ID: 920204522

View in Genome Browser
Species Human (GRCh38)
Location 1:204281999-204282021
Sequence TGATTTCTCTCCCTTGTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920204522_920204527 -6 Left 920204522 1:204281999-204282021 CCGTGGACAAGGGAGAGAAATCA 0: 1
1: 0
2: 0
3: 33
4: 287
Right 920204527 1:204282016-204282038 AAATCACAAATCAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 209
920204522_920204531 21 Left 920204522 1:204281999-204282021 CCGTGGACAAGGGAGAGAAATCA 0: 1
1: 0
2: 0
3: 33
4: 287
Right 920204531 1:204282043-204282065 GGTTTCTTCCCTTCCAGCTCAGG 0: 1
1: 0
2: 0
3: 25
4: 303
920204522_920204528 0 Left 920204522 1:204281999-204282021 CCGTGGACAAGGGAGAGAAATCA 0: 1
1: 0
2: 0
3: 33
4: 287
Right 920204528 1:204282022-204282044 CAAATCAGGGGGCCAGGTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920204522 Original CRISPR TGATTTCTCTCCCTTGTCCA CGG (reversed) Intronic