ID: 920212143

View in Genome Browser
Species Human (GRCh38)
Location 1:204335940-204335962
Sequence TGTGCCCTGGAACACTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920212143_920212149 -2 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212149 1:204335961-204335983 CATGCCCCTACATAAGGGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 61
920212143_920212146 -7 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212146 1:204335956-204335978 GGGCACATGCCCCTACATAAGGG 0: 1
1: 0
2: 0
3: 5
4: 72
920212143_920212155 29 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212155 1:204335992-204336014 AAACTTCTCTAGTGTCAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 162
920212143_920212147 -6 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212147 1:204335957-204335979 GGCACATGCCCCTACATAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 67
920212143_920212145 -8 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212145 1:204335955-204335977 AGGGCACATGCCCCTACATAAGG 0: 1
1: 0
2: 1
3: 11
4: 127
920212143_920212156 30 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212156 1:204335993-204336015 AACTTCTCTAGTGTCAAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 116
920212143_920212148 -5 Left 920212143 1:204335940-204335962 CCTCTAAAGTGTTCCAGGGCACA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 920212148 1:204335958-204335980 GCACATGCCCCTACATAAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920212143 Original CRISPR TGTGCCCTGGAACACTTTAG AGG (reversed) Intronic
901846022 1:11982804-11982826 TGTGCCCTGGCACTTTTTAGGGG + Intronic
903667439 1:25016687-25016709 TGGGCCCTGGCACACAGTAGGGG - Intergenic
906524510 1:46486345-46486367 TCTGCCCGGAACCACTTTAGGGG - Intergenic
910706302 1:90133196-90133218 TGGGCACTGGAAAACTCTAGGGG + Intergenic
914946026 1:152066991-152067013 GGTGGCCTAGAACACTTCAGGGG + Intergenic
916463138 1:165047187-165047209 TGTTCCCTGGATCGCTCTAGAGG + Intergenic
916675213 1:167059591-167059613 TGGGGCCTGGAGCACTTAAGGGG - Intronic
916953810 1:169810443-169810465 TGTTCTCTGGAAGGCTTTAGGGG + Intronic
917356728 1:174133387-174133409 GATGCCCTGGATCTCTTTAGAGG + Intergenic
917505540 1:175623838-175623860 TGGGCCCCGGAGCACTTCAGTGG - Intronic
918038863 1:180899939-180899961 TGTGCCCTCTCACACTCTAGGGG - Intergenic
920212143 1:204335940-204335962 TGTGCCCTGGAACACTTTAGAGG - Intronic
921462035 1:215439955-215439977 TATGCCCTGGAGAACTTTTGGGG + Intergenic
922412643 1:225391206-225391228 TCTGGCCTGGAACACTTCAGTGG - Intronic
924187014 1:241503490-241503512 TCTGCCCTTCAACACTTTACTGG - Intronic
1070414512 10:76176992-76177014 TGTGCTCTGGAAGACTCTATTGG - Intronic
1070782881 10:79147715-79147737 TGAGCCCTGCAACAATGTAGGGG - Intronic
1072260055 10:93661102-93661124 TGGGCCCTAGAGCACTTCAGGGG + Intronic
1075199055 10:120387069-120387091 TGTGTCCTGGAACACTGTCAGGG - Intergenic
1081748642 11:45491021-45491043 TCTGCCCTGCAGCACATTAGGGG - Intergenic
1085722821 11:78928220-78928242 TGTGCCCTGGAGCAGTTTCCTGG + Intronic
