ID: 920203365

View in Genome Browser
Species Human (GRCh38)
Location 1:204274496-204274518
Sequence ACCTGTGGGGTGCACCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920203358_920203365 12 Left 920203358 1:204274461-204274483 CCAGCCTCATACCTGTCTTCTAC 0: 1
1: 0
2: 0
3: 26
4: 236
Right 920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 129
920203357_920203365 25 Left 920203357 1:204274448-204274470 CCTGGGTGCTATGCCAGCCTCAT 0: 1
1: 0
2: 3
3: 12
4: 178
Right 920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 129
920203360_920203365 1 Left 920203360 1:204274472-204274494 CCTGTCTTCTACTCCATCAGCTC 0: 1
1: 0
2: 3
3: 16
4: 199
Right 920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 129
920203355_920203365 27 Left 920203355 1:204274446-204274468 CCCCTGGGTGCTATGCCAGCCTC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 129
920203359_920203365 8 Left 920203359 1:204274465-204274487 CCTCATACCTGTCTTCTACTCCA 0: 1
1: 0
2: 0
3: 19
4: 253
Right 920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 129
920203356_920203365 26 Left 920203356 1:204274447-204274469 CCCTGGGTGCTATGCCAGCCTCA 0: 1
1: 0
2: 3
3: 67
4: 866
Right 920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG 0: 1
1: 0
2: 1
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920203365 Original CRISPR ACCTGTGGGGTGCACCACCC TGG Intronic
900240461 1:1615115-1615137 AACTCTGGGGTGCAGAACCCGGG + Intergenic
900646825 1:3712872-3712894 GCCCGTGTGGTGCCCCACCCCGG + Intronic
902534997 1:17114408-17114430 AACTGTGGGGTGCAGAGCCCAGG - Intronic
905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG + Intronic
905926285 1:41752229-41752251 ACCTCTGTGCTGCACCTCCCTGG + Intronic
908444452 1:64188165-64188187 ACCTGAAGGGTGCCCCACCATGG + Intergenic
910102549 1:83594181-83594203 AGCTGTGAGCTGCACCACCTGGG + Intergenic
912544784 1:110442917-110442939 AACTGAGGGCTTCACCACCCAGG + Intergenic
915462275 1:156077157-156077179 GCCTGGCGGGTGCACCAGCCCGG - Exonic
916933612 1:169605125-169605147 ATCTGTGCCCTGCACCACCCAGG + Intronic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1063927714 10:10996838-10996860 GCCTGTGGGCAGCACCTCCCAGG - Intergenic
1065549917 10:26860408-26860430 ACCTGGGGGGCGCGCGACCCCGG + Intronic
1073426276 10:103457550-103457572 CCGTGTGGGGAGGACCACCCAGG - Intronic
1075060023 10:119250110-119250132 ACCTGTGGGGTGAATCTCCCTGG + Intronic
1075724706 10:124605317-124605339 GCCTGTGGGGGGGACCACCGAGG + Intronic
1076500257 10:130931061-130931083 CCCTGTGGGGTGCAGAGCCCAGG - Intergenic
1077111928 11:865787-865809 AGCTGTGGGCTGCACGCCCCCGG + Exonic
1077131142 11:973300-973322 TGGTGTGGGGTGCAGCACCCTGG - Intronic
1077178454 11:1201205-1201227 CCCTGTGGGGTGCACACCTCAGG + Intergenic
