ID: 920203852

View in Genome Browser
Species Human (GRCh38)
Location 1:204277285-204277307
Sequence GCCAGAATGCTACTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 4, 3: 5, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920203843_920203852 16 Left 920203843 1:204277246-204277268 CCTAGGTGCCCTAGTAGGCCTGT 0: 1
1: 0
2: 1
3: 2
4: 81
Right 920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG 0: 1
1: 0
2: 4
3: 5
4: 118
920203845_920203852 8 Left 920203845 1:204277254-204277276 CCCTAGTAGGCCTGTGGCTTCCT 0: 1
1: 0
2: 0
3: 16
4: 131
Right 920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG 0: 1
1: 0
2: 4
3: 5
4: 118
920203846_920203852 7 Left 920203846 1:204277255-204277277 CCTAGTAGGCCTGTGGCTTCCTG 0: 1
1: 0
2: 2
3: 25
4: 220
Right 920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG 0: 1
1: 0
2: 4
3: 5
4: 118
920203849_920203852 -2 Left 920203849 1:204277264-204277286 CCTGTGGCTTCCTGGTATTCGGC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG 0: 1
1: 0
2: 4
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920203852 Original CRISPR GCCAGAATGCTACTGGTCAG AGG Intronic
905920145 1:41713916-41713938 GAAACAATGCTGCTGGTCAGTGG + Intronic
907127405 1:52063060-52063082 CACAGACTGGTACTGGTCAGTGG + Intronic
907301226 1:53487494-53487516 GCCATCATGCTTCTGGTCACTGG + Intergenic
911243909 1:95496068-95496090 GCAATGATGCAACTGGTCAGTGG + Intergenic
911898269 1:103467405-103467427 CACAGACTGCTACTGGTCTGTGG + Intergenic
912236623 1:107858466-107858488 ACCAGACTGGTACTGGTCTGGGG - Intronic
913574888 1:120162186-120162208 ACCAGTATGCTACTGGTCAGAGG + Intronic
914296153 1:146327028-146327050 ACCAGTATGCTACTGGTCAGAGG + Intergenic
914557195 1:148777818-148777840 ACCAGTATGCTACTGGTCAGAGG + Intergenic
914615639 1:149352412-149352434 ACCAGTATGCTACTGGTCAGAGG - Intergenic
920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG + Intronic
920961704 1:210669800-210669822 GGCAGTATGCTATTGGTCAAAGG - Intronic
921362808 1:214345597-214345619 CTCTGAATGCTATTGGTCAGGGG + Intergenic
922630408 1:227102465-227102487 GCAAGAATAGTACGGGTCAGTGG - Intronic
924449001 1:244160875-244160897 CCCACAATGCTACAGGTCAAAGG - Intergenic
1063132983 10:3194572-3194594 GGCAGATTGCTTCTGCTCAGGGG + Intergenic
1065127633 10:22589363-22589385 GCCAGGATGCTACCTGTGAGGGG - Intronic
1068959194 10:62849633-62849655 CACAGACTGGTACTGGTCAGTGG + Intronic
1070450805 10:76555179-76555201 GCCAGGATCCTGCTGGTCTGTGG - Intronic
1074722328 10:116273447-116273469 GCCAGATTTCTTCTGGCCAGAGG + Exonic
1080682222 11:34487461-34487483 GCCAGGATGCTCCTGCCCAGAGG - Intronic
1081707219 11:45189611-45189633 GCCAGACTGCTACCGTTCTGGGG + Intronic
1084914687 11:72419752-72419774 GCCAGATTTCCCCTGGTCAGAGG - Intronic
1086478430 11:87205837-87205859 CCCAACATGCTACTGGTCAGAGG + Intronic
1090726514 11:129531807-129531829 GACAGATTGCTAATGGGCAGTGG - Intergenic
1091367352 11:135033300-135033322 TGCAGACTGGTACTGGTCAGAGG - Intergenic
1092756857 12:11771671-11771693 GCCAGAATTCTACAGGGAAGGGG - Intronic
1092958089 12:13568874-13568896 GCCAGGATGATACTGGGGAGTGG + Intronic
1094221621 12:28000050-28000072 GCCTGCATGCAGCTGGTCAGAGG - Intergenic
1096016648 12:48282277-48282299 CACAGACTGGTACTGGTCAGTGG + Intergenic
1101325276 12:103710044-103710066 ACCACAAGGCTACTGGTGAGAGG - Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1103630920 12:122260137-122260159 GACAGACTGCTACTGGGCATGGG + Intronic
