ID: 920204528

View in Genome Browser
Species Human (GRCh38)
Location 1:204282022-204282044
Sequence CAAATCAGGGGGCCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920204517_920204528 28 Left 920204517 1:204281971-204281993 CCACAGGCAGAAGATAGAAGAGA 0: 1
1: 0
2: 4
3: 39
4: 386
Right 920204528 1:204282022-204282044 CAAATCAGGGGGCCAGGTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 180
920204522_920204528 0 Left 920204522 1:204281999-204282021 CCGTGGACAAGGGAGAGAAATCA 0: 1
1: 0
2: 0
3: 33
4: 287
Right 920204528 1:204282022-204282044 CAAATCAGGGGGCCAGGTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920204528 Original CRISPR CAAATCAGGGGGCCAGGTCC AGG Intronic