ID: 920205125

View in Genome Browser
Species Human (GRCh38)
Location 1:204285915-204285937
Sequence TAGCTGACGCTTGGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 269}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920205116_920205125 -1 Left 920205116 1:204285893-204285915 CCTTCCTGGATTGGCCAACCTCT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205115_920205125 5 Left 920205115 1:204285887-204285909 CCTTTTCCTTCCTGGATTGGCCA 0: 1
1: 0
2: 1
3: 23
4: 255
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205112_920205125 13 Left 920205112 1:204285879-204285901 CCTGCTTTCCTTTTCCTTCCTGG 0: 1
1: 0
2: 6
3: 119
4: 985
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205110_920205125 17 Left 920205110 1:204285875-204285897 CCCTCCTGCTTTCCTTTTCCTTC 0: 1
1: 6
2: 104
3: 990
4: 4787
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205109_920205125 20 Left 920205109 1:204285872-204285894 CCTCCCTCCTGCTTTCCTTTTCC 0: 1
1: 1
2: 19
3: 239
4: 2008
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205117_920205125 -5 Left 920205117 1:204285897-204285919 CCTGGATTGGCCAACCTCTAGCT 0: 1
1: 0
2: 1
3: 10
4: 111
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205108_920205125 26 Left 920205108 1:204285866-204285888 CCTGTTCCTCCCTCCTGCTTTCC 0: 1
1: 0
2: 11
3: 132
4: 1274
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269
920205111_920205125 16 Left 920205111 1:204285876-204285898 CCTCCTGCTTTCCTTTTCCTTCC 0: 1
1: 1
2: 28
3: 331
4: 2096
Right 920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920205125 Original CRISPR TAGCTGACGCTTGGGGGAGG AGG Intronic
901236518 1:7670208-7670230 TAGCACAGGGTTGGGGGAGGGGG + Intronic
902713278 1:18255181-18255203 AAACTGAGGCTTGGAGGAGGGGG + Intronic
904712940 1:32444658-32444680 TAGCTGACATTTGGGGGTGGGGG + Intergenic
904771903 1:32885653-32885675 TTGCTGAGGCTGGGGGCAGGAGG + Intergenic
905290797 1:36920626-36920648 GAGCTGGTGCATGGGGGAGGTGG - Intronic
905685250 1:39902687-39902709 TAGCCCCCGCTTTGGGGAGGCGG + Intergenic
905874484 1:41423480-41423502 GAGCTGAATCTTGCGGGAGGGGG - Intergenic
907292634 1:53426547-53426569 TAGCAAACTCCTGGGGGAGGAGG - Intergenic
907521260 1:55024851-55024873 TAGCAAACTCCTGGGGGAGGAGG - Intergenic
911155385 1:94631234-94631256 TGGCTGGGGCTTGGGGGAGTTGG - Intergenic
913010533 1:114678646-114678668 GAGCTGACAGTTGGTGGAGGTGG + Intronic
913251251 1:116913392-116913414 TAGCTGGAGCTGGGAGGAGGAGG + Intronic
914422310 1:147540784-147540806 TAGCTGGAGATTGGGGGAGTAGG - Intergenic
915521901 1:156450788-156450810 TTGCTGAGGATGGGGGGAGGCGG - Intergenic
915980748 1:160418576-160418598 GAGCTGATCCTTGGGGGAAGGGG - Intronic
917059191 1:171018026-171018048 TGGCTGTCCCTTGGTGGAGGGGG - Intronic
