ID: 920201629

View in Genome Browser
Species Human (GRCh38)
Location 1:204263178-204263200
Sequence CTGTGACAGGAGAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920201622_920201629 18 Left 920201622 1:204263137-204263159 CCGCGGGAAACAAGGAGAGAGCA 0: 1
1: 0
2: 0
3: 13
4: 197
Right 920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920201629 Original CRISPR CTGTGACAGGAGAAGGCAGA GGG Intronic
No off target data available for this crispr