91679359-91679381 CTGGATGAAGATAAGGCAAATGG - Intergenic
1132117972 15:99151387-99151409 CTGAGAAAAGAAAAGGCACAGGG + Intronic
1132296583 15:100739243-100739265 CTAGGTTAATAAAAGACAGATGG + Intergenic
1132513124 16:353661-353683 CTGGGAGAAATCAAGGCAGAGGG - Intergenic
1133226873 16:4344957-4344979 CTGGCAGGAGAGAAGGCAGAAGG + Intronic
1133489396 16:6252217-6252239 TTGAGAGAAGAAATGGCAGAAGG - Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134257970 16:12626973-12626995 CTGGGTGAAGCTAACGCAGGTGG - Intergenic
1134504054 16:14791048-14791070 CTGGGTGAAGAACAGGTGGGTGG - Intronic
1134576518 16:15337860-15337882 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1134725925 16:16418639-16418661 CTGGGTGAAGAACAGGTGGGTGG - Intergenic
1134778826 16:16876856-16876878 CTGGGGGAAGAAGAGAAAGATGG - Intergenic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1134941509 16:18293220-18293242 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1137008969 16:35304841-35304863 CTGTGTGCAGAACAGGCTGAAGG + Intergenic
1137587741 16:49674089-49674111 CTGAGTGAAAAATAGGCAGGTGG + Intronic
1137728781 16:50674621-50674643 CTGGGAGGAGAAAGGGCAGAGGG + Intronic
1138142468 16:54580606-54580628 CTGGGATAAGAAAAGGCCCAGGG + Intergenic
1138863245 16:60785399-60785421 TTGTGTGTAAAAAAGGCAGAGGG - Intergenic
1139144808 16:64310338-64310360 AGGGGTGAGGAAAAGGGAGAGGG + Intergenic
1139264050 16:65622972-65622994 CTGGGTCAATGAAAGGCAGGAGG + Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1141268795 16:82520663-82520685 CTGGATTAAGAATAGGCAGGAGG - Intergenic
1141572900 16:84945011-84945033 CTGGGTGGAGAACAGGGAGCAGG + Intergenic
1141606774 16:85158541-85158563 CTGGGTGGAGAACAGACGGACGG + Intergenic
1141799710 16:86298490-86298512 CCTGGTGAGGAAAGGGCAGATGG - Intergenic
1142024494 16:87805139-87805161 CTGGGTGAGCCACAGGCAGATGG - Intergenic
1142781252 17:2182858-2182880 GTAGGGGAAGAAAAGGAAGAGGG + Intronic
1142908484 17:3066089-3066111 CTTTGGGAAGACAAGGCAGAAGG - Intergenic
1142926081 17:3238155-3238177 CTTTGGGAAGACAAGGCAGAAGG + Intergenic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144232346 17:13220700-13220722 CAGGGTGAAGGCAAGGTAGATGG + Intergenic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1144785932 17:17831577-17831599 ATGAGTGCAGAAGAGGCAGACGG - Intronic
1145228694 17:21153729-21153751 ATGGGTGAAAAAAAGGGGGAAGG + Intronic
1146483422 17:33223908-33223930 CTGGGAGAAGATAAGTCAAAGGG + Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1147879252 17:43643385-43643407 CTGGAGGAAGAAAAAGGAGAAGG + Intronic
1148496791 17:48057749-48057771 CTGCCTGAAGGAAAGGAAGAAGG - Intronic
1148906091 17:50913176-50913198 CTGGGTCAGGGAAAGGCAAAGGG - Intergenic
1149278319 17:55071092-55071114 CAGGGAGAAGAAAAAGGAGATGG - Intronic
1149485188 17:57037013-57037035 CTGGGTGGAGAAAAGGAGGCTGG + Intergenic
1149689853 17:58566492-58566514 CTGGTTTATGAAAAGACAGAAGG + Intronic
1150213042 17:63452059-63452081 CAGCATGAAGAAGAGGCAGAAGG + Intergenic
1150354678 17:64473011-64473033 CTGAGAGTAGAAGAGGCAGAAGG - Intergenic
1151372350 17:73656260-73656282 ATGGGTGGAAGAAAGGCAGAGGG - Intergenic
1151472724 17:74327914-74327936 CTGGCTGGAGGACAGGCAGATGG + Intronic
1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG + Intergenic
1152383165 17:79952653-79952675 CTACCTGAAGAAAAGGCGGAGGG + Exonic
