ID: 920208460

View in Genome Browser
Species Human (GRCh38)
Location 1:204310911-204310933
Sequence CCGGTGATGATGCGGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920208460 Original CRISPR CCGGTGATGATGCGGGTGTG GGG Intronic
900160930 1:1223497-1223519 CAGGTGAGGAAACGGGTGTGGGG - Intronic
900178011 1:1299201-1299223 CTGCTGCTGATGCGGCTGTGAGG - Intronic
900677480 1:3896936-3896958 CCTGTGATGTTGCTGGTGGGGGG - Intronic
900836262 1:5006716-5006738 CAGGTGGTGATGCGGGTGATGGG + Intergenic
900927067 1:5712427-5712449 CCGGTCATAAAGCGGGTGTCTGG + Intergenic
902512766 1:16975213-16975235 CAGATAATGATGCGGGTGTGGGG + Intronic
907221173 1:52907848-52907870 TCGGTGAGGATCTGGGTGTGGGG - Exonic
912460661 1:109828756-109828778 CAGGGGATGGGGCGGGTGTGGGG + Intergenic
915164727 1:153942175-153942197 CTGGTGATAAGGTGGGTGTGTGG - Exonic
920208460 1:204310911-204310933 CCGGTGATGATGCGGGTGTGGGG + Intronic
1063460128 10:6210090-6210112 AGGGTGATGAGGCGGGTGGGGGG + Intronic
1067318790 10:45198408-45198430 CTGGTGTTGGAGCGGGTGTGGGG - Intergenic
1069987760 10:72295910-72295932 CAGGTGAGGCTGCAGGTGTGGGG + Intergenic
1070848095 10:79540262-79540284 CCGCTGATGAGGCTGGGGTGAGG + Intergenic
1070925682 10:80219907-80219929 CCGCTGATGAGGCTGGGGTGAGG - Intergenic
1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG + Intronic
1072495915 10:95959272-95959294 AAGGTGATGATGCTGGTCTGGGG - Intronic
1073562808 10:104511272-104511294 CAGGTGATGATGAGGGGATGGGG + Intergenic
1076455739 10:130593331-130593353 CAGATGCTGATGCGGTTGTGGGG + Intergenic
1076669447 10:132111526-132111548 CCGGGGGCCATGCGGGTGTGGGG + Intronic
1076777110 10:132704037-132704059 CGGGTGAAGCTGCGTGTGTGTGG - Intronic
1076847421 10:133076153-133076175 CCTGTGATGCTGGGGGAGTGAGG - Intronic
1079388602 11:20001880-20001902 CCTGAGATGATGTGGGGGTGTGG + Intronic
1082159983 11:48880249-48880271 CAGGTGATGCTGCGGGTGTCGGG - Intergenic
1082243525 11:49893617-49893639 CAGGCGATGCTGCGGGTGTCAGG + Intergenic
1082658011 11:55874425-55874447 CAGGTGATGCTGCGGGTGTTGGG + Intergenic
1083749746 11:64754474-64754496 CCGGTGCTCATGGGGGTGGGAGG + Intronic
1086697949 11:89865437-89865459 CAGGCGATGCTGCGGGTGTCGGG + Intergenic
1086708213 11:89979051-89979073 CAGGCGATGCTGCGGGTGTCGGG - Intergenic
1087797967 11:102474056-102474078 CCGGTGGTGTTGGGGGTGGGGGG + Intronic
1089119263 11:116121870-116121892 CAAGTGTTGATGAGGGTGTGGGG + Intergenic
1092259176 12:6943321-6943343 CCGGTTATGAAGCGGGGGTGGGG + Intronic
1095201975 12:39395372-39395394 GCGGTGAAGAAGCGGGTGGGTGG - Intronic
1102573501 12:113841884-113841906 ACTGAGATGATGCCGGTGTGAGG + Intronic
1104244655 12:127026504-127026526 CAGGTGATTTAGCGGGTGTGGGG + Intergenic
1105540519 13:21312250-21312272 GCAGTGATGATGAGGGTGTTAGG + Intergenic
1113717359 13:112521430-112521452 CTGGTGATGCTGCGTTTGTGGGG - Intronic
1119614708 14:76091485-76091507 CAGGTGGTGATGAGGGTCTGAGG - Intergenic
1125516701 15:40324631-40324653 CCGGCGATGGTGGGAGTGTGAGG - Intergenic
1131250020 15:90824249-90824271 CCTTTGATCATGCGGGTGTGAGG - Intergenic
1131517644 15:93089413-93089435 CCGGTGCTGATGCGGGAGGGTGG - Intergenic
1133525647 16:6602838-6602860 CATGTGATGGTGGGGGTGTGTGG - Intronic
1133801040 16:9085729-9085751 CTGGTAATGATGAGGGGGTGGGG + Intergenic
1135983702 16:27168325-27168347 GCGGTGGTGATGAGGGTGTCAGG + Intergenic
