ID: 920211302

View in Genome Browser
Species Human (GRCh38)
Location 1:204330803-204330825
Sequence CAGGGTGATCTAGGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920211302_920211311 25 Left 920211302 1:204330803-204330825 CCCTCCTTCCCTAGATCACCCTG 0: 1
1: 0
2: 2
3: 32
4: 309
Right 920211311 1:204330851-204330873 CTCCAGCCTCATACTGAGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920211302 Original CRISPR CAGGGTGATCTAGGGAAGGA GGG (reversed) Intronic
900237839 1:1600939-1600961 CTGGGTGATCTATGCAGGGACGG - Intergenic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900475495 1:2874547-2874569 CAGAGGGGTCTAGGGGAGGATGG + Intergenic
901078585 1:6570989-6571011 CAGGGTGATGTTGGGCAGCAGGG - Exonic
901680259 1:10908990-10909012 CCGTGTGTTCCAGGGAAGGATGG + Intergenic
902623272 1:17662681-17662703 CAGGGTATGGTAGGGAAGGATGG + Intronic
902864664 1:19270213-19270235 CAGGGGAAGGTAGGGAAGGAAGG + Intergenic
902866887 1:19285649-19285671 CAGGGGAAGGTAGGGAAGGAAGG + Intronic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
905182468 1:36175704-36175726 CAGGGTGGCCTAGGGCAGGCAGG + Intronic
905282968 1:36860685-36860707 CAGGGTGGGCTGGTGAAGGAAGG + Intronic
905548614 1:38818575-38818597 GCGGGTGGTCTCGGGAAGGAGGG - Intergenic
905630094 1:39513789-39513811 CCAGGTCATCTAGGGAAGGAGGG + Intronic
905667665 1:39772401-39772423 CCAGGTCATCTAGGGAAGGAGGG - Intronic
905672699 1:39802694-39802716 CACGGTGAAGTGGGGAAGGACGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906346833 1:45020957-45020979 CATGGGGGTCTGGGGAAGGAAGG - Intronic
911435955 1:97857622-97857644 TAGGGTGAGCTACGGAAGAAGGG - Intronic
912373777 1:109193824-109193846 GAGGGAGCTCCAGGGAAGGAAGG - Intronic
913349016 1:117837578-117837600 CAGAGTGATCTAGGGGCAGAAGG - Intergenic
913595593 1:120373070-120373092 CAGCATGATAAAGGGAAGGAAGG - Intergenic
913670546 1:121094134-121094156 CACGGTCATTCAGGGAAGGATGG + Intronic
913715118 1:121526035-121526057 GAGGGTGTTCTTGGGAGGGAAGG + Intergenic
914022312 1:143881573-143881595 CATGGTCATTCAGGGAAGGATGG + Intergenic
914091684 1:144505905-144505927 CAGCATGATAAAGGGAAGGAAGG + Intergenic
914306861 1:146427955-146427977 CAGCATGATAAAGGGAAGGAAGG - Intergenic
914595189 1:149144843-149144865 CAGCATGATAAAGGGAAGGAAGG + Intergenic
914660797 1:149789514-149789536 CACGGTCATTCAGGGAAGGATGG + Intronic
915296617 1:154925907-154925929 CACAGTGATCTAGGGCAGGAAGG + Intronic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
916194548 1:162211094-162211116 CAGGCTCATCTTGGGAATGAGGG + Intronic
917140545 1:171830761-171830783 GAGGGTCATCAAGGGAAGCATGG + Intergenic
917671001 1:177273474-177273496 CTCGGTGACCTAGAGAAGGAAGG - Exonic
918151019 1:181798395-181798417 CAGGGAGCTGTAGGAAAGGAGGG - Exonic
918625654 1:186653484-186653506 CATGGTAAACTAGGGAAGGGAGG + Intergenic
919777852 1:201205894-201205916 CAGGGTGTTCCAGGGATGGATGG - Intronic
919946009 1:202319305-202319327 CAGTGTGATCTATAGCAGGATGG + Exonic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