1155077213 18:22369450-22369472 CTGTGGGAAGCTAAGGCAGAAGG + Intergenic
1155420110 18:25646654-25646676 TTGGAAGAAGAAAAGGAAGAAGG + Intergenic
1155643618 18:28050362-28050384 GTGGGTGTAGAAGAGTCAGAAGG - Intronic
1155737505 18:29242273-29242295 CTGGGTGAGTAAAGGTCAGAGGG + Intergenic
1156269298 18:35516292-35516314 CTGGCTGATCTAAAGGCAGAGGG - Intergenic
1157110625 18:44816853-44816875 CTGGGTCAGGAAAAGGCAAGAGG - Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157810977 18:50695602-50695624 CAGGGTGATGACAAGACAGAAGG + Intronic
1158391051 18:57045162-57045184 ATGGGTGGAGGGAAGGCAGATGG + Intergenic
1158595175 18:58809563-58809585 TTGGGTAAAGAAAAGATAGAAGG + Intergenic
1158911760 18:62070655-62070677 TTTGGAGAAGAAAAGGCAAAAGG + Intronic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159790317 18:72771170-72771192 TTATGTGAACAAAAGGCAGATGG + Intronic
1161382191 19:3971218-3971240 GTGGGTGCCGAAAAGGCAGCTGG - Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161672280 19:5620716-5620738 TTGGGTGATGAAAATCCAGAAGG + Intronic
1161935424 19:7368893-7368915 CCTGGTGATCAAAAGGCAGAGGG + Intronic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1164508379 19:28877849-28877871 AGAGGTGAAGAAAAGGCTGAAGG - Intergenic
1164526636 19:29017886-29017908 CTGGGGGAAGAAAAGGGAAGAGG + Intergenic
1164544104 19:29144839-29144861 CTGGGTGTATTAAAGGGAGAAGG - Intergenic
1164670019 19:30067141-30067163 CTGTGTGAAGCAAAGGGGGATGG + Intergenic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165356113 19:35305158-35305180 CTGGGTGAAGAGTAGGGAGCTGG - Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166329400 19:42069676-42069698 CTGGGTGGAGAAAAGGAAGCCGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166887118 19:45968491-45968513 CTAAGTGAAAGAAAGGCAGATGG + Intronic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167953432 19:53045813-53045835 CTGAGTGAAGCAAACGCAGCAGG - Intronic
1168348460 19:55662184-55662206 ATTGTTCAAGAAAAGGCAGAGGG - Intronic
1168414700 19:56160631-56160653 CTTGGTGAAGCAGAGGCTGAAGG + Exonic
925060657 2:887549-887571 TTGGGTCAAGACAAGGAAGAGGG - Intergenic
925607519 2:5673646-5673668 CTGGCAGAAGGAAAGCCAGACGG + Intergenic
926045934 2:9709674-9709696 CTGGGTGAAGGAAAGAGGGAAGG - Intergenic
927025733 2:19067241-19067263 GTGGGAGAAGAAAAAGCACAAGG - Intergenic
927259253 2:21070288-21070310 CTTGGGGAAGAAAAGTCAGGTGG + Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927484408 2:23478909-23478931 CTGGGGGAAGTAAAGGCGGGGGG - Intronic
928019970 2:27696632-27696654 CTGGCTGAAGTGAAGGCAAAGGG + Intergenic
929018535 2:37526687-37526709 CTGGGAGATGAACAGGGAGACGG + Intergenic
929655161 2:43723625-43723647 CTTTGGGAAGAAAACGCAGAGGG + Intronic
929865345 2:45712683-45712705 CTGGATGGAAAAAAGGCAAAAGG - Intronic
931207096 2:60158347-60158369 CCAGTTGAAGAAAAGGCACAAGG + Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932056270 2:68447368-68447390 CTGGTTGAAGGGAAGCCAGACGG - Intergenic
932141241 2:69280214-69280236 TTTGGGGAAGATAAGGCAGAGGG + Intergenic
932567525 2:72918845-72918867 CTGGGGGAAGCAAGGGCAGCAGG + Intronic
933030069 2:77317578-77317600 CTTCATGAAGAAAAGGCACATGG - Intronic
933417391 2:82003708-82003730 CAGTGTTAAGTAAAGGCAGATGG + Intergenic
933872085 2:86576565-86576587 CTGGAAGAAGAAAAGAAAGAGGG + Intronic
934090052 2:88543342-88543364 CTGGATTGAGAAAAGACAGAGGG + Intergenic