1077373895 11:2196143-2196165 ACCTGTGTGGTCCAGAACCCAGG - Intergenic
1077497201 11:2892082-2892104 GCCTGTGGGGTGCAGCCACCTGG - Intronic
1082870933 11:57943696-57943718 AGCTGTTGGGTACACCTCCCAGG + Intergenic
1084535424 11:69753537-69753559 GTCTGTGAGGTGCCCCACCCTGG + Intergenic
1085467940 11:76736919-76736941 GCCTGTGGGGTGCCCCACACTGG - Intergenic
1090196576 11:124821713-124821735 ACCTCTTGGGAGCACCTCCCTGG + Intergenic
1096193980 12:49637128-49637150 GCCTGTCGGGTGCCCCACCAAGG - Exonic
1098130083 12:67341212-67341234 AGCTGTTGGGTACACCTCCCAGG + Intergenic
1099806913 12:87531452-87531474 AGCTGTGGTGGGCTCCACCCAGG - Intergenic
1103558488 12:121779835-121779857 ACCTGCGGGCTGCACTGCCCTGG - Exonic
1104474656 12:129061535-129061557 AGCTGTGGTGGGCTCCACCCAGG + Intergenic
1108082559 13:46752000-46752022 GCCTGTGGGCAGCACCACCAAGG + Intronic
1110699151 13:78526547-78526569 AGCTGTGGTGGGCTCCACCCAGG - Intergenic
1113065105 13:106365283-106365305 ACCTGTGGGATGCCGAACCCAGG + Intergenic
1117495343 14:56296755-56296777 TCCTGTGGGGCTCAACACCCTGG + Exonic
1118347096 14:64948329-64948351 TCGTGTGGGGTGCCCCACACAGG + Exonic
1120843948 14:89110357-89110379 ACCTGCGAGGTGCACCACGGGGG - Intergenic
1202942253 14_KI270725v1_random:162195-162217 TCCTGTAGGGTGGCCCACCCAGG - Intergenic
1124088229 15:26572256-26572278 AGCTGTGGCGTGCACTATCCTGG + Intronic
1125764315 15:42123077-42123099 ATCTGTGTTGTGCACCACCTGGG + Intergenic
1130207206 15:81888193-81888215 AACTGTGGGGTGGACCTGCCAGG - Intergenic
1130572269 15:85057440-85057462 AGCTGTGGTGGGCTCCACCCAGG + Intronic
1130833639 15:87628539-87628561 ACCTGTGGGGAGCAGCAACCAGG - Intergenic
1131303787 15:91223496-91223518 ACTTGTGGGACTCACCACCCAGG - Intronic
1137675578 16:50302169-50302191 ACCTGCGGGTGCCACCACCCTGG - Intronic
1141652609 16:85401577-85401599 ACCTGTGGGGCGGCCCATCCAGG + Intergenic
1141683517 16:85557167-85557189 AACCCTGGGGTTCACCACCCAGG - Intergenic
1142171999 16:88627801-88627823 ACCTTTGGGGAGCAGCTCCCGGG + Intronic
1142190038 16:88713266-88713288 GCCTGGGGGGTGCAGGACCCGGG - Intronic
1142192636 16:88725007-88725029 ACCTGTGGCGTGGTCCAGCCAGG + Exonic
1144784207 17:17822947-17822969 ACCTGGGGGGTCCACAAACCAGG - Intronic
1145242831 17:21249643-21249665 ACTTGAGGGGTGCAGAACCCTGG - Intronic
1146420796 17:32683760-32683782 AACTGTGGTGGGCTCCACCCAGG + Intronic
1146610136 17:34297960-34297982 AACTGTGGTGGGCTCCACCCAGG + Intergenic
1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG + Intergenic
1147882452 17:43662839-43662861 CCCTGTGATGTGCACCAGCCCGG - Intergenic
1149410018 17:56395415-56395437 ACCTATGGACTGCATCACCCAGG - Intronic
1151787642 17:76283011-76283033 ACAGGTGGGGTGGCCCACCCTGG + Intronic
1153491148 18:5649081-5649103 GCCTGTTGGGTAGACCACCCTGG - Intergenic
