ID: 920214866

View in Genome Browser
Species Human (GRCh38)
Location 1:204354966-204354988
Sequence ATTCCAGGGGATTCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920214855_920214866 8 Left 920214855 1:204354935-204354957 CCTGCCAGAAGAAGCCCCCAGCA 0: 1
1: 0
2: 2
3: 21
4: 216
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214854_920214866 15 Left 920214854 1:204354928-204354950 CCATGCACCTGCCAGAAGAAGCC 0: 1
1: 0
2: 0
3: 25
4: 326
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214859_920214866 -8 Left 920214859 1:204354951-204354973 CCCAGCAAGTGTGCCATTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214858_920214866 -7 Left 920214858 1:204354950-204354972 CCCCAGCAAGTGTGCCATTCCAG 0: 1
1: 0
2: 1
3: 9
4: 153
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214853_920214866 23 Left 920214853 1:204354920-204354942 CCTATAAGCCATGCACCTGCCAG 0: 1
1: 0
2: 1
3: 33
4: 462
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214857_920214866 -6 Left 920214857 1:204354949-204354971 CCCCCAGCAAGTGTGCCATTCCA 0: 1
1: 0
2: 1
3: 27
4: 119
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214856_920214866 4 Left 920214856 1:204354939-204354961 CCAGAAGAAGCCCCCAGCAAGTG 0: 1
1: 1
2: 0
3: 9
4: 183
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164
920214861_920214866 -9 Left 920214861 1:204354952-204354974 CCAGCAAGTGTGCCATTCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920214866 Original CRISPR ATTCCAGGGGATTCTCCTGG AGG Intronic
902819840 1:18937150-18937172 ATTCCAGAGCAATCTCCAGGAGG + Intronic
905505673 1:38477067-38477089 TTTCCAGGGTGTTCTTCTGGAGG - Intergenic
906638503 1:47426761-47426783 CTTCCAGGGATTTCTCCTGCTGG - Intergenic
908740573 1:67323159-67323181 GTGCCAGGTGATTTTCCTGGAGG + Intronic
915513787 1:156401180-156401202 GTTCCAGGGGAGGCTACTGGGGG - Intergenic
918557163 1:185816739-185816761 ATTCCAGGCACTTCTCCTGAGGG - Intronic
918654202 1:187003633-187003655 TTTCCTGGGGATCCTCCTGTAGG + Intergenic
919266257 1:195270674-195270696 ATTTCTGGGAATTCTCCTTGTGG - Intergenic
920214866 1:204354966-204354988 ATTCCAGGGGATTCTCCTGGAGG + Intronic
920230275 1:204465648-204465670 TTTCCGGGGGATTCTCCCAGAGG + Intronic
922003425 1:221503987-221504009 ATGCCTGGAGATCCTCCTGGAGG - Intergenic
924863641 1:247953887-247953909 ATTCCAGGGGAGTCCCTAGGAGG - Intronic
1064275612 10:13902514-13902536 CTTCCAGGGGATTCTCATGTTGG - Intronic
1065092373 10:22247711-22247733 ATACCAAGTGATTCTCGTGGTGG - Intergenic
1065324863 10:24541704-24541726 ATTCAAGGCGCTTCACCTGGAGG - Intronic
1068002174 10:51348452-51348474 ATTCCAAGGCACTCACCTGGAGG - Intronic
1069610399 10:69768963-69768985 ATCCCAGGGGAGTGTCTTGGGGG - Intergenic
1069768908 10:70885331-70885353 ATTATAGAGGAGTCTCCTGGGGG - Intronic