934544172 2:95200900-95200922 CAGGCTGAGGAAGAGGCAGAGGG + Intergenic
934904316 2:98185686-98185708 CTGGGAGAAATAAAGGTAGATGG - Intronic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937615766 2:123920608-123920630 CTGGGTAAAAACATGGCAGAAGG + Intergenic
937657649 2:124394775-124394797 AAGGGTGAAGGAAAAGCAGATGG - Intronic
937973721 2:127568391-127568413 CTGGGGGAGGAAAGGGCAGGAGG - Intronic
938087073 2:128408703-128408725 CTGGGTGGAGCAGAGGCAGATGG + Intergenic
938705432 2:133920523-133920545 CTGGGGAAAGAAAAGGGATATGG + Intergenic
938946458 2:136216736-136216758 CTGGATGTTGGAAAGGCAGAAGG - Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939271073 2:139940415-139940437 CTGGGTGCTCACAAGGCAGATGG + Intergenic
940597715 2:155816025-155816047 CTGGTTATAGCAAAGGCAGATGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941712654 2:168730430-168730452 CTGAGTGAAGCAAAGAGAGAGGG + Intronic
941891652 2:170588432-170588454 CTGGCTCAAAAAAAGGGAGAGGG + Intronic
942300559 2:174557242-174557264 CTGGGGGAAGACAAAGGAGAAGG + Intergenic
942479961 2:176374806-176374828 CTGGCTGAAGAAAGGACAAATGG - Intergenic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943348140 2:186765170-186765192 TTGGGTTAAGAAAAAGTAGATGG - Exonic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944098342 2:195994933-195994955 CTGTCTAAAGAAAAGGAAGAAGG - Intronic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
944997999 2:205316235-205316257 CTGCTTGAAGAAAAGGTTGAAGG + Intronic
945736707 2:213609895-213609917 CTGGATTATGAATAGGCAGAGGG - Intronic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946430202 2:219622166-219622188 CTGGAAGAACAAAAGGCAGAAGG + Intergenic
946608568 2:221433217-221433239 TTGGAGGAAGACAAGGCAGATGG + Intronic
946704346 2:222443577-222443599 CAGCGAGAAGAAATGGCAGAGGG - Intronic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
948536115 2:238648787-238648809 CTGGGTGCAGGAATGGGAGATGG - Intergenic
948651977 2:239452662-239452684 CTGGGTAAGGAAAAACCAGAAGG - Intergenic
948877408 2:240837013-240837035 CTGGGAGCAGCAAAAGCAGAGGG - Intergenic
1169139607 20:3219801-3219823 CTTTGTGAAGCAAAGGCAGGAGG + Intronic
1169477156 20:5941951-5941973 CTGAGTGAAAGAAACGCAGATGG - Exonic
1169831344 20:9828864-9828886 ATGGGGGAAGGAAAGGAAGAAGG - Intronic
1170734833 20:19005716-19005738 CTGCCTGAAGGAAAGGCAGCTGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172285004 20:33734115-33734137 TTGGGTGAAGAAAGGGCAGCAGG + Intronic
1172574299 20:35995402-35995424 CTGGGTGAAAAAAAGGGTGGGGG - Intronic
1172654876 20:36530570-36530592 CTGGATGGATAAAAGGGAGAAGG - Intergenic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1173070850 20:39763549-39763571 CAGGGTGGAGCAAATGCAGAAGG + Intergenic
1173198645 20:40937764-40937786 ATGGTTCAAGAAAAGGAAGAAGG + Intergenic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1173641309 20:44604061-44604083 CTGGGGGCAGAAAAGCCAGTTGG + Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173851687 20:46222612-46222634 ATGGGTGAAGACAAGGCTGCGGG - Intronic
1174828884 20:53794764-53794786 TTGGTTGAAGAACAGCCAGAAGG - Intergenic
1175245059 20:57577208-57577230 GTGGGTGGAGAATAGACAGATGG + Intergenic
1175948226 20:62568570-62568592 CAGGGAGATGAAAAGACAGATGG - Intronic
1176714411 21:10337806-10337828 CTCAGTGAAGAAAGGGCAAAGGG + Intergenic
1178370559 21:32023582-32023604 CTGGGGAAAGAAAAGTCAGAGGG - Intronic