917795998 1:178533248-178533270 TGGCTGAGGCTTGAGGCAGGAGG - Intronic
919220707 1:194625045-194625067 TGGCTGCCCCTTGGTGGAGGAGG - Intergenic
920205125 1:204285915-204285937 TAGCTGACGCTTGGGGGAGGAGG + Intronic
920501078 1:206485872-206485894 CAGCTGGGGCCTGGGGGAGGGGG - Intronic
922048415 1:221968206-221968228 TAGCAAACTCCTGGGGGAGGAGG - Intergenic
922756770 1:228101301-228101323 TATCTGCCTCTTGGGGGTGGGGG - Intronic
923053083 1:230402494-230402516 GAGCTCACTGTTGGGGGAGGGGG + Intronic
923784419 1:237053833-237053855 TATCTAAGGCTTGGTGGAGGAGG + Intronic
924650877 1:245926183-245926205 TTGCTGATGCTTTGTGGAGGTGG - Intronic
924711514 1:246533496-246533518 TGCCTGAGGGTTGGGGGAGGGGG - Intergenic
1062864520 10:840116-840138 TAGAGGACGCTTGGCGGGGGTGG + Intronic
1063865779 10:10363748-10363770 TAGCTTAGGCTGGGAGGAGGAGG + Intergenic
1063907966 10:10799602-10799624 AAGCTGAGGCCTGGGGGTGGGGG - Intergenic
1064370425 10:14747812-14747834 TGGCTGCCCCTTGGTGGAGGGGG + Intronic
1067223907 10:44363230-44363252 TTCCTGAGCCTTGGGGGAGGCGG - Intergenic
1069370988 10:67747260-67747282 TGGCTGCCCCTTGGTGGAGGGGG - Intergenic
1069531089 10:69220177-69220199 TAGCTGAGGTTTAGTGGAGGGGG - Intergenic
1070050771 10:72887406-72887428 GAGCTGACGACTGGGGGTGGTGG - Exonic
1070801448 10:79246675-79246697 CAGCCGAGGCTTGGGGAAGGAGG - Intronic
1071669855 10:87598228-87598250 TAGCTGGCACTTTGGGGAGGTGG + Intergenic
1074923774 10:118046708-118046730 GAGCTGAGGCGAGGGGGAGGAGG - Intergenic
1075518665 10:123130366-123130388 TAGCAGATGCTAGGGGGATGAGG - Intergenic
1075554994 10:123424143-123424165 TACCTGAGGCTGGGGGGAGGAGG + Intergenic
1076421596 10:130335893-130335915 TGACTGACCCTTGGAGGAGGGGG - Intergenic
1076848849 10:133083180-133083202 AAACTGACGCTGGGGGGAGACGG + Intronic
1077119547 11:900540-900562 TAGCTCACGGCTGGGGAAGGGGG - Intronic
1077403358 11:2369645-2369667 TGCCTGACACTTGGGGGATGAGG - Intergenic
1078691295 11:13582940-13582962 TGGCTGTCCCTTGGTGGAGGCGG - Intergenic
1079256869 11:18838245-18838267 TAGCTATCCCTTGGTGGAGGGGG - Intergenic
1080227359 11:29975659-29975681 TAGCAAACTCGTGGGGGAGGAGG - Intergenic
1080640894 11:34157697-34157719 TAACTGACGGATGTGGGAGGAGG - Intronic
1083188770 11:61034777-61034799 GAGCTGATGCTGGGGGCAGGGGG - Intergenic
1083293901 11:61705026-61705048 GAGCTGAGACTGGGGGGAGGGGG + Intronic
1083889872 11:65590414-65590436 CAGCTGGGGGTTGGGGGAGGGGG - Intronic
1086875564 11:92091528-92091550 TAGTTGAAGGGTGGGGGAGGTGG - Intergenic
1087216721 11:95502895-95502917 TTCCTGACTATTGGGGGAGGAGG - Intergenic
1087896776 11:103594885-103594907 TAGCTTTAGCTTGGGGGAGGCGG - Intergenic
1089364362 11:117911985-117912007 TAGCTGCTGCTTGGAGGAGTTGG - Intronic
1089528605 11:119112615-119112637 AAGCTGACCCCTGGGGTAGGTGG + Intronic