921308126 1:213817260-213817282 CAGGGAGGTCCAGGGACGGAAGG - Intergenic
922414026 1:225403883-225403905 CAGGGGGATCTTGGGAAGCTGGG - Intronic
922756404 1:228099504-228099526 CAGGCCGATGGAGGGAAGGACGG - Intergenic
923735061 1:236598793-236598815 CATGGTGATCCAGGGTAGGGGGG - Intronic
923815024 1:237367967-237367989 CAGTCTGATCAAGGGGAGGAGGG + Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924700737 1:246449463-246449485 CAGTGTGATATGGGGCAGGAGGG + Intronic
1064245472 10:13664433-13664455 CAGGATGAGATAGGGAAAGATGG + Intronic
1065857534 10:29842412-29842434 CAGGGGGATCCTGGGAGGGAAGG - Intergenic
1067542433 10:47165740-47165762 CAGCGTGATCACGAGAAGGAGGG + Intergenic
1068150256 10:53122325-53122347 CTGGTTGATCTGGGGAAGAAGGG - Intergenic
1069655070 10:70081627-70081649 CATGGTGACCTTGGCAAGGACGG + Intronic
1073055518 10:100698302-100698324 CAGGGTGATCGGAGGATGGAGGG - Intergenic
1073944029 10:108730144-108730166 GAGGGAGATAGAGGGAAGGAGGG + Intergenic
1074197603 10:111203098-111203120 CAGGGTTGTCTAGGTAGGGAAGG + Intergenic
1074284483 10:112085278-112085300 CAGTGTTGTCTAGGGAGGGATGG - Intergenic
1075468829 10:122672710-122672732 CTGGGTGGTCTAGAGAGGGAGGG - Intergenic
1075729672 10:124628714-124628736 CTGGGAGATCTAGGATAGGAAGG + Intronic
1075922464 10:126224693-126224715 CAAGGTGAGCCAGGGAAGGCAGG - Intronic
1076799865 10:132815881-132815903 TAGGCTGGCCTAGGGAAGGATGG + Intronic
1077462618 11:2718210-2718232 GAGGGGGATGTGGGGAAGGACGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078458791 11:11497012-11497034 CAGAGTGAGCAAGAGAAGGATGG - Intronic
1080068709 11:28052356-28052378 CAGAGAGATAAAGGGAAGGAAGG - Intronic
1081961229 11:47139068-47139090 CAGTATGATATAGGGAAGGTAGG - Intronic
1082884200 11:58066599-58066621 CAGGGTGCTAGAGGCAAGGATGG - Intronic
1083096911 11:60260329-60260351 CAGGGTGATATATGGATGTAAGG + Intergenic
1083792898 11:64997198-64997220 GAGGGTGTTCTAGGGGAGGGAGG + Intergenic
1083885586 11:65572124-65572146 CAGGATGCTCAGGGGAAGGAGGG - Intronic
1084272898 11:68038585-68038607 CAGGGTGGTCAAGAGCAGGAAGG + Intergenic
1084935748 11:72585684-72585706 CAGTGAGCCCTAGGGAAGGAAGG - Intronic
1085012036 11:73147981-73148003 CAGGCTGAGCTGGGTAAGGAGGG + Intergenic
1085936608 11:81153177-81153199 GAGGGCCATGTAGGGAAGGATGG - Intergenic
1087957402 11:104305272-104305294 AATGATGATCTAGTGAAGGAAGG + Intergenic
1088242341 11:107785331-107785353 CTGGTTGATCTGGGGAAGGGGGG + Intergenic
1088243804 11:107797304-107797326 CAGAATGGGCTAGGGAAGGAGGG + Intronic
1088798782 11:113286879-113286901 AAGGGTGATGTAGGGGATGATGG - Intergenic
1089093737 11:115900452-115900474 CGGGCTGGTCTAGGGAAAGAGGG + Intergenic
1089627452 11:119760696-119760718 CTGGGAGATCTAGGGAGGGAGGG - Intergenic
1091238216 11:134035613-134035635 CTGTGTGATGTAGGGAAGGATGG - Intergenic
1091765917 12:3119833-3119855 CAGGTTGGGCTAGGGCAGGAGGG + Intronic
1092047454 12:5442157-5442179 CAGGGAGAACAAGGGAAGCAAGG + Intronic
1092239217 12:6827179-6827201 CAGGGTCAGCTGGGGAAAGATGG - Exonic