1086311575 11:85540989-85541011 TGTTCCCTGGAACACTTCCCAGG + Intronic
1092084299 12:5743015-5743037 TGTGCCCTGGAAATTTTTATTGG + Intronic
1092624173 12:10307826-10307848 TGGTTCCTGGAACACTTCAGAGG + Intergenic
1095362322 12:41357789-41357811 TGGGTACTGGAACATTTTAGTGG - Intronic
1096422907 12:51475571-51475593 TGTGACCTTGGATACTTTAGGGG + Intronic
1098302254 12:69066528-69066550 TGTTCCCTTGAAGACTTTAGGGG + Intergenic
1101307733 12:103546357-103546379 TGTGCCCTGGATCCTTTCAGAGG - Intergenic
1107441945 13:40435707-40435729 TGTTCCCTGGAACACTCTTTGGG - Intergenic
1110813300 13:79834472-79834494 TGTGGCTTGGAGCACTTTACAGG + Intergenic
1113257568 13:108523658-108523680 TCAGCTCTGGAAGACTTTAGAGG + Intergenic
1117047554 14:51828354-51828376 TGTGCCCTGGAACCATTTTCAGG - Intronic
1120364105 14:83543005-83543027 AGTGACCAGGAACACTTTAGGGG + Intergenic
1121505364 14:94473012-94473034 TGTGCCCTGGAACCCACTGGGGG + Intronic
1124832245 15:33160407-33160429 TCTGACATGGAACACTCTAGAGG - Intronic
1125334428 15:38613614-38613636 GATGTCCTGGAACACTTTTGTGG - Intergenic
1125407613 15:39369874-39369896 TGTGCCCTGCAAAGCTTCAGGGG - Intergenic
1129675695 15:77631711-77631733 AGCGCCCAGGAACGCTTTAGGGG - Intronic
1130867410 15:87944627-87944649 TGTGAACTGGATCATTTTAGTGG - Intronic
1131465066 15:92648358-92648380 GGTGCCATGGAACACATCAGAGG - Intronic
1132542718 16:518776-518798 TGTGCCCTGGAGCACATGGGTGG + Intronic
1144362740 17:14510595-14510617 TGTGCCGTGGAACACAGCAGTGG + Intergenic
1144386435 17:14752796-14752818 TCTGCCTTGGAACACTAAAGCGG + Intergenic
1146639343 17:34528048-34528070 TGTGCACTGCAGAACTTTAGGGG - Intergenic
1146650259 17:34602059-34602081 TGTTCCCTGGAACCCCTCAGGGG - Intronic
1147650266 17:42058072-42058094 TGAGCCCTGGAATACCTTGGAGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1148901989 17:50885180-50885202 TTTGCCTTGGTACACTTGAGGGG + Intergenic
1152402781 17:80078400-80078422 CGAGACCTGGAAAACTTTAGTGG - Intronic
1164253854 19:23510017-23510039 TGTGTCCTGGATTCCTTTAGGGG - Intergenic
925014943 2:515922-515944 TGTGCCCTGCACCACTCCAGCGG - Intergenic
927623170 2:24683754-24683776 TGAGCACTGAAAAACTTTAGAGG - Intronic
931662029 2:64574317-64574339 TTTACCCTGGAACCCTTCAGTGG - Intronic
932648472 2:73530469-73530491 TGTGCCCTGCAAAACCTCAGGGG - Intronic
934132037 2:88957455-88957477 TGTGACCTGGATCACCTAAGAGG - Intergenic
935101840 2:100003371-100003393 TGTGCCCTAGAACATTCTAGAGG + Intronic
936402129 2:112172992-112173014 TTTGCCCTGGAAAATTTTGGAGG - Intronic
936835151 2:116700750-116700772 TGTGACCTGTGACACTTTATAGG + Intergenic
937077282 2:119116556-119116578 TGTGCCCTAGAACAGTCTTGTGG - Intergenic
937272069 2:120659395-120659417 TCTGCCCTGGAAAGGTTTAGGGG - Intergenic
940500655 2:154489663-154489685 TGTGCCCTGGAACTTCTGAGGGG - Intergenic
942277348 2:174332922-174332944 TGTGCCCTGGGAGACTGTAGTGG - Intergenic
944204193 2:197140226-197140248 TGTGAACCGGCACACTTTAGAGG - Intronic
1171958509 20:31476943-31476965 TGTGCCCTGTACAACTTTGGAGG - Intronic
1172967677 20:38849821-38849843 TGTGTCCAGGAAGACTTTTGGGG - Intronic