1090376383 11:126292575-126292597 GAGCTGAGGCTTGGGGGTAGTGG - Exonic
1090604061 11:128403220-128403242 TAGCTCACACTCGGGGGGGGGGG - Intergenic
1092039394 12:5370697-5370719 GAGGGGAAGCTTGGGGGAGGGGG - Intergenic
1093235127 12:16600710-16600732 TGACTGTCGCTTGGGAGAGGTGG - Exonic
1093303355 12:17479736-17479758 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
1094011788 12:25817400-25817422 CAACTGGCTCTTGGGGGAGGAGG - Intergenic
1095975657 12:47939369-47939391 TGGGTGGGGCTTGGGGGAGGTGG - Intronic
1096004369 12:48157151-48157173 TCGCTGAGGCTAGGGGGCGGGGG + Intronic
1096157560 12:49348975-49348997 ATGCTGACCCTGGGGGGAGGTGG + Exonic
1096296954 12:50392131-50392153 TAGCTGGGGATTGGGGGTGGGGG + Intronic
1096438988 12:51622763-51622785 CAGCCCACGCTTGGGGGAGGAGG + Intronic
1096781109 12:53992632-53992654 TGGCTGATGCCAGGGGGAGGAGG + Intronic
1096989051 12:55783572-55783594 TAGGGGAGGCTGGGGGGAGGTGG + Intronic
1097226387 12:57478982-57479004 TAGCAGAAGCTTGAGGGAGGGGG + Intronic
1098612301 12:72474433-72474455 TGCCAGAGGCTTGGGGGAGGAGG - Intronic
1098653826 12:73005425-73005447 TAGCAGGCTCCTGGGGGAGGAGG + Intergenic
1099502629 12:83432520-83432542 TGGCTGCCCCTTGGTGGAGGGGG + Intergenic
1105668410 13:22586356-22586378 TGGCTGTCCCTTGGTGGAGGGGG + Intergenic
1108313828 13:49219861-49219883 TAGCTGCCGCTTGACGGTGGAGG - Intergenic
1109936445 13:69291702-69291724 TATGTGACTCTTGGGGGAGGGGG - Intergenic
1110300458 13:73920730-73920752 GAGATGACTCTTGAGGGAGGGGG - Intronic
1110456386 13:75694698-75694720 TAGCTGAGTCTTGGGTGAGAGGG + Intronic
1112734705 13:102402647-102402669 TGACTGGCGCTTGGCGGAGGAGG - Intergenic
1112889316 13:104211518-104211540 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
1113527766 13:110994180-110994202 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
1114271662 14:21103935-21103957 GAGCTGACGCTTGGCAGAGCTGG + Intronic
1114937853 14:27566291-27566313 TACCAGAAGCTTGGGGGTGGGGG + Intergenic
1115924263 14:38413073-38413095 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
1116573456 14:46546178-46546200 TAGCAAGCTCTTGGGGGAGGAGG - Intergenic
1116691407 14:48111396-48111418 CAGATGACTCTTGGTGGAGGTGG + Intergenic
1117135312 14:52730011-52730033 GCGCAGACGCTTGGGGGTGGGGG - Intergenic
1117179520 14:53177820-53177842 TAGCTGACAGTTGGGGGGTGGGG + Intergenic
1118920749 14:70147739-70147761 TATCTGAAGCATGGGGGTGGGGG - Intronic
1120204684 14:81574869-81574891 CAGCGGAGGCTTGGGGGAAGTGG + Intergenic
1121522135 14:94593457-94593479 TAGCTGGCTCATGGGGGAGCTGG - Intronic
1121706846 14:96002590-96002612 TGGCTGTCTCTTGGTGGAGGGGG - Intergenic
1122414384 14:101541879-101541901 TAGCTGCAGCTGGGAGGAGGGGG - Intergenic
1123061636 14:105597199-105597221 TGGGTGAGGCTTGGGGGACGGGG + Intergenic