1136245016 16:28970120-28970142 CGGGTGATGCAGTGGGTGTGGGG - Intergenic
1136713559 16:32259351-32259373 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1136754352 16:32670080-32670102 TCAGTGATGGTGCTGGTGTGTGG + Intergenic
1136813761 16:33200285-33200307 TCAGTGATGGTGCTGGTGTGTGG - Intronic
1136820237 16:33310365-33310387 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1136826800 16:33366904-33366926 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1136831866 16:33465675-33465697 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1141366830 16:83451051-83451073 CCAGTGATGCTGCTGGTCTGGGG + Intronic
1202992337 16_KI270728v1_random:23259-23281 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1203056499 16_KI270728v1_random:930411-930433 TCAGTGATGGTGCTGGTGTGTGG + Intergenic
1146845433 17:36179075-36179097 GCGGTGATAATGCTGGTGGGGGG + Intronic
1146873648 17:36390918-36390940 GCGGTGATAATGCTGGTGGGGGG + Intronic
1146881007 17:36442006-36442028 GCGGTGATAATGCTGGTGGGGGG + Intergenic
1147065740 17:37921955-37921977 GCGGTGATAATGCTGGTGGGGGG - Intergenic
1149519771 17:57309958-57309980 ACGGTGATGATGGGGGTGCAGGG + Intronic
1150584695 17:66506660-66506682 CGGCTGATGCTGGGGGTGTGGGG + Intronic
1156914262 18:42447149-42447171 CCGGTGTTGAAGAGGGGGTGTGG - Intergenic
1158527725 18:58230376-58230398 CAGGTGATGTTGCGGAAGTGAGG + Intronic
1159693384 18:71521463-71521485 CGGGTGGTGATGAGGGTGGGGGG - Intergenic
1160063086 18:75549958-75549980 CCGGTGAAGATGGGGGTGGAAGG + Intergenic
1161615369 19:5267197-5267219 CCGGTGGTGATGTGGGGGCGGGG + Intronic
1161773439 19:6243658-6243680 CAGGTGATGAAGCGGGGCTGGGG - Intronic
1163449858 19:17370148-17370170 CAGGTGTTGATGAGGATGTGGGG + Intronic
1166017967 19:39997374-39997396 CGGGTGTGGGTGCGGGTGTGAGG + Intronic
924988119 2:288917-288939 GCGGTGGAGATGCGGGTGGGGGG - Intergenic
929539133 2:42806489-42806511 CCAGTGTTGATGAGAGTGTGGGG - Intergenic
929602040 2:43210584-43210606 GGGGTGATGATGGGGGCGTGAGG - Intergenic
930003364 2:46876881-46876903 CCAGTGCTGGTGCAGGTGTGAGG - Intergenic
935828823 2:106978099-106978121 CTGGTGATAATGGGGGTGCGTGG + Intergenic
937358484 2:121213031-121213053 CCAGCCATGATGCGGGCGTGAGG - Intergenic
940139106 2:150473950-150473972 CCGGTGTTGAAGCCAGTGTGTGG + Intronic
948377767 2:237533059-237533081 CCGGTTATGATGCTAGAGTGAGG - Intronic
1169641923 20:7761845-7761867 CCTGAGATGATTCTGGTGTGTGG - Intergenic
1169879456 20:10330715-10330737 CAGGTGATGCTGCTGGTTTGGGG - Intergenic
1172012052 20:31851267-31851289 CAGATGCTGATGCGGGGGTGGGG + Intronic
1172547288 20:35771950-35771972 GTGGCGATGATGCGTGTGTGTGG + Intergenic
1174194041 20:48760416-48760438 CTGGTGGTGATGAGGATGTGGGG - Intronic
1175586135 20:60141569-60141591 CAGGTGATGTTGCTGGTCTGGGG + Intergenic
1176256565 20:64156083-64156105 CAGGTCATGAGGCGGGTGGGGGG + Intronic
1178295859 21:31409586-31409608 GGGGTGGTGATGCTGGTGTGTGG - Intronic
1180670888 22:17552076-17552098 CCTGTGATGTTGCTGCTGTGGGG - Exonic
1182294536 22:29305354-29305376 CGGGTGAGGGTGTGGGTGTGAGG - Intergenic
1182665577 22:31956824-31956846 TCGGTGATGATGGGGGTGGTGGG - Exonic
1184283645 22:43453528-43453550 CTGATGATGATGGGGGTGTGGGG + Intronic
1185079559 22:48702068-48702090 CCGGGGATGATACGCATGTGTGG + Intronic
