ID: 920204527

View in Genome Browser
Species Human (GRCh38)
Location 1:204282016-204282038
Sequence AAATCACAAATCAGGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920204515_920204527 26 Left 920204515 1:204281967-204281989 CCCACCACAGGCAGAAGATAGAA 0: 1
1: 0
2: 0
3: 29
4: 287
Right 920204527 1:204282016-204282038 AAATCACAAATCAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 209
920204516_920204527 25 Left 920204516 1:204281968-204281990 CCACCACAGGCAGAAGATAGAAG 0: 1
1: 0
2: 1
3: 23
4: 212
Right 920204527 1:204282016-204282038 AAATCACAAATCAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 209
920204522_920204527 -6 Left 920204522 1:204281999-204282021 CCGTGGACAAGGGAGAGAAATCA 0: 1
1: 0
2: 0
3: 33
4: 287
Right 920204527 1:204282016-204282038 AAATCACAAATCAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 209
920204517_920204527 22 Left 920204517 1:204281971-204281993 CCACAGGCAGAAGATAGAAGAGA 0: 1
1: 0
2: 4
3: 39
4: 386
Right 920204527 1:204282016-204282038 AAATCACAAATCAGGGGGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920204527 Original CRISPR AAATCACAAATCAGGGGGCC AGG Intronic