1070731520 10:78831774-78831796 ATGGCAAGGGATTCTCCCGGGGG - Intergenic
1071976387 10:90960074-90960096 ATTGCAGGGGAATCTCCATGAGG + Intergenic
1075316603 10:121458405-121458427 ATCCCAGGGGCATCTCTTGGCGG + Intergenic
1075589946 10:123684066-123684088 ACCCCAGGGGATTTTCCGGGGGG + Intronic
1076472383 10:130728096-130728118 GTTCCCGGGGGTGCTCCTGGAGG + Intergenic
1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1085445635 11:76599050-76599072 CTTCCAGGGCATCTTCCTGGTGG + Intergenic
1087156910 11:94913871-94913893 TTTCCAGGTGACTTTCCTGGGGG + Intergenic
1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1093893242 12:24548535-24548557 GTTCCTGGGGACTCTGCTGGTGG - Intergenic
1098322230 12:69257830-69257852 TTTCCAGGGGCTGTTCCTGGTGG + Exonic
1102006957 12:109595234-109595256 TTTCAAGGGAATTCTCCAGGTGG - Intronic
1102495123 12:113314381-113314403 AGCCCAGGGGCTTCGCCTGGAGG - Intronic
1102937723 12:116911403-116911425 ACTGCAGGGGTTTGTCCTGGGGG - Intronic
1103292218 12:119855745-119855767 ATTTCAGGCCATTCACCTGGAGG + Intronic
1107018635 13:35729719-35729741 ATTCCAGGTGGTTCTGCTTGTGG + Intergenic
1108912655 13:55576680-55576702 ATGCCAGGGAATTCTACTGGGGG - Intergenic
1110607069 13:77445298-77445320 CTTCCAGGGGATTCTCTTAAAGG - Intergenic
1112143718 13:96674478-96674500 ATCCCCCGGGCTTCTCCTGGGGG + Intronic
1112297408 13:98200355-98200377 ATTCCAGGTGATTCTGATGCAGG - Intronic
1115866094 14:37747993-37748015 ATACTAGGGGAAGCTCCTGGAGG + Intronic
1116768951 14:49105088-49105110 ACTCCAGGGTACTCACCTGGAGG + Intergenic
1116998103 14:51345471-51345493 ATGTGAGGGGATGCTCCTGGTGG + Intergenic
1119568676 14:75650514-75650536 ATTCCAGTGCATTCTCCTCGGGG + Exonic
1120036207 14:79701518-79701540 ATTCTCTGGGATTCTCCTTGTGG + Intronic
1121711246 14:96040201-96040223 ACTCCAGGGCATTCTGCCGGAGG - Intronic
1121827119 14:97019344-97019366 AGTCAAGGGGATTCCCCAGGCGG - Intergenic
1123539703 15:21275810-21275832 TTTCCTGGGGATTATCCAGGTGG - Intergenic
1125420531 15:39500019-39500041 AGTCCAGGCAATTCTGCTGGAGG - Intergenic
1130870011 15:87963120-87963142 TATCCAGTGGATTCTCCTGAGGG - Intronic
1131064151 15:89422623-89422645 CTTCCAGGGGGTGTTCCTGGAGG + Intergenic
1132032743 15:98451746-98451768 ATTCCAGGGGATTCTGCAGGAGG - Intronic
1202948014 15_KI270727v1_random:2976-2998 TTTCCTGGGGATTATCCAGGTGG - Intergenic
1133382421 16:5342312-5342334 ATTCCAGGGGACTCTGTTAGAGG + Intergenic
1133591911 16:7253234-7253256 ATTCACAGGTATTCTCCTGGGGG + Intronic
1138044136 16:53703686-53703708 ACTCCAGGGCCTTCTCCAGGCGG + Intronic
1140509757 16:75498658-75498680 AGTCCAGTGGATTATCCTCGTGG - Intergenic
1141697147 16:85625504-85625526 ATCCCAGGGGTGTCACCTGGGGG - Intronic
1142767621 17:2074425-2074447 CTCCCAGGGGATGCTGCTGGTGG - Intronic