1185362882 22:50419637-50419659 CCAGTGATGATGAGGGTCTAAGG - Intronic
953017317 3:39090127-39090149 CCAGTGTTGGTGCAGGTGTGGGG - Intronic
960353253 3:116619029-116619051 CTGGTGATGATATGGGTGGGTGG - Intronic
968544779 4:1193319-1193341 CCAGTGATGAAGGGTGTGTGGGG - Intronic
969517189 4:7654366-7654388 CCTGGGATGAGGAGGGTGTGGGG - Intronic
969641417 4:8401410-8401432 CGGGTGACAATGGGGGTGTGGGG - Intronic
972628442 4:40822894-40822916 CTTGCGATGATGCTGGTGTGGGG + Intronic
973293113 4:48489895-48489917 CCGGTGAGGGAGCGGGGGTGGGG + Intergenic
975579309 4:75892340-75892362 CAGGTTATAATGCGGGGGTGGGG + Intronic
983399969 4:167250352-167250374 GCTGGGATGATGCAGGTGTGTGG - Intergenic
988503022 5:31799215-31799237 CCTCTGATGATGCTGGTGTCTGG + Exonic
988846933 5:35136691-35136713 CCGGTGAGGTTGAGGGTGGGCGG - Intronic
992351453 5:75933180-75933202 TTGGTGATGATGCGGGGGTAGGG - Intergenic
992495855 5:77292516-77292538 ACAGTGATGATGAGGGTCTGGGG - Intronic
992887817 5:81176516-81176538 GCGGTGATGATGGAGGGGTGGGG + Intronic
994094024 5:95832553-95832575 CAGGTCATGATGGGGGTGGGTGG + Intergenic
994736512 5:103562798-103562820 CCGGTGGAGATCCGGGGGTGGGG + Intergenic
997371524 5:133364276-133364298 CCGGTTCTGTTGGGGGTGTGGGG + Intronic
999647253 5:153730219-153730241 CAGGTGATGCTGCTGGTCTGAGG + Intronic
1000289556 5:159857970-159857992 GTGGTGATGATGTGTGTGTGTGG - Intergenic
1001207705 5:169779697-169779719 CATGGGATGATGCGGGGGTGGGG - Intronic
1003977130 6:11354880-11354902 GCTGGGAGGATGCGGGTGTGTGG + Intronic
1004262701 6:14122033-14122055 TGGGTGATGCTGCGGGGGTGAGG + Intronic
1006766264 6:36509601-36509623 CCGGAGATGAGGTGGGGGTGGGG + Intronic
1008211476 6:48729751-48729773 CTGGTGATGATCAGGGTGGGTGG - Intergenic
1010747895 6:79584765-79584787 CCAGTGTTGATGAGAGTGTGGGG + Intergenic
1013305463 6:108843550-108843572 CCGGTGATGGTGGGGGTTGGTGG + Intergenic
1014925571 6:127266777-127266799 CCGGTGCGGGTGCGGGTGCGCGG + Exonic
1016332241 6:142965657-142965679 ACAGTGATGATGGGGGTTTGGGG - Intergenic
1022101273 7:27170259-27170281 CCGGTTATTTTGCGGGTGTCTGG - Intronic
1023866948 7:44242842-44242864 CCTGTGATAGTGTGGGTGTGGGG - Intronic
1029776749 7:102688652-102688674 GCGCAGATGATGCGGGGGTGAGG + Intergenic
1030007522 7:105133595-105133617 TAGGGGATGATGTGGGTGTGAGG - Intronic
1034869749 7:154673565-154673587 TCTGTGATGATGCTGGTCTGGGG + Intronic
1035368880 7:158366145-158366167 CCAGGGATGCTGTGGGTGTGTGG - Intronic
1035368894 7:158366264-158366286 CCAGGGATGCTGTGGGTGTGTGG - Intronic
1035368914 7:158366388-158366410 CCAGGGATGCTGTGGGTGTGTGG - Intronic
1035368925 7:158366453-158366475 CCAGGGATGCTGTGGGTGTGTGG - Intronic
1036647545 8:10621202-10621224 CCAGTGATAATGCGATTGTGGGG + Intronic
1039089438 8:33812715-33812737 CCAGTGAAGATGGGGGTGAGAGG + Intergenic
1042225746 8:66513158-66513180 CCAGTGATGATGGAGGTGTGAGG + Intronic
1049272371 8:141702766-141702788 CCAGGCATGATGAGGGTGTGAGG - Intergenic
1051394103 9:16600711-16600733 AAGGTAATGATGCGGGGGTGCGG + Intronic
1057275178 9:93672519-93672541 CAGGTGCAGATGCAGGTGTGGGG + Intronic
1061511859 9:131066592-131066614 ACGATGATGATGAGGGTGTGAGG + Intronic
1190459887 X:50661985-50662007 ATGCTGATGCTGCGGGTGTGGGG - Intronic
1192875810 X:75228474-75228496 CATTTGATGATGCTGGTGTGGGG - Intergenic
1196966801 X:121065116-121065138 CCAGTGATGATGTGTGTTTGGGG + Intergenic