1096182688 12:49559293-49559315 CAGGGTGATCTGGGGAAATGGGG + Exonic
1097046418 12:56190167-56190189 CTGGGTGACCCAGGGAGGGAGGG - Intergenic
1099440934 12:82698913-82698935 CAGGGTGGGATAGGGCAGGATGG + Intronic
1099763802 12:86956123-86956145 GGGGGTGATGTGGGGAAGGAGGG - Intergenic
1100821822 12:98438938-98438960 CAGGGGGATTAAGGGAAGAAGGG + Intergenic
1102500506 12:113349004-113349026 CAGAGGGAGCAAGGGAAGGAGGG - Intronic
1102513320 12:113430072-113430094 AAGGGTGATGTGTGGAAGGATGG - Intronic
1104262170 12:127194342-127194364 CAGGGGGAAGGAGGGAAGGAGGG - Intergenic
1107015402 13:35704859-35704881 CTGGGTGAGCTAGTGAGGGAAGG + Intergenic
1107425102 13:40284598-40284620 CAGGGGTGACTAGGGAAGGAGGG + Intergenic
1107741682 13:43456761-43456783 CAGTGTGAGCTAGGGAGGGCAGG + Intronic
1108743545 13:53364794-53364816 CAGGGTATTCTATGGAAGCAAGG + Intergenic
1109624860 13:64961886-64961908 AAAGGTGATTTAGGAAAGGAGGG + Intergenic
1110394270 13:75011797-75011819 CAGGGTGCCCTAGGCAAGGAAGG - Intergenic
1111134731 13:84026576-84026598 CAGAGGGATCCAGGGCAGGAAGG - Intergenic
1113361391 13:109634856-109634878 GATGGTCATCTAGGGATGGAAGG - Intergenic
1114613953 14:24058648-24058670 CAAGGTGAGGTAGGGAAGGCAGG - Intronic
1118174251 14:63422330-63422352 CATGGGGACCTAGGGAGGGAAGG - Intronic
1118847097 14:69555644-69555666 CAGGGTGAGATGGGGCAGGAGGG + Intergenic
1120791655 14:88589747-88589769 CAGGTGGAACAAGGGAAGGAGGG - Intronic
1122914593 14:104852426-104852448 CAGGGTGAGCCTAGGAAGGAAGG - Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124624276 15:31299176-31299198 CAGGGGAATGCAGGGAAGGAGGG + Intergenic
1124651933 15:31480458-31480480 CAGGGTCAGCTAGGGCAGCAGGG + Exonic
1125896935 15:43310371-43310393 CAGGTTAGTCTAGGGAGGGATGG + Intergenic
1126385639 15:48090617-48090639 CAGGGTGACTTAGGGTAGGGTGG + Intergenic
1126678112 15:51179177-51179199 CAGTGTGACCTAGTGAAGAAAGG - Intergenic
1128058257 15:64716970-64716992 CAGGAGGATCTGGGGAAGGGTGG - Intergenic
1131691769 15:94835005-94835027 CAGACTGATATAGAGAAGGAAGG - Intergenic
1132465963 16:77656-77678 CAGGCTGGTCGGGGGAAGGAAGG - Intronic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1133577660 16:7109455-7109477 CAGGTGGATGTATGGAAGGAAGG + Intronic
1134190842 16:12120033-12120055 CTGGGTGGGCTAGGGGAGGAGGG + Intronic
1134291743 16:12907153-12907175 AAGGGGGATGGAGGGAAGGAGGG - Intronic
1134687578 16:16169553-16169575 CAGGGTGACCCAGGGAGGGGTGG + Intronic
1135290129 16:21229328-21229350 CAAGGTGAGGTTGGGAAGGAGGG - Intergenic
1135776977 16:25265414-25265436 TTGGGTGATGGAGGGAAGGAAGG - Intergenic
1136236127 16:28914636-28914658 CAGGGGGCGCTGGGGAAGGAGGG - Intronic
1136346513 16:29679424-29679446 CAAGGAGCTCTGGGGAAGGAAGG + Intronic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1139228284 16:65254590-65254612 CAGGATGAGCTAGAGAACGAAGG - Intergenic
1140847521 16:78904581-78904603 CAGGCTGACCTGGGGAAGGGAGG - Intronic
1141891741 16:86930795-86930817 CAGCGTGATGGAGGAAAGGAGGG - Intergenic
