ID: 920204531 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:204282043-204282065 |
| Sequence | GGTTTCTTCCCTTCCAGCTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 329 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 25, 4: 303} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920204522_920204531 | 21 | Left | 920204522 | 1:204281999-204282021 | CCGTGGACAAGGGAGAGAAATCA | 0: 1 1: 0 2: 0 3: 33 4: 287 |
||
| Right | 920204531 | 1:204282043-204282065 | GGTTTCTTCCCTTCCAGCTCAGG | 0: 1 1: 0 2: 0 3: 25 4: 303 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920204531 | Original CRISPR | GGTTTCTTCCCTTCCAGCTC AGG | Intronic | ||