ID: 920201629 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:204263178-204263200 |
| Sequence | CTGTGACAGGAGAAGGCAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920201622_920201629 | 18 | Left | 920201622 | 1:204263137-204263159 | CCGCGGGAAACAAGGAGAGAGCA | 0: 1 1: 0 2: 0 3: 13 4: 197 |
||
| Right | 920201629 | 1:204263178-204263200 | CTGTGACAGGAGAAGGCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920201629 | Original CRISPR | CTGTGACAGGAGAAGGCAGA GGG | Intronic | ||
| No off target data available for this crispr | |||||