1142808887 17:2386136-2386158 CAGGCTGAGGTGGGGAAGGAGGG - Exonic
1142958104 17:3534998-3535020 CAGGGTGGACCAGAGAAGGAGGG - Intronic
1142988747 17:3714745-3714767 CAGGATGATCTAGAGCAGCATGG - Exonic
1143516854 17:7423752-7423774 CATGGTGAACTGGGGAAGGTGGG - Intergenic
1144072670 17:11688742-11688764 CAGAGTGATCAATGGAGGGAGGG + Intronic
1147050669 17:37792116-37792138 CTGAGTGATCTCGGGAAGAAAGG - Intergenic
1147739914 17:42665611-42665633 GAGGGTCATCTGGGGAAGGAAGG + Intronic
1148534624 17:48429538-48429560 CAGGGTGATAAAGGGAGGGCTGG + Intronic
1148598214 17:48873646-48873668 CAGAGTGAAAGAGGGAAGGAGGG - Intergenic
1148792855 17:50183417-50183439 CACCGTGCTCTTGGGAAGGAAGG - Exonic
1149144062 17:53468678-53468700 CATGGTCATCTAGGGCAGGAAGG - Intergenic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1149852163 17:60044340-60044362 CAGGCTGAGGTAGGGAAAGAGGG - Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1151074159 17:71251874-71251896 CATGGTGTTCTAGGGAAGTGTGG - Intergenic
1151709330 17:75792695-75792717 CAGGGTGATTTTGGGAGTGATGG + Intronic
1151816022 17:76471825-76471847 GAAGGTGATGTAGGGCAGGAAGG + Exonic
1151895299 17:76976347-76976369 GGGGGTGAACCAGGGAAGGAAGG + Intergenic
1152249648 17:79205145-79205167 CAGGTCCATCTGGGGAAGGATGG - Intronic
1152892214 17:82888990-82889012 CCGGGTGCTTTTGGGAAGGACGG + Intronic
1153978294 18:10288355-10288377 CAGGGAGATCCAGGCAAGGCAGG - Intergenic
1155242901 18:23880227-23880249 CAGTGAGATTTGGGGAAGGAAGG + Intronic
1155407760 18:25508641-25508663 CAGGCTTATCTAAGGAATGAAGG + Intergenic
1156631461 18:38974387-38974409 CAGGGTGAGCTAGAGAGAGATGG + Intergenic
1157294008 18:46428994-46429016 CAGTGTGACAGAGGGAAGGAGGG - Intronic
1157368482 18:47088387-47088409 GAGGGTGAACTAGAGAAGAATGG + Intronic
1157790566 18:50527641-50527663 CAGAGTGAGCTAGGTAAGAACGG + Intergenic
1158552483 18:58447922-58447944 CAGGGAGATCTCAGGAAGTAAGG + Intergenic
1159435898 18:68416495-68416517 TAGGGTGATTTTGGGAAGGAGGG - Intergenic
1159605779 18:70473349-70473371 CAAGTTAATCTAGGGAAGCAGGG + Intergenic
1160978939 19:1807590-1807612 CAGGGTGACCTGGGGAAGCAGGG - Intronic
1161358071 19:3830543-3830565 AAGGGTGATCTGGGGCGGGAGGG + Intronic
1161735471 19:5989792-5989814 TACGGTGATGTTGGGAAGGAAGG - Intergenic
1161750137 19:6089797-6089819 CAGGGTGGTGGAGGGAAGGGAGG - Intronic
1162304475 19:9863399-9863421 CTGGCTGCTCTAGGGAACGAGGG + Intronic
1162748510 19:12813227-12813249 GGGGGTGCTATAGGGAAGGAAGG + Intronic
1165351772 19:35279599-35279621 CAGGGTGCTGATGGGAAGGAGGG + Exonic
1165855599 19:38877993-38878015 CAGGGTGTTATTAGGAAGGAGGG + Intronic
1166011896 19:39948904-39948926 CAAGGTGGGCAAGGGAAGGAGGG + Intergenic
925604281 2:5642425-5642447 CAGCATGATAAAGGGAAGGAAGG - Intergenic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927431443 2:23029575-23029597 CAGGAAGTTCTATGGAAGGATGG - Intergenic
928208845 2:29308542-29308564 GAGGGAGATCAAGGGAAGGTGGG + Intronic
928423663 2:31160192-31160214 CAGGGAGTTTTATGGAAGGAGGG - Intergenic