1178528800 21:33357285-33357307 CTGGTGGAAGAAAAGGTTGAAGG + Exonic
1179374841 21:40841357-40841379 ATGGGTTAAGATAAGGCAGTGGG - Intronic
1179559985 21:42209516-42209538 CTGGGTGAAGAAAAAGCTAAGGG + Intronic
1181744326 22:24945301-24945323 CTGGGTGGAGAACAGGCAGAAGG + Intronic
1182957979 22:34445197-34445219 TGGGGTTAGGAAAAGGCAGAGGG + Intergenic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183151055 22:36037677-36037699 CTGGGAGAGGCAAAGGCAGCAGG - Intergenic
1183398734 22:37588641-37588663 CTGGGTGATTAAGATGCAGAAGG - Intergenic
1183460508 22:37947220-37947242 CTGGGGGAGGACAAGGGAGAGGG - Intronic
1183528822 22:38341118-38341140 CTCGGTGACGAAAAGGAAGGAGG - Intronic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1183749640 22:39712545-39712567 CTGGGTGCAGAGGATGCAGAAGG + Intergenic
1183850493 22:40582878-40582900 CTGTATGAAAAAAAGGCTGATGG + Intronic
1184212519 22:43044188-43044210 CTAGGTACAGAGAAGGCAGAGGG - Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
950104516 3:10379674-10379696 CTGGGTTGAGAGAAGGCAAAGGG + Intronic
950109964 3:10412612-10412634 CTGTGGCAAGTAAAGGCAGAGGG - Intronic
950434152 3:12968357-12968379 CTGGGTGGAGAAAGGGTAGGGGG - Intronic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
952253845 3:31678906-31678928 CTGAGTGAAGAATAGACTGAAGG - Intronic
952305527 3:32142822-32142844 CCGGGTAAAGAAATGCCAGAGGG - Intronic
952447705 3:33398660-33398682 CAGGATAAGGAAAAGGCAGAAGG + Intronic
953178471 3:40574145-40574167 CTGAGTCAGGAATAGGCAGAGGG + Intronic
954477073 3:50757094-50757116 CTTTGTGAAGCCAAGGCAGATGG - Intronic
954702627 3:52458733-52458755 CTTGGTGGAGAAGAGGGAGAAGG + Exonic
955625743 3:60917379-60917401 CTGTGTAAAGAAGAGGCTGAAGG - Intronic
956013100 3:64852566-64852588 CCGGGTGCAGAAATGGGAGATGG + Intergenic
958991942 3:100856572-100856594 TTGGGAGAAGAACAGGCAGGAGG + Intronic
959678159 3:109060810-109060832 CAGGGAGAAGAAACAGCAGAAGG + Intronic
960909514 3:122635058-122635080 CCAGGTAAAGAAAAGGCAAATGG + Exonic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962368261 3:134800122-134800144 CTGGGAGATGAAAAGGCAGGTGG - Intronic
962641215 3:137388760-137388782 ATGGAAGAAGAAAAGGAAGAAGG - Intergenic
963817159 3:149844277-149844299 CAGTGAGAAGAAAAGGCACATGG + Intronic
963934170 3:151035402-151035424 CTGGGGGAAGGAAAGGTAGGAGG - Intergenic
964113929 3:153115482-153115504 CTGGGTGAAAAATAGACAGCAGG + Intergenic
964653288 3:159036372-159036394 GTGGAGGAAGAAAAGGCAGGTGG - Intronic
964836606 3:160946177-160946199 CTGGGCTAAGAAAAGTAAGATGG - Intronic
965885690 3:173444442-173444464 CTGGGAGAAAAGATGGCAGAAGG - Intronic
966158199 3:176940901-176940923 CTGGGGGAAGGAAAGGGAGTAGG + Intergenic
966885708 3:184377121-184377143 CTGGGTGAGGAACTGGCAAACGG + Intronic
967845523 3:194039573-194039595 CTGGGTGAAGAAAAAGCCACTGG - Intergenic
967953951 3:194862871-194862893 CTGGGAGAGGAGGAGGCAGAGGG - Intergenic
968115443 3:196085846-196085868 CTTGGTGAAGAAAAAAGAGAGGG - Intergenic
969522111 4:7684430-7684452 CTGGATGAGGAAAAGGGAAAGGG - Intronic
970274620 4:14385142-14385164 CTGGGAGAAGAAAAAGGAGGAGG - Intergenic
971342447 4:25782947-25782969 CTGGGAGAAGCAGAAGCAGAAGG + Intronic
971633867 4:29031562-29031584 CTGGGTGAAGAGACTGCAAAGGG + Intergenic
971726303 4:30317019-30317041 CTTGGTGAAGAAAAGGAAAAAGG + Intergenic
971730484 4:30372675-30372697 CTACCTGAAGAAAAGGCAGAAGG + Intergenic