1143001780 17:3799193-3799215 AGTCCAGGAGAGTTTCCTGGAGG - Intronic
1143718820 17:8796156-8796178 ATTCCAGGCCCTTCCCCTGGGGG + Intergenic
1144739914 17:17576102-17576124 CTTCCCGGGGATCCTGCTGGGGG - Intronic
1148848075 17:50540811-50540833 AGGCCAGTGGATCCTCCTGGGGG + Exonic
1149656238 17:58310894-58310916 CTTGCAGGGGGTGCTCCTGGAGG + Exonic
1151120187 17:71784305-71784327 ATTATAGGGGATTTTTCTGGAGG - Intergenic
1151305057 17:73257895-73257917 CCTCCAGGGGATTCCCCAGGAGG + Intronic
1152696622 17:81800829-81800851 ATTGCAGGGGGCCCTCCTGGAGG - Intergenic
1155896914 18:31341077-31341099 AATCCAGTGGACTCTCCAGGTGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157745338 18:50130125-50130147 ATTCCAGCCCAGTCTCCTGGTGG - Intronic
1160317917 18:77865697-77865719 GTTCCACCGGATTCTGCTGGTGG + Intergenic
1163585639 19:18162045-18162067 AATACAGGGGACTCACCTGGGGG - Exonic
1163775869 19:19217093-19217115 ATTCCAGAGCCTTCTCCTGCTGG + Intronic
1165146519 19:33734591-33734613 ATGGCAGGGCGTTCTCCTGGGGG - Intronic
1166862003 19:45816331-45816353 CTCCCAGGGGATGCTCCTGCTGG - Intronic
1168013478 19:53553768-53553790 ATTCCAGGTGATGCTCCAGAGGG + Intronic
1202648539 1_KI270706v1_random:161151-161173 ATTACAGGGGACTCTTCTGCTGG + Intergenic
928905155 2:36359948-36359970 CTTCTAGGTGATTTTCCTGGAGG - Intronic
930739765 2:54819273-54819295 ACTCCAGGAGATTCTGATGGAGG - Intronic
931521936 2:63106973-63106995 ATTCCAGTGTTTTCTCCTAGAGG + Intergenic
932053964 2:68425954-68425976 CTCCCAGGGGATGCTGCTGGTGG - Intergenic
932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG + Intergenic
933764139 2:85695610-85695632 ACCCCAGAGGATCCTCCTGGAGG - Intronic
936092168 2:109508427-109508449 GTTCCAGGGCAATGTCCTGGAGG - Intergenic
936505748 2:113104465-113104487 ATTCCTGGGCCTTCTCATGGTGG + Intergenic
936508688 2:113128568-113128590 GCTCCAGGAGATCCTCCTGGAGG + Intronic
937029547 2:118726836-118726858 ATTCCAGGGGGTTCATCTGGAGG - Intergenic
937212965 2:120289357-120289379 ATCCCAGGGGATTCTGATGTGGG + Intronic
937924161 2:127154709-127154731 CTTCCAGTGGTTTCTCCTGTGGG + Intergenic
938840251 2:135154420-135154442 ATTTCACGGGATTTTCTTGGGGG - Intronic
939602276 2:144207690-144207712 ATTCCTGTGTATTCTCCTGATGG - Intronic
941332892 2:164201684-164201706 AAGCCAGGGAACTCTCCTGGTGG + Intergenic
942349666 2:175039308-175039330 ACTCCTGCGGATTCTGCTGGTGG - Intergenic
942675445 2:178421859-178421881 ATTCCCAGTGATTCTCTTGGGGG - Intergenic
946214046 2:218169800-218169822 ATCCAAGTGGATTCTTCTGGAGG - Intergenic
948116356 2:235496228-235496250 ATTCCAGGGGAGGATCCGGGTGG + Intronic
1172793070 20:37519579-37519601 CTCCCCGGGGCTTCTCCTGGGGG + Intronic
1172972886 20:38886412-38886434 TGTCCAGGAGATACTCCTGGAGG - Intronic
1175297367 20:57918198-57918220 ATTCCAGTGGAGTCAGCTGGGGG + Intergenic