929185188 2:39086720-39086742 CTGGATGTTCTAGGAAAGGAAGG + Intronic
930366506 2:50446378-50446400 CAGGGGGAGATAGGAAAGGAAGG - Intronic
935713099 2:105916606-105916628 CAGAGAGAGCTGGGGAAGGAAGG + Intergenic
936110720 2:109662256-109662278 CAGGGTGAACCAGAGAAGGTGGG - Intergenic
937060511 2:118977485-118977507 CAGGGTGCTCCAGGGAAGCAAGG + Exonic
938114250 2:128592429-128592451 CAGGGGGAGCAAGGGAATGAGGG + Intergenic
938743269 2:134252823-134252845 GAGGATGATGTAGGGAAGGTGGG + Intronic
939979967 2:148768057-148768079 CAGGGTCATCCAGGGGAGAAAGG - Intronic
941372150 2:164679194-164679216 CAGGGTGCTTTAGAGAAGTATGG - Intronic
942058924 2:172209954-172209976 CCAGGGTATCTAGGGAAGGAAGG - Intergenic
942255321 2:174091290-174091312 CAGGGAGAACAAGGGAAGAAGGG + Intronic
944086295 2:195851332-195851354 CAGGTTGATCTAGCGAAGCAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944670907 2:201993758-201993780 CAGGCTGATCTAGGAAAAGTGGG + Intergenic
944809209 2:203311579-203311601 CAGGGTGATCTTAGGAAGTTTGG + Intergenic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
946567158 2:220979420-220979442 TAGGTTAATCTAGGGAAGGCAGG + Intergenic
947166140 2:227264187-227264209 GAGAGTGATGTGGGGAAGGATGG + Intronic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
947616719 2:231562452-231562474 CAGTGTGATGTAGGGAGGCAGGG + Intergenic
948558163 2:238831850-238831872 TGGGGTGATTTAGGGAAGGGTGG + Intergenic
1169074077 20:2750834-2750856 GAGGTTGACCTGGGGAAGGAAGG + Intronic
1169978465 20:11357031-11357053 CAGGGTGAGTCAGGGAAGGCTGG - Intergenic
1170176102 20:13471746-13471768 CAGCGTGATCTATGCAAAGACGG + Intronic
1172531935 20:35637387-35637409 AAGGTTGATCTAGGGATGCAGGG - Intronic
1172626807 20:36352085-36352107 CCGGGTGATCCAGGGAAGAGTGG + Intronic
1173326519 20:42038488-42038510 CAGAGTGGACTAGGGAAGGAAGG + Intergenic
1173394795 20:42669311-42669333 CATGAGGATCTAGGGAAGGAGGG - Intronic
1174546067 20:51326092-51326114 CCAGGTTCTCTAGGGAAGGAAGG + Intergenic
1175063390 20:56264143-56264165 CAGGCTGCTCCTGGGAAGGACGG - Intergenic
1175126017 20:56752060-56752082 AAAGGTTACCTAGGGAAGGAAGG + Intergenic
1175337058 20:58203523-58203545 CAGAGTGGTCTGGTGAAGGATGG + Intergenic
1176182516 20:63757631-63757653 TAAGGTGATCTTGGAAAGGAAGG - Intronic
1176370063 21:6057072-6057094 TAGGGTGACCGAGGGAGGGAGGG - Intergenic
1178914411 21:36698812-36698834 CAGGGAGGGCGAGGGAAGGAGGG - Intergenic
1179728935 21:43356520-43356542 CAGGGTGCTCTTGGGAAGAGGGG - Intergenic
1179753456 21:43481469-43481491 TAGGGTGACCGAGGGAGGGAGGG + Intergenic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1180081983 21:45491222-45491244 CAGGGAGATCCAGGGAAGGACGG + Exonic
1180883596 22:19224119-19224141 CAGGGTCATCGAGGGAAGGTGGG - Intronic
1183667434 22:39253847-39253869 CAGGAGGACCTGGGGAAGGAAGG - Intergenic
1184083916 22:42246636-42246658 CAGGGAGGACTGGGGAAGGAGGG + Intronic
1184490223 22:44804077-44804099 GAGGGTGATGGAGGGAGGGAAGG - Intronic
1184522615 22:45004334-45004356 CAGGGCGATGAAGGGATGGAGGG + Intronic