1123086374 14:105718929-105718951 TGGGTGAGGCTTGGGGGACGGGG + Intergenic
1124038614 15:26079932-26079954 TTACTGACTTTTGGGGGAGGGGG - Intergenic
1125759113 15:42085037-42085059 GAGCAGACGCTTGGGGAGGGAGG - Intronic
1129160824 15:73746773-73746795 TGAGTGACGCCTGGGGGAGGGGG + Intronic
1129663353 15:77565641-77565663 TGGCTGCCGCGTGGGGAAGGGGG - Intergenic
1130843457 15:87723304-87723326 CAGGTGAGGGTTGGGGGAGGGGG - Intergenic
1131347746 15:91666494-91666516 TACTAGATGCTTGGGGGAGGGGG + Intergenic
1133336626 16:5010847-5010869 GAGCTGACGCCTGGGGGTGGGGG - Intronic
1134089957 16:11386238-11386260 GAGCTGTGGCTTGGGGGTGGGGG + Intronic
1135070500 16:19347563-19347585 TATCAGGGGCTTGGGGGAGGGGG - Intergenic
1136017870 16:27416774-27416796 GAGCTGAGGCTGAGGGGAGGGGG - Intronic
1136375037 16:29860424-29860446 AAGCTGAGGCGTGGAGGAGGAGG - Intronic
1138343079 16:56303430-56303452 GAGCTGACTCTTGGGGCAGCTGG - Intronic
1138882277 16:61030931-61030953 TGGCTGCCTCTTGGTGGAGGGGG + Intergenic
1139497013 16:67327049-67327071 TACCTGAGGCTGGGGGGCGGGGG + Intronic
1139730939 16:68944627-68944649 TAGCTGACTCGTGGGAGAGAGGG + Intronic
1141864252 16:86739268-86739290 TAGCTGAGGCTTGGTGGACTTGG - Intergenic
1142263473 16:89053099-89053121 TGGCAGACCGTTGGGGGAGGCGG - Intergenic
1142855253 17:2725459-2725481 GAGCCGACGCGTGGGGAAGGAGG - Intergenic
1143019197 17:3907864-3907886 GAGCTGATGCAGGGGGGAGGAGG + Intronic
1143156878 17:4843059-4843081 TAGCTAAGGTTTGGAGGAGGTGG + Intronic
1143175285 17:4951550-4951572 AAGTGGAGGCTTGGGGGAGGTGG + Intronic
1144549680 17:16228810-16228832 TACCAGAGGCTTGGGAGAGGAGG - Intronic
1145960898 17:28886041-28886063 TGCCTGACGCCTGGGGGCGGGGG + Intronic
1146519465 17:33515118-33515140 TAGCTGGCACTTGGTGGATGGGG + Intronic
1148150015 17:45391404-45391426 GAGCTGAGGCTTGGGGGAGGAGG + Intergenic
1150134904 17:62690161-62690183 TAGCTTATTCTTCGGGGAGGAGG - Exonic
1150291156 17:63983226-63983248 CAGGTGAAGCTTGGGGGTGGGGG - Intergenic
1150594664 17:66593542-66593564 CAGCTGAAACTTGGGGGTGGAGG + Intronic
1150808799 17:68339986-68340008 TAGATGAGGGTTGGGTGAGGTGG + Intronic
1151377340 17:73698980-73699002 CAGCTCATACTTGGGGGAGGGGG - Intergenic
1151613061 17:75189374-75189396 TAACTTATGATTGGGGGAGGAGG + Intergenic
1151850104 17:76685022-76685044 TGGCGGGCTCTTGGGGGAGGGGG - Intronic
1152193139 17:78900676-78900698 CAGATAACCCTTGGGGGAGGTGG + Intronic
1155053084 18:22165102-22165124 TGGCTGCCGCCTGGGGAAGGTGG - Intergenic
1158676935 18:59528979-59529001 TGGCTGCCTCTTGGCGGAGGGGG + Intronic
1159966217 18:74598190-74598212 CAGCTGGGGCCTGGGGGAGGAGG - Intronic
1160720789 19:596105-596127 TGGATGAAGCTTGGGGGAGGAGG - Intronic
1160868846 19:1267941-1267963 CAGCTGCTGCCTGGGGGAGGGGG + Intronic