972296233 4:37741742-37741764 CTGAGTGAAGGAAAGGCTGAAGG + Intergenic
972340419 4:38148151-38148173 CTGTGTGAAGAACAGACTGAGGG - Intergenic
973293819 4:48494078-48494100 CTGGGGGAAAAAAATACAGAAGG - Intronic
974196738 4:58585165-58585187 CTGGGGGAAGAAATGGCTGGGGG - Intergenic
974236581 4:59189164-59189186 CTGGGGGAAGTCAAGGCTGAAGG - Intergenic
974266668 4:59594822-59594844 CTCTGTGAAGAATCGGCAGAAGG - Intergenic
975019751 4:69471626-69471648 ATGGATAAAGAAAAGGTAGATGG + Intergenic
975028746 4:69586011-69586033 ATGGATCAAGAAAAGGTAGATGG + Intergenic
976423847 4:84877257-84877279 CTGGATGTAGAAGAGCCAGACGG - Intronic
977674689 4:99734199-99734221 CTGGCTGAAGCCATGGCAGAAGG - Intergenic
978082365 4:104609568-104609590 GTGGGGGAAGTAACGGCAGATGG - Intergenic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
979361254 4:119767583-119767605 CTGGCTTAATAAAAGGCAGTTGG + Intergenic
980358391 4:131742671-131742693 CTGGAGGAAGAAACGCCAGAAGG + Intergenic
980424508 4:132608800-132608822 CTGAGTGAAGAAAAGTGGGAGGG + Intergenic
981759547 4:148178665-148178687 CTGGGTGAGGAAAGGGCAAGGGG + Intronic
982208868 4:153019106-153019128 CTGGGGGACTAAAAGGCAGAGGG + Intergenic
982430802 4:155319877-155319899 ATGCTTGAAGAAAAGGAAGATGG + Intergenic
984194754 4:176645753-176645775 GTGGGTGGGGAAAAGACAGAGGG - Intergenic
990177679 5:53126189-53126211 CTGGATGAAGAAATAGTAGATGG - Intergenic
990957656 5:61359605-61359627 CTGGGTGAGGGAAAGGATGATGG + Intronic
991127820 5:63087639-63087661 TTGGGTGAAGAAAAGGTCAAAGG + Intergenic
992445927 5:76833438-76833460 CTCAGAGAAGAAAAGGAAGAGGG + Exonic
992877870 5:81075668-81075690 TTGAGTGAAGAACAGGCTGAGGG + Intronic
992998266 5:82354021-82354043 CAGAGTAAAGAAAATGCAGAAGG - Intronic
993118525 5:83746635-83746657 CTAGGACAAGAAAAAGCAGATGG - Intergenic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
994097772 5:95862613-95862635 CTGTGGGAATAAAAAGCAGAGGG - Intergenic
994302569 5:98163084-98163106 CAGGGTGGAGAACAGGGAGATGG + Intergenic
994453964 5:99981688-99981710 CTTTGTGAAGACAAGGCAGGTGG + Intergenic
995237765 5:109849668-109849690 CTGGGTTAAGAACAGACATACGG - Intronic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
995629588 5:114118834-114118856 CTGAGTGAGGAAAAGTGAGAAGG - Intergenic
995908927 5:117162001-117162023 CTGAGGTAAGAAAAGGCATACGG - Intergenic
995951000 5:117713865-117713887 CTGGGTAAAGAAAATGTAGGTGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997743839 5:136281164-136281186 TTGGCTGATGAATAGGCAGAAGG - Intronic
998642612 5:144028554-144028576 CTGGGTGAAGAAAGAGAAGGAGG - Intergenic
999709286 5:154302262-154302284 CTGGTGGAAGCAAAGGCAGCTGG - Intronic
999930732 5:156430989-156431011 CTGGTTGTAGATAAGGCAGGTGG + Intronic
1000191442 5:158914698-158914720 GTGGGGAAAGGAAAGGCAGAAGG + Intronic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001560991 5:172668798-172668820 ATGGGAGAAGGAAAGGCAGGGGG + Intronic
1001575273 5:172759236-172759258 CTGGGAAAAGAAAAGTCAGAGGG + Intergenic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002137362 5:177116262-177116284 CTGGGTGAATAATAAGCAAATGG + Intergenic
1002180867 5:177430543-177430565 CCCGGTGAAGAAAGGGGAGAAGG - Intronic
1002309552 5:178306368-178306390 CTGGGTGAAGCAGAGACAGCAGG + Intronic
1002321268 5:178377518-178377540 GAGGGTGAAGAAAAGGCAAAAGG - Intronic
1003491895 6:6629713-6629735 CTAGCTGAGGACAAGGCAGAGGG - Intronic