1184765381 22:46569424-46569446 CAGGGTGGTTTAGGAGAGGAGGG + Intergenic
950358142 3:12429058-12429080 CAAGATGGTTTAGGGAAGGAGGG - Intronic
950788293 3:15453396-15453418 CAGGGTGTTCCAGGGAAGTCAGG + Intronic
951058818 3:18180115-18180137 CAGAGTGACATAGGGAGGGAGGG + Intronic
952858878 3:37795691-37795713 CAGGCTGAGCTGGGGAAGGCAGG - Intronic
954081413 3:48214251-48214273 TCGCGTGATCTGGGGAAGGAGGG + Intergenic
954977834 3:54713453-54713475 CAACGTGATCCAGGGAAGGGTGG - Intronic
955410688 3:58653585-58653607 CTGGGTCACCTAGGGATGGAGGG + Intronic
958728113 3:97930993-97931015 AAGGATGTTCCAGGGAAGGAGGG - Intronic
959850829 3:111084601-111084623 AAGGGTGATGTAAGGAAGGTAGG + Intronic
960570153 3:119177909-119177931 GAGAGGGATATAGGGAAGGAAGG + Intronic
961224574 3:125230076-125230098 TAGGGTGAGCTTGGGAAGGAAGG - Exonic
962621889 3:137188558-137188580 CATGGGGATCTAGGGAAGAGGGG - Intergenic
963403336 3:144830959-144830981 CAGGGTGCTCTAGAGAAGCATGG - Intergenic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
967130890 3:186469745-186469767 CAGGGTTATTTAGCGATGGAGGG - Intergenic
969721481 4:8894930-8894952 CAGGGTGCACAAGGGAAGAACGG - Intergenic
971231774 4:24806037-24806059 CAGGGTTATCTAGTGAAGTAGGG + Intergenic
971406856 4:26329439-26329461 CAGGGTGATGTAGGGAACTTGGG + Intronic
971504257 4:27348764-27348786 GAGGCTGATGGAGGGAAGGAAGG - Intergenic
971631385 4:28997888-28997910 CAGGGAGATCTGGGGAAGTTTGG + Intergenic
974539739 4:63218887-63218909 CTGGGTGGTCTAGACAAGGAAGG - Intergenic
975430005 4:74278193-74278215 GAGGCTGGTCTAGGGAAGAATGG - Intronic
976818657 4:89179709-89179731 CAGTGTGATCTAGTGAAGAACGG + Intergenic
977660907 4:99584862-99584884 CTGGGTGCTTTGGGGAAGGAGGG - Intronic
981504755 4:145486949-145486971 CAGTGTAATTTAGGGAAGGGAGG + Intronic
982289251 4:153763536-153763558 CTGAGTGGTCTAGGGTAGGAAGG - Intergenic
984573518 4:181421458-181421480 CTGGGTGGGGTAGGGAAGGAGGG + Intergenic
984679728 4:182593584-182593606 CATGGAGATCCAGGGAAGGAGGG + Intronic
985179260 4:187238663-187238685 CAGGGGGTGCTAGGGAAGCATGG + Intergenic
985562611 5:598186-598208 CAGGATGATGTTGGCAAGGATGG - Intergenic
985573255 5:661994-662016 CAGGGTGCTCCAGGCCAGGACGG + Exonic
986171240 5:5316627-5316649 CAGGGAGAGAGAGGGAAGGAAGG - Intronic
986208346 5:5647180-5647202 TAGGGTGGTCTAGGGAAAGTTGG - Intergenic
986813839 5:11386335-11386357 CAGAGAGATCGAGGGAAGGGAGG + Intronic
987570480 5:19651638-19651660 CATGGTGAATTAGGGAAGCAAGG - Intronic
988962140 5:36380875-36380897 CTGGGTGATCCTGGGAAGGATGG + Intergenic
989582389 5:43045142-43045164 CAGGTTGATCCAGAAAAGGATGG - Intergenic
991942092 5:71863075-71863097 CAGGGAGAGATAGGGAAGCAAGG - Intergenic
992223554 5:74596441-74596463 CAGTGTGATTTAGAGAAGGGAGG - Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
995953298 5:117743321-117743343 CGGGTTGAGCTTGGGAAGGAAGG + Intergenic
997713502 5:136025782-136025804 CTGGGTCATCTGGGGATGGAGGG + Intergenic
998159324 5:139804202-139804224 CTGGGTGATCTAGGGAATCTTGG + Intronic