1177906556 21:26978556-26978578 ATTACAGTGGAGTTTCCTGGAGG - Intergenic
1181787998 22:25241528-25241550 ATTCCAGGGGATTCTGAGGCAGG - Intergenic
1181819740 22:25466543-25466565 ATTCCAGGGGATTCTGAGGCAGG - Intergenic
1182367795 22:29790440-29790462 ATTCAAGGGGCTGCTTCTGGGGG - Intronic
1185383775 22:50522378-50522400 CTTCCAGGGAATCCTCCAGGTGG - Exonic
949265890 3:2155891-2155913 AGTCCAGGGAATCCTCCTGTAGG - Intronic
950887609 3:16374939-16374961 TTTCCAGTGGATTCTCCATGCGG - Intronic
952013418 3:28929320-28929342 ATTCCAGGGAATACTAATGGTGG + Intergenic
954300265 3:49697418-49697440 CTTTGAGGGGCTTCTCCTGGTGG + Exonic
955104237 3:55881238-55881260 ATTCGAGGGCATTATCCTGTTGG - Intronic
955722614 3:61899599-61899621 ATTCCTGGTGAGTCTTCTGGAGG - Intronic
961648649 3:128406223-128406245 ATTCATGAGGAATCTCCTGGTGG - Intronic
962310933 3:134326386-134326408 ATTCCAGGGAATTCTGTAGGTGG + Intergenic
962704223 3:138027810-138027832 TTTCCTGGGGCTTCTCCTAGGGG - Intronic
967891466 3:194367153-194367175 ATTCCACCTGAGTCTCCTGGAGG + Intronic
968003156 3:195221511-195221533 ATGACAGGAGAGTCTCCTGGGGG + Intronic
969122163 4:4918772-4918794 CTTCCAGAGGATTTTCCAGGGGG - Intergenic
969542764 4:7803861-7803883 ATCCCAGGGGATTTTTTTGGGGG - Intronic
973280460 4:48354994-48355016 ATTTCAAGCGATTCTCCTGCAGG + Intronic
975138788 4:70900100-70900122 ATTCCAGGCAACTCTCCTAGTGG + Intergenic
976817413 4:89165186-89165208 GTTCCAGGAGATGTTCCTGGCGG + Intergenic
980985277 4:139689217-139689239 AATCCGGGAGATTCTCCAGGTGG + Intronic
981388080 4:144154493-144154515 ATTCCAGGACATTCTTTTGGTGG - Intergenic
985597632 5:803287-803309 CTTCCAAGGGATGCTGCTGGAGG - Intronic
992240799 5:74767322-74767344 ACTCCAGCGGCTGCTCCTGGCGG + Exonic
993233549 5:85271303-85271325 ATACCAGGAAATTCTCCTGTTGG - Intergenic
995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG + Intergenic
998141275 5:139700935-139700957 ATTCCAGGTAACTCTCCAGGAGG - Intergenic
999216712 5:149941469-149941491 GTTCCCTGAGATTCTCCTGGTGG - Intronic
999777184 5:154820767-154820789 GTTCCAGGGGATTCTGATGCTGG - Intronic
1001021717 5:168188762-168188784 ATTCCAGGGCCTGCTCCTGGAGG + Intronic
1003021674 6:2515220-2515242 GTTGCAGGGTATTCTCGTGGAGG - Intergenic
1003279041 6:4676161-4676183 TTCCCAGGGGATTCTGATGGAGG + Intergenic
1007721490 6:43887867-43887889 CCTCCAGAGGCTTCTCCTGGCGG - Intergenic
1008806352 6:55433640-55433662 GTCCCAGGGGATTATCCTGCTGG + Intergenic
1008907004 6:56689565-56689587 AATCTAGAGGATTCTCCTGCAGG + Intronic
1011712090 6:90065324-90065346 ATTCCAGGCTAGCCTCCTGGAGG + Intronic
1013164760 6:107579692-107579714 ATTTAAGGAGATTCTCATGGAGG + Intronic
1015329051 6:131955923-131955945 ATTCCTAGGGATTCTGCTGCGGG + Intergenic
1015989600 6:138923924-138923946 ATTACAAGGGAATCACCTGGGGG - Intronic