1004271419 6:14199501-14199523 CTGGGTGAAGAGGAGAGAGAAGG + Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004631669 6:17427235-17427257 CTGGGAAAAGATAAGGGAGAGGG + Intronic
1005713796 6:28527653-28527675 CTGGCTGGAGAAAAGAGAGAAGG - Intronic
1005808005 6:29493203-29493225 ATGGTTGAAGAAAAGAAAGAAGG + Intergenic
1006115276 6:31772954-31772976 CTGGGTCATGAAAAGGCACCAGG + Exonic
1006436044 6:34026665-34026687 CTGGCTGGAGCAGAGGCAGAGGG + Intronic
1007107890 6:39295824-39295846 CTGGGTGAGGTAAGGGCCGATGG + Intergenic
1007113690 6:39328503-39328525 CTGGTTGAAGTAGGGGCAGAGGG + Intergenic
1007166498 6:39832157-39832179 CTTGGTGAGGAAAGGGTAGAGGG + Intronic
1007287895 6:40761325-40761347 CGGGGTGAAGAAAAGAGAGAAGG + Intergenic
1008008968 6:46443531-46443553 CAAGGAGAAGAAAAGGGAGATGG - Intronic
1008802648 6:55388901-55388923 CTGGGGGAAGAACAGGAAGAGGG - Intronic
1009483115 6:64185471-64185493 CTGATTACAGAAAAGGCAGATGG - Intronic
1010768521 6:79803046-79803068 CTGGGTAAGGAAAGGTCAGACGG - Intergenic
1010914021 6:81593604-81593626 GTGAGTGAAGAATAGCCAGAAGG + Intronic
1011000141 6:82579092-82579114 ATGGGTGGAGAAGAGGCAGGGGG + Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1011830698 6:91368021-91368043 ATTGGAGAAGAAAAGGCTGAAGG - Intergenic
1012035337 6:94130513-94130535 GTGGGCTAAGAAAAGGAAGATGG + Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012447984 6:99326288-99326310 CTGGGTGAGGCAAAGGCAGAAGG + Intronic
1013553571 6:111234047-111234069 CTGTGTGGAGAAAAGACCGAGGG - Intergenic
1013844296 6:114430868-114430890 CTGTGTCAAGACATGGCAGAAGG - Intergenic
1014081269 6:117288667-117288689 CAAGGTGAAGAAAAGTCTGAGGG - Exonic
1014572280 6:123024518-123024540 CTGGGTGGACTAAAGGCATATGG + Intronic
1014760677 6:125353381-125353403 AAGGGTGAGGAAAAGGAAGAAGG + Intergenic
1015280636 6:131430599-131430621 CTGGGTGGAGGATAGGGAGAAGG + Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1015812401 6:137173897-137173919 CTGGTTGAAGAAAATGCTGTTGG - Intergenic
1016001297 6:139044065-139044087 ATGACTGAAGGAAAGGCAGAAGG + Intergenic
1016092272 6:139994254-139994276 TTGGCTGAACAAAAGACAGAGGG + Intergenic
1016892041 6:149016475-149016497 GTGAGTGAATAAATGGCAGAAGG - Intronic
1017483945 6:154885306-154885328 CTGGGTGAAGAAACAGTAGTAGG - Intronic
1017969518 6:159299548-159299570 CTGGGTGAAGAAGAGGAGGAAGG + Intergenic
1020120835 7:5502289-5502311 CTTGGGGAAGCCAAGGCAGATGG + Intronic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1020861408 7:13496524-13496546 GTGAGTGATGGAAAGGCAGATGG - Intergenic
1021131386 7:16916585-16916607 CTGAGCCAAGAAAAGGGAGAAGG + Intergenic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023983375 7:45082095-45082117 CTGGAGGAAGGTAAGGCAGAGGG - Exonic
1024182272 7:46908308-46908330 CTGGGAGATGAAAAGGTAAAAGG - Intergenic
1024220647 7:47283989-47284011 CTGGGTGCATGTAAGGCAGATGG + Intronic
1024587441 7:50854224-50854246 TTGAGAGAAGAAAAGGAAGATGG + Intergenic
1024799504 7:53059715-53059737 CTCAGTAAGGAAAAGGCAGAGGG - Intergenic
1024810665 7:53207631-53207653 CTGGGATAAGAGATGGCAGATGG + Intergenic
1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG + Intergenic
1026907813 7:74072793-74072815 CTGAGTGGAGAGAAGGCCGAAGG - Intergenic
1026968346 7:74454055-74454077 ATGGGGGAAGGAGAGGCAGAGGG - Exonic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028035406 7:85975454-85975476 CTGGCTGAAGAATAGGGATAGGG + Intergenic