999475810 5:151898060-151898082 CAGGGTGATATAATGAAGTAGGG + Intronic
999857726 5:155613454-155613476 CAGAGTGAGCCAGGGAGGGAGGG + Intergenic
1000107628 5:158075458-158075480 CGGGGTGATCTTGGGCAGGCGGG - Intergenic
1001050393 5:168409389-168409411 CATGGTGGTATGGGGAAGGAAGG - Intronic
1001200335 5:169710279-169710301 AAGGGTGATCAAGGGAACCAGGG - Intronic
1001543811 5:172557757-172557779 CAGGCTCTTCTAGGGCAGGATGG - Intergenic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002296870 5:178236350-178236372 CAGGGTGGTCTAGGCAAGAAGGG - Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1003681997 6:8265822-8265844 CAGGGTGCTCTAGGTGTGGAGGG + Intergenic
1003869255 6:10389029-10389051 CATGATGATCAAGGGGAGGAAGG - Intergenic
1004016522 6:11736931-11736953 GGGGGTGATGCAGGGAAGGAGGG - Intronic
1004496994 6:16173970-16173992 CAGGGTAACCCAGGGAAGAAGGG - Intergenic
1005969377 6:30749297-30749319 CATGGTGATCTGGGGGAAGATGG - Intergenic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1007134439 6:39507735-39507757 CAGTGTGATGGAAGGAAGGAAGG - Intronic
1007933269 6:45711226-45711248 CAGTGTGATCTATGAAAGGGTGG + Intergenic
1010631903 6:78208237-78208259 CAGGATGATGTAGGAAAGTATGG - Intergenic
1013430429 6:110050451-110050473 CAGTGTGAGGCAGGGAAGGATGG - Intergenic
1014531704 6:122566665-122566687 CAGGGGGATAAAGAGAAGGAAGG - Intronic
1016361213 6:143269082-143269104 AAGTGTGATCTAGGTAAGGAAGG - Intronic
1018429433 6:163711936-163711958 CAGGCTGAACTTGGGAACGAAGG + Intergenic
1019046124 6:169147615-169147637 CAAGGTTAGCTTGGGAAGGATGG - Intergenic
1019481253 7:1267767-1267789 AAGGGGGCTCTAGGAAAGGACGG + Intergenic
1019509593 7:1411177-1411199 CTGGGTGATTCAGGGAGGGAGGG - Intergenic
1019542463 7:1557787-1557809 CAGGGTGTCCCAGGGAAGGATGG - Intronic
1019706090 7:2497947-2497969 CAGGGTCTGCTGGGGAAGGAGGG + Intergenic
1020445461 7:8262402-8262424 CAGGGTGACCGGGGGAAGGTGGG + Intronic
1021325634 7:19263836-19263858 CAGGGAGATATAGGGAAACAGGG + Intergenic
1023694738 7:42833441-42833463 CAGGAGGAGCAAGGGAAGGAAGG + Intergenic
1023788887 7:43736412-43736434 CAGCGTGAGATAAGGAAGGAAGG + Intergenic
1023968947 7:44977790-44977812 CAGGGCCATCCAGGGAAGGGTGG - Intronic
1024609834 7:51054959-51054981 CAGGCTGCTCCAGGGAAGAAAGG - Intronic
1026034217 7:66819479-66819501 CGGGGTGAATGAGGGAAGGATGG - Intergenic
1026773613 7:73217542-73217564 CAGGGTGACCTCTGGAATGATGG - Intergenic
1026985387 7:74552053-74552075 CAGGGTGAGTGAGGGAAGGATGG + Intronic
1027014472 7:74770936-74770958 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027073561 7:75175021-75175043 CAGGGTGACCTCTGGAATGATGG + Intergenic
1027761286 7:82282358-82282380 CCGAGTGATCTAGGGAAGTTGGG + Intronic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033223681 7:139544719-139544741 CCTGGTGCTCTGGGGAAGGAGGG + Exonic
1034367199 7:150561266-150561288 CAGGGTGAAATGGTGAAGGAGGG + Intergenic
1034953402 7:155316659-155316681 CAGGGTGTTCTATGTAAGGCAGG + Intergenic
1036216914 8:6888143-6888165 CTTGGTGACTTAGGGAAGGATGG + Intergenic