1162327474 19:10007562-10007584 TTGCTGAGGGTTGGGGGATGGGG - Intronic
1162549583 19:11351088-11351110 TGGCAGATGCCTGGGGGAGGGGG + Intronic
1164121138 19:22266265-22266287 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
1164178801 19:22801946-22801968 TGGCTGTCCCTTGGTGGAGGGGG + Intergenic
1165407788 19:35641691-35641713 CAGCTGACGCTGGGGGCGGGTGG + Intergenic
1166498940 19:43326960-43326982 TAGCAAGCGCCTGGGGGAGGAGG + Intergenic
925029416 2:637557-637579 TAGCAGACGCTTGGAGAAGCAGG + Intergenic
926092824 2:10061538-10061560 AAGCTGAGCCCTGGGGGAGGTGG + Intronic
926337378 2:11874984-11875006 GAGCGGACGGTGGGGGGAGGGGG - Intergenic
926435776 2:12836095-12836117 TAGGGGAAGCATGGGGGAGGAGG - Intergenic
927153308 2:20207982-20208004 GAGCTTTCTCTTGGGGGAGGCGG - Intronic
927896401 2:26785498-26785520 TTGCTGACGCTTGGGGTCGCGGG - Intronic
928883014 2:36118530-36118552 AAAATGACACTTGGGGGAGGAGG - Intergenic
929537710 2:42793616-42793638 GAGCTGACGGGTAGGGGAGGAGG + Intergenic
930024637 2:47022647-47022669 CAACTGGCGTTTGGGGGAGGTGG - Intronic
931515634 2:63049423-63049445 AAAGTGTCGCTTGGGGGAGGGGG + Intergenic
932469515 2:71944712-71944734 AAGCTGACCCTTAGGGGATGAGG - Intergenic
932874254 2:75433662-75433684 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
935755336 2:106272042-106272064 GAGCTGACTCTTGGAGGATGGGG - Intergenic
937495442 2:122414266-122414288 TAGCTGAAGACTGAGGGAGGAGG + Intergenic
938934433 2:136116589-136116611 GAGCGCCCGCTTGGGGGAGGAGG - Intronic
940410794 2:153360851-153360873 TGGCTGTCCCTTGGTGGAGGAGG - Intergenic
942360781 2:175168774-175168796 TAGGTGAGGTTTGGGGGAGGCGG + Intergenic
944911252 2:204312506-204312528 TACCTAACACTTGGGGGAGGGGG + Intergenic
945221374 2:207487959-207487981 AAGCTGAGGCTTGGGGCAGCTGG + Intergenic
946371937 2:219286247-219286269 TAGATCCCGCTTGGGGGAGGTGG + Exonic
947065103 2:226216050-226216072 TAGCTGAGGCCTGCAGGAGGTGG - Intergenic
947123328 2:226840144-226840166 CAGCTGGAGCTTGGGGGAGGGGG + Intronic
1170921054 20:20679746-20679768 TAGATGAGGCTTTGGGGAAGAGG - Intronic
1172192336 20:33069452-33069474 TAGCTGAGGCTTAGGGGACAAGG - Intronic
1173618637 20:44419614-44419636 TAGCTGGTGCCTGTGGGAGGAGG - Intronic
1174508695 20:51034696-51034718 TAGGAGAAGCATGGGGGAGGGGG - Intergenic
1175618483 20:60423507-60423529 TAGCTCAGGCTTGGAGGAAGAGG - Intergenic
1176041475 20:63068207-63068229 TGGCTGACGTTTTGGGGAGCAGG + Intergenic
1176042942 20:63075091-63075113 GTGCTGAGGCTTGAGGGAGGGGG - Intergenic
1176987613 21:15455882-15455904 TGGCTGCCTCTTGGTGGAGGAGG + Intergenic
1178987526 21:37319884-37319906 TTGCTGGCGCTAAGGGGAGGGGG + Intergenic
1179403224 21:41103279-41103301 TTGCTGGGGCCTGGGGGAGGGGG - Intergenic
1181791132 22:25267290-25267312 GTGATGAAGCTTGGGGGAGGAGG + Intergenic