1028228807 7:88281366-88281388 CTTGGGGAACAAAATGCAGATGG - Intronic
1029536365 7:101160115-101160137 CAGAGTGGGGAAAAGGCAGAGGG - Intronic
1029698820 7:102232803-102232825 CTGGGAGAAGAAAAGGTATCAGG + Intronic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030876508 7:114820017-114820039 CCGGCTGAAGAAATGGCATATGG - Intergenic
1031881704 7:127205800-127205822 CTGGGTGAAGAGAAAGGTGAAGG - Intronic
1032434286 7:131887548-131887570 CAGGGTGAGGGAAAGCCAGATGG - Intergenic
1032518326 7:132523457-132523479 CTTGGCAAGGAAAAGGCAGAAGG + Intronic
1032927281 7:136621753-136621775 CTTGGTGGAGAAAAGCCTGATGG + Intergenic
1033048214 7:137981243-137981265 CTGGGTGGAGAATAGGAAGGTGG + Intronic
1033347964 7:140540214-140540236 GTGGGAGAAGAGAAGGCAGCAGG - Intronic
1033562028 7:142541590-142541612 CTGGGAGACCAAAAGGCACACGG - Intergenic
1033568441 7:142602398-142602420 CTGGGAGAAGAGCAGCCAGAGGG - Intergenic
1034461507 7:151200230-151200252 CTGGGAGAGAAAGAGGCAGAAGG - Intronic
1034762323 7:153684599-153684621 CTGGGTAAAGACAAGCCAGTTGG - Intergenic
1035161151 7:156950608-156950630 CAGGGGGAAGAAAAGGAAAAGGG + Exonic
1035217316 7:157377825-157377847 CTGGGTTAAGGAAATGCATATGG - Intronic
1036661029 8:10708847-10708869 CTGGCTGAGGAAAAGGAAAACGG + Intronic
1036706471 8:11050749-11050771 ATGAGGGAAGAACAGGCAGAGGG - Intronic
1037689918 8:21172935-21172957 CTGGGTGCACAAAAGTTAGAAGG - Intergenic
1037837823 8:22224596-22224618 CCGGGTCAGAAAAAGGCAGAGGG + Intronic
1038428569 8:27481508-27481530 CTGAGTCAAGATTAGGCAGAGGG + Intergenic
1038473517 8:27845025-27845047 CTGGGTGAAGAAAAATAAGCCGG + Intergenic
1040345013 8:46483944-46483966 TTGAGAGAAGAAAAGGCTGAAGG - Intergenic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1041658350 8:60376509-60376531 GTAGATGCAGAAAAGGCAGAGGG + Intergenic
1042005681 8:64177647-64177669 CTGGGGGAAGATAAGGGATATGG - Intergenic
1043979727 8:86624016-86624038 CTGTGTGAAGAAAAGGCCTTAGG - Intronic
1044654210 8:94530671-94530693 CTTTGTGAAGCTAAGGCAGATGG + Intronic
1046093707 8:109533636-109533658 AGGGATGAAGAAAAGGCAAAGGG - Intergenic
1046207839 8:111025261-111025283 CTGGGTGAAATAATAGCAGAGGG + Intergenic
1046447384 8:114340665-114340687 CTGGGTGAGGAAGAGGTAGTTGG + Intergenic
1046758902 8:118000194-118000216 CTGTGTGTATAAAAGACAGATGG + Intronic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1047818827 8:128495634-128495656 TTTGGTGAAGCCAAGGCAGATGG - Intergenic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1049619505 8:143591703-143591725 CTGGGTGCAGACCAGGCAGGTGG - Intronic
1050832457 9:10030591-10030613 CTGGGAGAAGGAAAGGCTCAGGG + Intronic
1051194982 9:14554360-14554382 CTGGATGAGGAAAAGGCTGAAGG - Intergenic
1051818211 9:21134217-21134239 CAGGGTGAAGAACAGCCTGATGG - Intergenic
1052753896 9:32521340-32521362 TGGGGGGAAGAAAAGGAAGAGGG + Intronic
1053224254 9:36339026-36339048 CTGCCTGAAGCAAAGGAAGAAGG + Exonic
1053387584 9:37706910-37706932 CTGACAGAAGAACAGGCAGATGG - Intronic
1053642554 9:40099114-40099136 CTGGGTAGAGAAAAGGCAAGAGG + Intergenic
1053763598 9:41366379-41366401 CTGGGTAGAGAAAAGGCAAGAGG - Intergenic
1054542206 9:66277518-66277540 CTGGGTAGAGAAAAGGCAAGAGG - Intergenic
1054716908 9:68565670-68565692 CTGGGTGCAGAAACGACAGGAGG + Intergenic
1054859504 9:69934256-69934278 CTTTGGGAAGAAAAAGCAGAAGG + Intergenic