1173139765 20:40471478-40471500 TGTGCTCTGGACAACTCTAGGGG - Intergenic
1177561297 21:22757718-22757740 TGTTCCCTTAAACACTTCAGTGG + Intergenic
1178980480 21:37259578-37259600 TGTGTCTTGGAACGCTGTAGGGG - Intronic
950798486 3:15530617-15530639 TGTGACCTGGAAAACAATAGAGG - Intergenic
953703434 3:45213835-45213857 TGTGCCAAGGAACACCCTAGGGG + Intergenic
956326967 3:68063835-68063857 TGTGCCATGGACTCCTTTAGTGG - Intronic
957556438 3:81768511-81768533 TGTGGCCTGTAAAACTGTAGTGG - Intergenic
959752023 3:109849541-109849563 TTTGCCTTGGAACCCTGTAGGGG + Intergenic
960622513 3:119650649-119650671 GGAGCCCTGGGATACTTTAGTGG - Intronic
963064790 3:141254998-141255020 TGGGCCCTGGAACTCTCTGGTGG + Intronic
963466078 3:145684860-145684882 TGTACCTTTGAACACTTTTGGGG + Intergenic
967409490 3:189153004-189153026 TGTGTCTTAGATCACTTTAGAGG + Intronic
970428337 4:15965389-15965411 TGTTCCCTGCAACACTGTGGTGG - Intronic
974139766 4:57870631-57870653 TTTATCTTGGAACACTTTAGTGG - Intergenic
974362097 4:60894430-60894452 TGTGCCCTGTTACATTTCAGTGG + Intergenic
975040040 4:69735285-69735307 TGTGACCTGGAACCATTTACAGG + Intronic
976281404 4:83330336-83330358 TGTGCCCTGGAGCCCTTTGCAGG - Intronic
977806066 4:101299252-101299274 TGTAGCCTGGAACACTCTAATGG - Intronic
980860458 4:138493577-138493599 TGTGCACTGCACAACTTTAGGGG - Intergenic
985319442 4:188693314-188693336 TGTGCCCTGGTACACTGAAGGGG + Intergenic
985526893 5:408728-408750 TATGCTCTGGAACAATTTATGGG + Intronic
986764018 5:10907057-10907079 TCTGCCCTGGAACAGTTTATAGG - Intergenic
990954212 5:61327959-61327981 TTTGCCCTGGGGCACTCTAGGGG + Intergenic
993696846 5:91071445-91071467 TGTGCCCTGGAACACACTTTGGG - Intronic
997778206 5:136630227-136630249 TGAGCCCTGGGGCACTGTAGTGG + Intergenic
998849854 5:146342282-146342304 TGTTCGCTGGGACACTCTAGTGG + Intergenic
1002523094 5:179802024-179802046 TGTGCGCTGGCACACTGGAGGGG - Exonic
1005916815 6:30359583-30359605 TCAGCCCTGACACACTTTAGTGG - Intergenic
1006593001 6:35171851-35171873 TGTGACCTGGAACACTCAGGTGG - Intergenic
1014686002 6:124501190-124501212 TGTGTCCAGAAACACTGTAGAGG - Intronic
1020840754 7:13214510-13214532 AGTGCCCTGGATAACTTTATTGG + Intergenic
1022234810 7:28451083-28451105 TGTGATCTGGAAAACTTTAAAGG + Intronic
1023740855 7:43279407-43279429 AATGCCATGGGACACTTTAGAGG - Intronic
1026796267 7:73367988-73368010 TGTGACCTGGCACACTCCAGGGG - Intergenic
1032167098 7:129553915-129553937 TGTGCCCAGCCAGACTTTAGTGG + Intergenic
1033921674 7:146400738-146400760 TGTGCTCTGGGAAACCTTAGTGG + Intronic
1040662667 8:49594232-49594254 TGGTCCCTGGAACAATTTGGTGG + Intergenic
1041566069 8:59280428-59280450 TGTGCCCTGCACAACTCTAGGGG - Intergenic
1042386043 8:68175653-68175675 TGAGAGCAGGAACACTTTAGTGG - Intronic
1042588968 8:70376499-70376521 TGTGTCCTGAATCACTTTAGTGG - Intronic
1046201672 8:110935589-110935611 TGTGGCCTGGAACTCTTTCCAGG - Intergenic
1047334972 8:123926592-123926614 GGAGACCTGGAAGACTTTAGGGG + Intronic
1186745875 X:12568044-12568066 TGAGCCCTGGAAGCCTGTAGAGG - Intronic
1189097086 X:38151803-38151825 TGTTCCCTGGAAGACTTTCCAGG - Intronic