1104962752 12:132495930-132495952 GCCAGCAAGCCACTGGGCAGGGG - Intronic
1105701093 13:22936074-22936096 GCAAAAATGCTACTTGTGAGGGG - Intergenic
1105841890 13:24260969-24260991 GCCCGATTGCTACAAGTCAGAGG + Intronic
1105853921 13:24359122-24359144 GCAAAAATGCTACTTGTGAGGGG - Intergenic
1108358718 13:49650801-49650823 GTCAGCATGCTACAGGTCTGGGG - Intergenic
1116419217 14:44713663-44713685 CACAGACTGATACTGGTCAGTGG - Intergenic
1119478945 14:74947942-74947964 GCAAGACTGGTGCTGGTCAGAGG + Intronic
1122472659 14:101981986-101982008 CCCAGACTGGTACTGGTCCGCGG + Intronic
1122842706 14:104474131-104474153 GCAAAAATGCTACTTGTGAGGGG - Intergenic
1129611659 15:77064596-77064618 GCCACAAGGCTCTTGGTCAGTGG + Intronic
1130199373 15:81810745-81810767 GCCAGTCTGCACCTGGTCAGAGG + Intergenic
1137385213 16:48035545-48035567 GCCAGAATCCTACTGTGTAGAGG - Intergenic
1137936667 16:52641476-52641498 GTCAGAATGTTCCTGGTCAAGGG + Intergenic
1140338269 16:74132215-74132237 GCCAGAATGCTTCTGGTAAAAGG + Intergenic
1141700733 16:85640905-85640927 GCCAGAGGGCTGGTGGTCAGGGG + Intronic
1145220339 17:21083463-21083485 GCCAGTATGGTACTGGTAAAAGG - Intergenic
1148908790 17:50928662-50928684 CATAGAATGATACTGGTCAGGGG - Intergenic
1149591085 17:57830539-57830561 GCCAGAATGCTACAGGACTGTGG + Intergenic
1149979769 17:61300900-61300922 GCCAGATTGCCAGTGGTCTGTGG - Intronic
1152243190 17:79170687-79170709 GCCAGAAAGCTACAGACCAGGGG - Intronic
1156465579 18:37346295-37346317 CCCAGAATGCTATAGGTCACAGG + Intronic
1157056475 18:44234902-44234924 TCCAGAATTCTACTGTTCACAGG + Intergenic
1157437421 18:47682552-47682574 GCCACAATGCCACTAGACAGTGG + Intergenic
1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG + Intronic
1162837549 19:13330938-13330960 GCGAGTATGCTACAGGTCAAGGG - Intronic
1164299888 19:23952561-23952583 GCCAGATGGCTATTGGTCATAGG - Intergenic
1164841705 19:31397807-31397829 TCCAGAAGGCTCCTGGCCAGTGG - Intergenic
935884114 2:107597187-107597209 TCCATAGTGCTACTGCTCAGGGG - Intergenic
937200946 2:120204227-120204249 GCCAGGCTCCTGCTGGTCAGAGG + Intergenic
938600610 2:132834920-132834942 GCCAGCATCCTACTGAACAGGGG - Intronic
941574246 2:167210971-167210993 GTAAGAATACTACTGGACAGGGG + Intronic
942553683 2:177148784-177148806 GCCAGCCTGCTACTTGTCGGGGG + Intergenic
944937761 2:204587206-204587228 GCCAGAATGCTCATTATCAGAGG + Intronic
945027005 2:205629367-205629389 CCCAGAATGCTACTTATCAAAGG - Intergenic
947967341 2:234292218-234292240 GCCAAAATGCCAGTGGTTAGAGG - Intergenic
948533408 2:238628591-238628613 GTCAGAAGGCTACTTCTCAGAGG - Intergenic
948783827 2:240340658-240340680 GCCAGAGTGCAGCTGGTGAGGGG + Intergenic
1171146311 20:22786613-22786635 GCCTGAATGCTGTTGGTTAGGGG - Intergenic
1172046955 20:32087052-32087074 GCCAGAATACTCCTGGGCAATGG + Intronic
1173799748 20:45887471-45887493 GCCAGAAAGCAACTTCTCAGGGG + Intronic
1175978429 20:62725257-62725279 GCCAGAATGATGCTGGTCTTGGG - Intronic
1177893303 21:26833125-26833147 CCCAGAATGCTTCTGGCCTGGGG + Intergenic
1182097490 22:27635962-27635984 GCCAGAGAGCCACTGCTCAGTGG + Intergenic
1183280599 22:36929967-36929989 TGCAGAGTCCTACTGGTCAGTGG - Intronic
1184595580 22:45512112-45512134 TCCAGTGTGGTACTGGTCAGAGG + Intronic
1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG + Intronic
958104138 3:89051311-89051333 GTCACAATGCTACTTCTCAGTGG + Intergenic