1157708892 18:49834387-49834409 ACCTGTGGGGAGCACCTCAGGGG - Intronic
1160454163 18:78986196-78986218 ACCTGTGCAGTGAAGCACCCGGG - Intronic
1163510799 19:17733908-17733930 CCCTGTAGGGTGCACGACCCAGG + Intronic
1163827683 19:19532814-19532836 TCTTGAGGGGTGAACCACCCTGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925192772 2:1898862-1898884 TCCTCTGGAGTGCACCTCCCTGG - Intronic
926143267 2:10381160-10381182 CCCTGAGGTGGGCACCACCCAGG + Intronic
926655703 2:15403376-15403398 ACCTGTGGGCTCCACTTCCCTGG + Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928119493 2:28573320-28573342 ACCTGTGCTGTTCACCGCCCCGG - Intronic
931012235 2:57930003-57930025 AGCTGTGAGCTGCACCACCTGGG + Intronic
935095546 2:99940973-99940995 ACCTGTCTGGTGCAGCACTCTGG + Intronic
936261412 2:110962537-110962559 TCCTGTGGGGAGAACCACCCTGG - Intronic
943676112 2:190717828-190717850 ACCAGTGGGGTGAATCACCAAGG + Intergenic
948712632 2:239834417-239834439 CCATGTGGGGTTCAGCACCCAGG - Intergenic
1168904559 20:1392832-1392854 ACCGGTGTAGTGCACCACGCAGG + Exonic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1169063360 20:2677631-2677653 ACCTGGAGGGTGCACCAAGCAGG - Intergenic
1174116662 20:48230989-48231011 GCCTGTGGGCTGCACCTCCCAGG + Intergenic
1174272252 20:49378109-49378131 ACCTGTCAGGTGTCCCACCCTGG - Intronic
1175710595 20:61217337-61217359 AGCAGTGGGGTGCATCACCTTGG + Intergenic
1176129147 20:63488880-63488902 GCCTGGGGGCTGCACCTCCCCGG + Intronic
1176885840 21:14254840-14254862 TCCTGTGGGGAGCAGCACCAAGG + Intergenic
1180556538 22:16582610-16582632 ACCTGTGGTGTGCACTGCCGTGG - Intergenic
1180786102 22:18548624-18548646 GGCTGTGGGGTGCTCCACCTGGG - Intergenic
1181131384 22:20734349-20734371 GGCTGTGGGGTGCTCCACCTGGG - Intronic
1181243024 22:21488178-21488200 GGCTGTGGGGTGCTCCACCTGGG - Intergenic
1184689148 22:46109613-46109635 GCCTGAGGGGTGCACCACCAGGG - Intronic
1185246780 22:49776911-49776933 CCCTGTGTGGAGCCCCACCCTGG - Intronic
952272658 3:31847930-31847952 AGCTGTGGGCTGCATCCCCCTGG - Intronic
952997822 3:38902410-38902432 GCCTGTGAGGAGAACCACCCTGG + Intronic
953637882 3:44677968-44677990 CCCTGTGGGTGGCATCACCCTGG - Intergenic
961042009 3:123684194-123684216 ACCTGTGGGGTGTGATACCCTGG - Intronic
961505603 3:127368906-127368928 CAGTGTGGGGTGCACCACGCAGG + Intergenic
963459667 3:145594060-145594082 AACTGTGGGGTGCAGCATACAGG + Intergenic
963581336 3:147129801-147129823 AGCTGTGGTGGGCTCCACCCAGG + Intergenic
966328945 3:178789888-178789910 ACTTGGTGGGTGCACAACCCAGG + Intronic
966370294 3:179244598-179244620 ACCTGTGGTGTGCACTGCCACGG - Exonic
968609372 4:1550200-1550222 CCCTCAGGGCTGCACCACCCAGG + Intergenic
974402602 4:61425619-61425641 AACCATGGGGAGCACCACCCTGG - Intronic