1036245041 8:7108826-7108848 CAGGGAAATCTAAGGAAGGGTGG + Intergenic
1037386738 8:18351577-18351599 CTGGTTGTGCTAGGGAAGGATGG - Intergenic
1037711290 8:21357425-21357447 CAGGGGGTCCTAGGCAAGGATGG + Intergenic
1037831440 8:22192035-22192057 CAGGATGATCTAGGGCAACAGGG - Exonic
1038150241 8:24936877-24936899 CTGGGTGATCTTGGAAAGGATGG - Intergenic
1038336934 8:26653126-26653148 CTGTGAGATCTAGGGATGGAGGG - Intronic
1038482233 8:27909698-27909720 CAGGGGGATGAAGGAAAGGAAGG - Exonic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1040832421 8:51692090-51692112 CAGGGTGGCCTAGGTAAAGAGGG - Intronic
1041224017 8:55680527-55680549 AAGGCTGCTCTAGGGAAGAATGG - Intergenic
1041507202 8:58612411-58612433 TAGGGTGATATCTGGAAGGAAGG - Intronic
1041715330 8:60926976-60926998 CAGAATGATGTAGGAAAGGAGGG + Intergenic
1042334973 8:67620452-67620474 CAGTGTGATTTAGGGAAGGAAGG + Intronic
1044559259 8:93596469-93596491 CAGTGTTAGCTAGGCAAGGAAGG + Intergenic
1044843890 8:96361322-96361344 CTGGGAGAGCTAGAGAAGGATGG - Intergenic
1045013868 8:97981835-97981857 CAGGGTGGTGCAGGCAAGGAGGG + Intronic
1045478484 8:102574122-102574144 CAGGGACATCTTGGGAAAGAGGG - Intergenic
1046190929 8:110792996-110793018 CTGGGTGATCTGGGGAAGAAAGG + Intergenic
1046862235 8:119106500-119106522 CAGAGTGCTCTAGGGAGAGATGG - Exonic
1047761958 8:127961067-127961089 TAGGGTGGTCAGGGGAAGGAAGG + Intergenic
1048271896 8:133035998-133036020 CTGAGGGAGCTAGGGAAGGAGGG - Intronic
1048516736 8:135117975-135117997 CAGAGTGATCTAGGAAGGGTAGG + Intergenic
1049049697 8:140184896-140184918 GAGGGTGCTCTGGGGAGGGATGG - Intronic
1049757368 8:144316701-144316723 CAGTGGGATCTAGGGAGTGAGGG + Exonic
1049992313 9:1001624-1001646 CAGGCTGATCTAAAGCAGGAGGG + Intergenic
1051509681 9:17863604-17863626 CAGGTTGACCTTGTGAAGGAGGG + Intergenic
1052528882 9:29656453-29656475 CACGGAGAACTAGGGAAGCATGG + Intergenic
1055327257 9:75143732-75143754 GAACGTGAGCTAGGGAAGGATGG + Intronic
1057699344 9:97351759-97351781 CATGGTGATGTAGGGAATAAAGG + Intronic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1061273948 9:129558786-129558808 CAGGGTGAGGGAAGGAAGGAAGG + Intergenic
1061451018 9:130667009-130667031 CAGGGTGTCCGGGGGAAGGAGGG - Intronic
1186420307 X:9420321-9420343 GAGGGGGATGAAGGGAAGGAGGG - Intergenic
1187485893 X:19703078-19703100 AAGCGTGGTTTAGGGAAGGAAGG - Intronic
1187865902 X:23723187-23723209 AAGGGTGTTATGGGGAAGGAGGG - Intronic
1188507405 X:30897405-30897427 CATGGTGATCTAGGGACCCAGGG + Intronic
1190413727 X:50161992-50162014 CAGGGTGAGCTATGGAGGAAAGG + Intergenic
1192554435 X:72078636-72078658 GAGGGTGACCTTGGCAAGGATGG - Intergenic
1194105108 X:89759048-89759070 CAGCTTGACATAGGGAAGGAGGG + Intergenic
1195843442 X:109200195-109200217 CAGGGTGAAAAAGGAAAGGAGGG + Intergenic
1197093804 X:122571186-122571208 CAAGCAGATCTATGGAAGGAAGG + Intergenic
1199626971 X:149750291-149750313 CAGGGTCTTCCAGGGAATGACGG - Intergenic
1201256409 Y:12112288-12112310 GAGGGAGATGGAGGGAAGGAGGG - Intergenic