1181826942 22:25524320-25524342 GTGATGAAGCTTGGGGGAGGAGG + Intergenic
1182148716 22:28013745-28013767 TAGCAGACGCCTCGGGGATGTGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183753791 22:39740112-39740134 TTGCTGGGGCTTGGAGGAGGGGG + Intergenic
1185270545 22:49927693-49927715 CACGTGCCGCTTGGGGGAGGAGG + Intergenic
949594934 3:5533093-5533115 TAGGGGACACTTGGGGAAGGGGG + Intergenic
951518609 3:23589540-23589562 TAGGTGACTCTTGGGGCAGCTGG + Intronic
952849124 3:37713398-37713420 TAGCTGAGGGTTGGTGGAGGAGG - Intronic
953250772 3:41244435-41244457 TAGCTGAAGCTTGGGGATGGAGG + Intronic
956893024 3:73631054-73631076 TAGCAAAAGCTTGGGGAAGGGGG + Intergenic
958713765 3:97752590-97752612 TAGAAGAGGCTTGGGGCAGGGGG + Intergenic
959288352 3:104443376-104443398 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
960720342 3:120619060-120619082 TAGCTGACAGTTGGTGGCGGGGG + Intergenic
961201920 3:125052202-125052224 TGGCGGAGGCTTGGGGGTGGTGG - Intronic
961396754 3:126598882-126598904 TACCAGAGGCTTGGGGGAGAAGG + Intronic
962630884 3:137274294-137274316 GAGCTGAAGCGGGGGGGAGGGGG + Intergenic
963521623 3:146364305-146364327 TAGCAAACTCCTGGGGGAGGTGG - Intergenic
963627320 3:147689819-147689841 TAGCTGAAGGTTGAGAGAGGTGG + Intergenic
963923295 3:150925880-150925902 TAGCTGCCACCTGGGGAAGGAGG + Intronic
964651654 3:159018012-159018034 AAGATGAGGCATGGGGGAGGAGG + Intronic
967269621 3:187722314-187722336 TAGCTGGGGGTTGGGGGTGGTGG - Exonic
968905562 4:3449160-3449182 AAGCTGCCACTTGGGGGAGAGGG + Intronic
969441588 4:7220253-7220275 TAACCAAGGCTTGGGGGAGGGGG + Intronic
970340673 4:15103395-15103417 TAGCTGAATCATGGGGGCGGGGG + Intergenic
974833531 4:67218285-67218307 AAGCTGAGGCTGGGGGTAGGTGG - Intergenic
976375723 4:84342779-84342801 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
976891485 4:90052951-90052973 TTACTGATGCTTGGGGCAGGTGG + Intergenic
977462034 4:97337488-97337510 TGGCTGTCCCTTGGTGGAGGTGG - Intronic
977508962 4:97937901-97937923 TGGCTGTCGCTTGGTTGAGGGGG + Intronic
978350696 4:107817796-107817818 TTGCTGGGGCCTGGGGGAGGAGG + Intergenic
979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG + Intergenic
980312345 4:131147665-131147687 TACCAGAGGCTTGGGAGAGGAGG - Intergenic
980438770 4:132814673-132814695 TAGCTGACAGTTGTGGGGGGTGG + Intergenic
981273883 4:142875217-142875239 TGGCTGCCCCTTGGTGGAGGGGG - Intergenic
981329084 4:143487857-143487879 TTGCTGCTGCTTGGGGGTGGCGG - Intergenic
984854037 4:184177494-184177516 TGGCTGCCCCTTGGTGGAGGGGG - Intronic
985057398 4:186047659-186047681 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
985797269 5:1972417-1972439 GAGCTGGAGCTTGGGGGAGCTGG + Intergenic
986482945 5:8207065-8207087 TACCAGAGGCTTGAGGGAGGGGG - Intergenic