960802460 3:121553301-121553323 GACAGAAAGCTACTGGCAAGAGG - Intergenic
961331128 3:126139100-126139122 GACACAATGCTGGTGGTCAGAGG - Intronic
965113418 3:164456702-164456724 GCCAGAATGCTGACAGTCAGGGG - Intergenic
970565425 4:17327475-17327497 GCCAGAATGCCAGTTCTCAGAGG - Intergenic
971131267 4:23813568-23813590 GCCAGAATTGCAGTGGTCAGGGG + Intronic
978292212 4:107154849-107154871 GACAGAACTCTACTGGCCAGGGG - Intronic
981777741 4:148389337-148389359 GCCAGAATGCTATAGGACACGGG + Intronic
986173659 5:5333834-5333856 GACACAATGCCACTGGTCATGGG - Intergenic
989552340 5:42750592-42750614 TACAGACTGGTACTGGTCAGTGG + Intergenic
993264988 5:85714506-85714528 GCAAGAATGGTACTGGTAATAGG - Intergenic
994328392 5:98476495-98476517 GCCAGAATGGAGCAGGTCAGAGG + Intergenic
997003179 5:129785672-129785694 GCCACAATGTTACTGGACAAGGG + Intergenic
997846714 5:137293004-137293026 GCCAGATGGGTACTGGTCACAGG - Intronic
998431070 5:142070438-142070460 GCTAGGATGCTACTGGTCTCTGG - Intergenic
999809364 5:155113358-155113380 TCCCAAATGCTACTGGTCACAGG + Intergenic
1000266432 5:159642051-159642073 GTGACAATGCCACTGGTCAGTGG + Intergenic
1001891515 5:175343282-175343304 GCCAGAAGGAGACTGGTTAGAGG + Intergenic
1003525364 6:6892449-6892471 GCCAGAATCCTACTCTTTAGTGG - Intergenic
1006507561 6:34499374-34499396 CACAGATTGCTACTGGTCTGTGG - Intronic
1016918397 6:149266330-149266352 ACCAGAATGCTTCTGTTCACTGG - Intronic
1023893734 7:44414411-44414433 GCCAAAATGACACTGGGCAGGGG + Intronic
1029504553 7:100954891-100954913 GATAAAATGCTACTGGTGAGTGG - Exonic
1029504718 7:100956022-100956044 GATAAAATGCTACTGGTGAGTGG - Exonic
1030155631 7:106451536-106451558 CCCACTATGCTCCTGGTCAGCGG - Intergenic
1030694426 7:112569279-112569301 TCCAGACTGGTACTGGTCCGTGG + Intergenic
1036852641 8:12214858-12214880 CACAGACTGCTACTGGTCTGTGG + Intergenic
1036981087 8:13471119-13471141 GCTAGAATGGTAGTTGTCAGGGG + Intronic
1037582096 8:20251721-20251743 GCCAGCATGATACTAGTCACTGG + Intronic
1039492846 8:37960798-37960820 CGCAGACTGCTACTGGTCTGTGG - Intergenic
1040017779 8:42713871-42713893 GCCAGAAAGATCCTGGCCAGGGG - Intronic
1042842732 8:73140468-73140490 GCCAGAAAGACAATGGTCAGAGG - Intergenic
1044336327 8:90987990-90988012 CCCAGACTGGTACTGGTCATTGG - Intergenic
1045900982 8:107279859-107279881 TCCAGAGTGCTACGGGTCAATGG + Intronic
1046013141 8:108574407-108574429 CACAGACTGCTACAGGTCAGTGG + Intergenic
1048087222 8:131196645-131196667 GCAAGACTGCTCCTGGACAGTGG + Intergenic
1051349428 9:16185017-16185039 GCCAGGCTGCTACTCCTCAGGGG - Intergenic
1055800849 9:80033905-80033927 GCCAGCATGCTTCTGGTGAGAGG + Intergenic
1056788686 9:89611226-89611248 GCAGGAAGGCTCCTGGTCAGAGG + Intergenic
1061101188 9:128493737-128493759 GTCACAATGCTACAGGTCAGAGG - Intronic
1062194625 9:135266044-135266066 GCCAGGAGGCTGCTGGTGAGGGG + Intergenic
1203784579 EBV:120341-120363 GCCAGTATGCGCCTGGTCCGAGG - Intergenic
1185521991 X:747373-747395 CACAGATTGCTACTAGTCAGTGG - Intergenic
1185746417 X:2577083-2577105 GCCAGGTTGCCAGTGGTCAGTGG - Intergenic
1187266327 X:17737391-17737413 GCCAGACTCCGATTGGTCAGCGG + Intergenic
1188991649 X:36827906-36827928 TCCAGAAAGCTACTGGACAAGGG + Intergenic
1191816667 X:65253350-65253372 GCCAGTATTCTACAGGTCTGTGG - Intergenic
1196493747 X:116299004-116299026 TGGAGAATGCTACTGCTCAGGGG - Intergenic
1198582489 X:138081314-138081336 AGCAGAATGCTGCTTGTCAGGGG + Intergenic