1018280853 6:162183909-162183931 AGTTCAGGGGATTCTCCCTGGGG - Intronic
1018406402 6:163487640-163487662 ATTCCTGTGGATTTTGCTGGTGG + Intronic
1019289261 7:242394-242416 ATTCCAGAGGGTCTTCCTGGAGG + Intronic
1022527919 7:31050290-31050312 TTTCTAGTGGATTCACCTGGAGG - Intergenic
1024587420 7:50854014-50854036 ATTACAGAAGAATCTCCTGGTGG - Intergenic
1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG + Intronic
1028077960 7:86537880-86537902 ATGCCAGGGGATCCACTTGGTGG + Intergenic
1031575451 7:123410487-123410509 ACTGCAGGGAAGTCTCCTGGAGG + Intergenic
1039926002 8:41932995-41933017 ATTCCAGGGGATTTTGGTGCCGG - Exonic
1039989342 8:42474948-42474970 ATTCCAGATGGTTCTCATGGTGG + Intronic
1040735060 8:50495816-50495838 TTTCCAGAGGAGTCTTCTGGTGG - Intronic
1040937730 8:52798924-52798946 TTTCCAGGGTGATCTCCTGGGGG + Intergenic
1041002239 8:53464433-53464455 ATTCCAGGCGCTACTCCTTGAGG + Intergenic
1048289211 8:133167304-133167326 TTTCCATGGGATTCACATGGAGG - Intergenic
1048816791 8:138341662-138341684 ATTCCAGGGGATTCTTGCAGTGG - Intronic
1051710070 9:19922496-19922518 CTTCCATGGGATTATCCTTGGGG + Intergenic
1052244210 9:26314058-26314080 TTCCAAGGGGCTTCTCCTGGTGG - Intergenic
1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG + Exonic
1053164301 9:35833751-35833773 TTTCCTGGGGACTCTCATGGTGG + Intronic
1055774825 9:79755889-79755911 ATCCCAGGTGATGCTTCTGGTGG - Intergenic
1056063748 9:82911614-82911636 AATCTAGGGGATACTCCTGGTGG - Intergenic
1056495886 9:87154826-87154848 ATTCCAGGAGAGCTTCCTGGAGG + Intronic
1057169942 9:92955850-92955872 ATCCCAAGGGATTATGCTGGTGG - Intronic
1057594894 9:96407245-96407267 ACCCCAGGGGCTGCTCCTGGCGG + Intronic
1058703151 9:107617362-107617384 CTCCCAGGTGATTCTGCTGGTGG + Intergenic
1058867779 9:109177372-109177394 CCTCCAGGTGATTCTTCTGGAGG + Intronic
1060380984 9:123171887-123171909 ATTCAAGGGGGTTACCCTGGAGG - Intronic
1060776802 9:126380588-126380610 AGTCAACGGGATTCTACTGGAGG - Intronic
1061386804 9:130295291-130295313 ACCCCAGTGGATTCTCATGGTGG + Intronic
1186370067 X:8937525-8937547 AGACCAGGAGATTCTCTTGGAGG - Intergenic
1186371530 X:8952106-8952128 ACTCCAGGGCATTCTGATGGAGG + Intergenic
1187110691 X:16296129-16296151 ATTCCAGGTGATTCTGATGCAGG + Intergenic
1187258437 X:17662105-17662127 CTTCCAGGGAACTTTCCTGGAGG + Intronic
1189097173 X:38152560-38152582 CCTCCAGGGGATTCTGATGGAGG + Intronic
1190682733 X:52842030-52842052 AATCCAGTGTATTCTCCTGAAGG + Intergenic
1194448773 X:94016781-94016803 TTTCCAGGGGAATCTCCTGAGGG - Intergenic
1195997572 X:110746384-110746406 ATTGAAGGGGATTTTTCTGGGGG - Intronic
1196441327 X:115722473-115722495 CTTCCAGGGGATGCTGCTGGTGG - Intergenic
1196444856 X:115840462-115840484 CTTCCAGGGGATGCTGCTGGTGG - Intergenic