986499515 5:8384494-8384516 GAGCTGGCTCTTGGGGGATGGGG - Intergenic
986571149 5:9167608-9167630 GAGCTGGCTCTTGGGGGATGGGG - Intronic
987590203 5:19915338-19915360 TAGCTGACCCTTGGACAAGGTGG + Intronic
992468539 5:77030810-77030832 CAGCTCAGGCTCGGGGGAGGTGG - Exonic
992546414 5:77818102-77818124 TAGCTGAGGCTGGGAGGAAGAGG - Intronic
993882696 5:93381520-93381542 TAGCTAAAGATGGGGGGAGGTGG - Intergenic
995125163 5:108571918-108571940 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
996639127 5:125730892-125730914 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
996675758 5:126172541-126172563 TGGCTGTCCCTTGGTGGAGGGGG - Intergenic
997096995 5:130924180-130924202 TAACTGTCCCTTGGTGGAGGAGG - Intergenic
997653282 5:135537386-135537408 TAGCTGACTCTTTGGGTTGGGGG + Intergenic
998693705 5:144614799-144614821 TAGCAAGCTCTTGGGGGAGGAGG + Intergenic
999258361 5:150222417-150222439 CAGCTGAGGCTGGGGAGAGGGGG + Intronic
1001424184 5:171612786-171612808 GAGGTGACACTTGGGGAAGGAGG - Intergenic
1002060914 5:176625564-176625586 CAGCTGAGGCTGGGGGTAGGTGG + Intronic
1002376412 5:178792170-178792192 TAGCTGTCCCTTGGGGCTGGCGG - Intergenic
1004434608 6:15578195-15578217 AAGCCGACGCTGGGAGGAGGGGG + Intronic
1006579905 6:35071146-35071168 AAGCTGAAGTTTGGGGGTGGTGG - Intronic
1006712208 6:36083834-36083856 TGGCTGCCCCTTGGTGGAGGGGG - Intronic
1007577944 6:42938252-42938274 TTGCTCTCCCTTGGGGGAGGTGG + Intronic
1009578623 6:65500902-65500924 TGGATTACGCTTGGGGGTGGGGG + Intronic
1009635792 6:66262749-66262771 TAGCTGACAGTTGGTGGAGCGGG - Intergenic
1010826914 6:80485899-80485921 TAGCAAACTCCTGGGGGAGGAGG + Intergenic
1012063127 6:94512186-94512208 TGGCTGTCTCTTGGTGGAGGGGG - Intergenic
1013801192 6:113946082-113946104 TTACTGATGCTTGGAGGAGGTGG - Exonic
1017711646 6:157174323-157174345 TAACTCACGGTTGGGGGAGAGGG + Intronic
1023223554 7:37945870-37945892 TTGGTGGAGCTTGGGGGAGGGGG - Intronic
1023781902 7:43663739-43663761 TTGCTGGGGCTTGGGGGATGGGG - Intronic
1024955130 7:54910493-54910515 CAGCTGAGTCATGGGGGAGGAGG + Intergenic
1026073963 7:67148783-67148805 TAGCAGAGAATTGGGGGAGGGGG + Intronic
1031777342 7:125919862-125919884 TAGCAAGCTCTTGGGGGAGGAGG - Intergenic
1031820871 7:126499781-126499803 TACCAGAGGCTGGGGGGAGGTGG + Intronic
1032546784 7:132750636-132750658 TAGCTGATGCTTTGGAAAGGAGG - Intergenic
1032924005 7:136580827-136580849 TTTTTGAGGCTTGGGGGAGGGGG + Intergenic
1033868198 7:145718241-145718263 TGGCTGCCCCTTGGTGGAGGAGG + Intergenic
1034275021 7:149820243-149820265 GAGCTGAAGCTTGGGGGTGACGG - Intergenic
1034858512 7:154576713-154576735 TACCAGGCTCTTGGGGGAGGAGG + Intronic
1035620517 8:1033374-1033396 TAGCTGGGGGTTGGGGGTGGTGG + Intergenic
1036339989 8:7906886-7906908 TAGCTAGCTCCTGGGGGAGGAGG + Intergenic