1055255940 9:74371345-74371367 GAGGGTTGAGAAAAGGCAGAGGG - Intergenic
1055355157 9:75429877-75429899 CTGGGATAGGAAAAGGCAGAGGG + Intergenic
1056333262 9:85539520-85539542 CTGTGTAATGAAAAGGCAGGGGG + Intergenic
1056600595 9:88043837-88043859 GTGGGCGAAGCAAAGGGAGAAGG - Intergenic
1056984796 9:91352995-91353017 GTGGGAGAAGAAAAAGAAGAGGG + Intronic
1057350572 9:94293662-94293684 CTTTGGGAAGCAAAGGCAGATGG - Intronic
1057401518 9:94727176-94727198 CCGGGGGAAGAAGAGGCGGATGG - Intronic
1057568432 9:96185101-96185123 GTGGCTGAAGTAAAAGCAGAGGG + Intergenic
1057815552 9:98291477-98291499 CTGGGCAAAGCAGAGGCAGACGG - Intronic
1058523616 9:105836033-105836055 CCTGGTGTGGAAAAGGCAGATGG + Intergenic
1058775576 9:108280071-108280093 CTGTGTTAAGAACAGGCTGAAGG + Intergenic
1060008691 9:120024292-120024314 CTGCCTGAAGAAAAGTGAGAAGG - Intergenic
1060181502 9:121537596-121537618 CTGGGAGAAGAAAAACAAGAAGG + Intergenic
1060198016 9:121635725-121635747 CTGGGTGAAGACAAGACAGTGGG + Intronic
1060606446 9:124918837-124918859 CAGGAGGCAGAAAAGGCAGAAGG - Intronic
1060672705 9:125484096-125484118 CTGAGTTAAGAACAGGCAGGTGG + Intronic
1060763556 9:126276097-126276119 ATGGGAGAAGAGAAGGCAGGTGG - Intergenic
1061065846 9:128276856-128276878 CTGGGAGAAGATATGGAAGAGGG - Intronic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1062235566 9:135506142-135506164 CTGGGTGAAACAAAGGTTGAGGG + Intergenic
1062243588 9:135552361-135552383 ATTGGTGAGGAAAGGGCAGAGGG - Intergenic
1203793205 EBV:162465-162487 CTGGGTGAAGATGGGGCAGGCGG + Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186402589 X:9273567-9273589 AAGGATGAAGAAAAGGAAGAAGG + Intergenic
1187397437 X:18930880-18930902 CAGGCTCTAGAAAAGGCAGAAGG - Intronic
1187832541 X:23397577-23397599 CTGAGGGAGTAAAAGGCAGAAGG - Exonic
1188621769 X:32234219-32234241 TTGGGTCAGGAAAAGACAGATGG + Intronic
1189124836 X:38435487-38435509 CTGGGTGAAGGACAGAGAGAAGG - Intronic
1189217677 X:39341005-39341027 ATGGATGAAGAAGAGGGAGAAGG + Intergenic
1189488097 X:41447882-41447904 CTGGGTGGATGAAAGGCCGAGGG + Exonic
1189988217 X:46572486-46572508 ATGAGTAATGAAAAGGCAGAGGG + Intergenic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190397417 X:49999013-49999035 CTGGGTGAAAAAAAGCAAGGGGG - Intronic
1190465367 X:50720809-50720831 CTGGCTGAAGGAATAGCAGATGG + Intronic
1191572090 X:62640190-62640212 CTTTTTGAAGAAAATGCAGATGG + Intergenic
1191669514 X:63736033-63736055 CTGGATGAGGAAGTGGCAGAGGG + Intronic
1194434375 X:93851688-93851710 CTGGCTGAAGAAAAAGCCCAAGG - Intergenic
1195031183 X:100929059-100929081 CAGGATGAAGAAAAGGCTGGAGG + Intronic
1195869868 X:109474679-109474701 CTGCTTTGAGAAAAGGCAGAAGG + Intronic
1197917203 X:131548920-131548942 TTGAGTGAAGAAGTGGCAGAAGG - Intergenic
1198556695 X:137801205-137801227 CTGGGTAATGAGAAGGCATAGGG - Intergenic
1198589164 X:138156950-138156972 CTGGGTGGACAAAAGACTGATGG + Intergenic
1199498207 X:148477934-148477956 CAGGGAGAAGAAAAGTAAGAAGG + Intergenic
1199985618 X:152947980-152948002 ATGAGAGAAGCAAAGGCAGATGG + Intronic
1200797871 Y:7358234-7358256 CTTGGGGAGGAAAAGGCAGGAGG - Intergenic
1201511044 Y:14763408-14763430 ATAGGTGAAGAAAAGAGAGAGGG + Intronic
1201700366 Y:16874596-16874618 CTTTGGGAAGCAAAGGCAGAAGG - Intergenic
1202124637 Y:21557178-21557200 TTGGGTGCAGTACAGGCAGAAGG + Intergenic
1202154371 Y:21872202-21872224 TTGGGTGCAGTACAGGCAGAAGG - Intergenic