975751083 4:77524369-77524391 AGCTGTGGTGGGCTCCACCCAGG + Intronic
977875021 4:102139511-102139533 TGCTGTGGGTTGCACCACTCTGG + Intergenic
978527086 4:109678337-109678359 AGCTGTTGGGTACACCTCCCAGG + Intronic
981444371 4:144818619-144818641 ACCTGTGGACTCCACCTCCCTGG - Intergenic
985634635 5:1030037-1030059 ACCTGTGTGGTGAAGCCCCCAGG - Intronic
985690879 5:1311607-1311629 ACCTGTGGGGAGCCCTGCCCTGG - Intergenic
987083417 5:14446593-14446615 ACCTGTGGGGTGCATGCACCTGG + Intronic
989679508 5:44012594-44012616 ACCTGTGGAGAGGAGCACCCTGG - Intergenic
991696785 5:69280409-69280431 ACCTGTGCAGAGGACCACCCAGG + Exonic
992235727 5:74706802-74706824 AGCTGTGGTGGGCTCCACCCAGG - Intronic
993457689 5:88144284-88144306 GCCTCTGAGGTGCCCCACCCCGG + Intergenic
994882735 5:105518758-105518780 AGCTGTGGTGGGCTCCACCCAGG + Intergenic
997209357 5:132068421-132068443 CCCTGTGGGGTGAGCCAGCCGGG + Intergenic
998189197 5:140008083-140008105 AGATGTGGGGAGCACCACACAGG + Intronic
1006448924 6:34094913-34094935 ACCTGTGCTGAGCACCACCTGGG - Intronic
1012595741 6:101036552-101036574 ACCACTGGTGTGCACCACCATGG - Intergenic
1013811867 6:114053984-114054006 GCCTGTGGGGGGCATCACCTGGG - Intergenic
1017317080 6:153043865-153043887 ACCTGTAGGATGCCACACCCAGG - Intronic
1018612608 6:165660569-165660591 ACCTTTGGGGTGCAGCCCCCGGG - Intronic
1019303151 7:319292-319314 ACCTGTGGGATTGACCTCCCAGG - Intergenic
1023733988 7:43218966-43218988 ACCTGTGGGGAACACCAGCCAGG + Intronic
1024228407 7:47345948-47345970 ATCTCTGGGGTGCATTACCCAGG + Intronic
1024597648 7:50953639-50953661 ACCTGTGGGGGGCTCCACTGTGG + Intergenic
1027536273 7:79405871-79405893 CCCTCTAGGGTGCTCCACCCTGG + Intronic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1029487586 7:100852865-100852887 AGCTGTGGGGTGCACCTGGCCGG + Intronic
1030386096 7:108870235-108870257 ACCTGTGGGATGCAGCATGCAGG + Intergenic
1040041238 8:42918923-42918945 AGCTGTTGGGTACACCTCCCAGG + Intronic
1045281601 8:100754246-100754268 GTCTATGTGGTGCACCACCCAGG + Intergenic
1047536548 8:125725340-125725362 TCCTGTGGGCTGCACCTGCCAGG - Intergenic
1049701070 8:144012915-144012937 ACCTGTGGAGAGGTCCACCCTGG - Intronic
1052910848 9:33880022-33880044 ACCTCAGGGGTGCACCATCATGG + Intronic
1058368142 9:104234753-104234775 AGCTGTTGGGTACACCTCCCAGG + Intergenic
1060187446 9:121572342-121572364 ACCAGTGCTGTGCAGCACCCTGG - Intronic
1186248970 X:7645573-7645595 ACCTTTAGGGTGCACTTCCCAGG + Intergenic
1186415853 X:9382496-9382518 ACATGGGGGTTGCCCCACCCAGG + Intergenic
1188489514 X:30722850-30722872 ACCTGAGGCCTGCAACACCCAGG - Intronic
1191879554 X:65831349-65831371 ACAGCTGGGGGGCACCACCCTGG + Intergenic
1195240796 X:102949890-102949912 ACCTGTGGGGAACAACAGCCAGG - Intergenic
1200869112 Y:8078037-8078059 ATCTGTGGTGAGCAGCACCCAGG + Intergenic