1038916565 8:32031088-32031110 CAGCTGTCTCTTTGGGGAGGTGG + Intronic
1039741400 8:40386266-40386288 GAACTGACTCTTGAGGGAGGTGG - Intergenic
1043803598 8:84643189-84643211 CAGCTGACTTTTGGGGGTGGGGG - Intronic
1044184565 8:89236273-89236295 TAGCTGACAGTTGGCGGGGGTGG + Intergenic
1044755491 8:95457281-95457303 CAGCTGACTCTGGGGGCAGGAGG - Intergenic
1045961808 8:107977583-107977605 TAGCTAAAGTTTGGGGGAGTGGG + Intronic
1047270289 8:123351434-123351456 TATCTGTCCCTTCGGGGAGGGGG + Intronic
1047921968 8:129644557-129644579 TAGCTGGGAGTTGGGGGAGGCGG - Intergenic
1048399473 8:134050916-134050938 CATCTGTCCCTTGGGGGAGGTGG + Intergenic
1049230033 8:141477198-141477220 GAGCTGACCCTTGGGGGATGGGG - Intergenic
1050259258 9:3823960-3823982 AAGCTGACAGTTGGAGGAGGGGG - Intergenic
1050644425 9:7703348-7703370 TTGCTGCTGCTTGGGGGTGGAGG + Intergenic
1050660798 9:7880497-7880519 TGACTGTCGCTTGGTGGAGGGGG - Intronic
1052199800 9:25764190-25764212 TGGCTGCCCCTTGGTGGAGGGGG - Intergenic
1053199086 9:36140608-36140630 AGGCTGATGCTTGGGGGAAGGGG + Intronic
1056475599 9:86948260-86948282 TAGCTGGGGCTGGGGGGTGGCGG - Intergenic
1058530307 9:105899934-105899956 TGGCTGCCTCTTGGTGGAGGTGG + Intergenic
1058909631 9:109508872-109508894 TAGATGACTCTTGGGTGTGGAGG - Intergenic
1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG + Intergenic
1059409964 9:114125644-114125666 TAACTGTGGGTTGGGGGAGGGGG - Intergenic
1060055600 9:120410255-120410277 TGTCTGGCGCTTGAGGGAGGAGG - Intronic
1060098213 9:120812885-120812907 TGGCTGATTCTTGGTGGAGGGGG - Intergenic
1060321062 9:122561852-122561874 TGGCTGTCCCTTGGTGGAGGGGG + Intergenic
1061078334 9:128355217-128355239 TTCCTGAGGGTTGGGGGAGGAGG + Intronic
1061175658 9:128994950-128994972 TAACTGAAGGTTGGGGGAGTGGG + Intronic
1187749772 X:22449359-22449381 TGTCTGGCACTTGGGGGAGGGGG + Intergenic
1190123563 X:47683654-47683676 TAGCTGTCCGTTGGGGGAGGTGG + Intergenic
1190260404 X:48793557-48793579 TAGCTGATGCCTGGAGGTGGGGG - Intronic
1191779097 X:64847577-64847599 TAGCTGATGCATGGGGTTGGAGG - Intergenic
1193164282 X:78263864-78263886 TGGCTGTCCATTGGGGGAGGGGG + Intergenic
1193227284 X:78998632-78998654 TGGCTGCCCCTTGGTGGAGGAGG - Intergenic
1194193569 X:90865598-90865620 TGGCTGCCCCTTGGTGGAGGGGG - Intergenic
1195655919 X:107331599-107331621 AAACTGAAACTTGGGGGAGGGGG + Intergenic
1196032696 X:111108362-111108384 AAGCTGTCTCTTGGAGGAGGTGG - Intronic
1197607046 X:128597177-128597199 TAGCTGTCCTTTGGTGGAGGGGG + Intergenic
1198197136 X:134373932-134373954 GGGCTAACTCTTGGGGGAGGGGG + Intronic
1198214727 X:134545653-134545675 TAGCAGATTTTTGGGGGAGGAGG + Intergenic
1199866020 X:151850964-151850986 TAGTTACCGCTTGCGGGAGGGGG - Intergenic
1200540181 Y:4447980-4448002 TGGCTGCCCCTTGGTGGAGGGGG - Intergenic