ID: 920204531

View in Genome Browser
Species Human (GRCh38)
Location 1:204282043-204282065
Sequence GGTTTCTTCCCTTCCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920204522_920204531 21 Left 920204522 1:204281999-204282021 CCGTGGACAAGGGAGAGAAATCA 0: 1
1: 0
2: 0
3: 33
4: 287
Right 920204531 1:204282043-204282065 GGTTTCTTCCCTTCCAGCTCAGG 0: 1
1: 0
2: 0
3: 25
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920204531 Original CRISPR GGTTTCTTCCCTTCCAGCTC AGG Intronic