ID: 920215095

View in Genome Browser
Species Human (GRCh38)
Location 1:204357369-204357391
Sequence CTGAACAGACAGATGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920215095 Original CRISPR CTGAACAGACAGATGGTCAA GGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
902760183 1:18575809-18575831 CTGAGCTGACAGCTGGTCCAGGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
903909712 1:26714163-26714185 CTGAAAAGACAGCTGGTGACTGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
912885711 1:113471363-113471385 CTGAACAACCAGTGGGTCAATGG + Intronic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
915322110 1:155061881-155061903 CTGAACAGAGAGAGGGGCAGTGG - Intronic
915686076 1:157636216-157636238 CTGGACAGACAGATTTTTAAAGG + Intergenic
916835686 1:168542734-168542756 CTGAAAAGAAAGAAGGCCAAAGG + Intronic
916838927 1:168579415-168579437 CTGAAAGGAAAGATGGCCAAAGG - Intronic
917120621 1:171641857-171641879 CTGAGCAAACAAATGATCAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
919527999 1:198678998-198679020 CTGAGCAGTCAGATGGTTTAGGG - Intronic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
921193696 1:212731946-212731968 CTGAACAGTTAGATGGACATTGG - Intronic
922042623 1:221911556-221911578 ATGAACATACAGGTGTTCAAAGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923032624 1:230262322-230262344 CTTGTCACACAGATGGTCAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063471747 10:6293249-6293271 ATCAACAGACAGAAGGTCACTGG - Intergenic
1063810135 10:9695633-9695655 CTGGACAGAGAGATGGCCAGTGG - Intergenic
1066623712 10:37384600-37384622 ATGAAAAGACCGATGGTGAAAGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066749385 10:38636930-38636952 ATGAACAGAAAGAAGCTCAATGG + Intergenic
1066967262 10:42280862-42280884 ATGAACAGAAAGAAGCTCAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1073572628 10:104593335-104593357 CTGAACAGAAGGATAATCAATGG - Intergenic
1073633522 10:105173771-105173793 AAGAACAGAAAGATGGTCAGTGG - Intronic
1073723381 10:106200994-106201016 CTGAACAGAAAAATGATCAAAGG - Intergenic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1074742143 10:116495881-116495903 AAGATCAGACAGATGGTTAATGG + Intergenic
1075428977 10:122364961-122364983 CTGCCCAGAAAGCTGGTCAAAGG - Intergenic
1076014205 10:127014834-127014856 GTAAGCAGACAGATGGGCAAAGG - Intronic
1076078615 10:127557580-127557602 CTGAAAAGTCTGATGTTCAAGGG - Intergenic
1080221740 11:29913809-29913831 CTGAACAGACAGAACCTCCAAGG + Intergenic
1081068525 11:38578466-38578488 CTAAACAGAAATATAGTCAAAGG - Intergenic
1084057667 11:66646939-66646961 CTAAACAAATAGATGGTGAAAGG - Intronic
1085201359 11:74704158-74704180 CAGAACAGATAGATGGGAAATGG - Intronic
1086026261 11:82295726-82295748 CTGAACAACCAGTGGGTCAAAGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087237792 11:95739377-95739399 ATTAAAAGACAGATGGTGAAGGG - Intergenic
1090585942 11:128213406-128213428 CAGAGCAGAGAGATGGTCAGTGG - Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1093051645 12:14511264-14511286 CTGAACAAACTGATGTTCTACGG - Exonic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093582300 12:20796712-20796734 CTAAACAGAACTATGGTCAATGG + Intergenic
1094353899 12:29557357-29557379 CTGCACAGGCAGCTGGTCAGAGG - Intronic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1095382004 12:41606173-41606195 CTGCAGAGAGAGATGCTCAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096544251 12:52326893-52326915 CTGAATAGACAGTTCATCAAAGG + Intergenic
1097516841 12:60617289-60617311 CAGGACAGACTGATTGTCAAAGG + Intergenic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1098821690 12:75239035-75239057 ATGAACAGACATATCATCAAAGG - Intergenic
1099844112 12:88006867-88006889 CTAAACAGAGAGGTGGTGAAAGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1103549425 12:121726066-121726088 CTGGACAGAAAGGTGGTTAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104394627 12:128421870-128421892 GTGAACAGAGAGATGGAAAAAGG - Intronic
1104427648 12:128691418-128691440 ATGCACAGACAGATGGACAGAGG - Intronic
1104527750 12:129540086-129540108 CAGCACAGACAGATGTTCAATGG + Intronic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1108841968 13:54628846-54628868 CAAAACAGACAGATGCTCCATGG - Intergenic
1108912186 13:55568762-55568784 TTAAACAGACAGATGGTAAGTGG + Intergenic
1109073979 13:57809108-57809130 CTAAACAAACAGTGGGTCAATGG + Intergenic
1110303042 13:73951726-73951748 CTGAACAGAATGGTGGACAATGG - Intronic
1113770740 13:112906900-112906922 CTGAACAGTGTGATGCTCAAAGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114988346 14:28258300-28258322 CTGAAAGGAAAGATGGTCAAAGG - Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1120663859 14:87282513-87282535 CTGAAGAGGCAGATGGTTTAGGG + Intergenic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1122131420 14:99606115-99606137 CTCTCCAGACAGATGGTCAGGGG + Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1124897643 15:33791861-33791883 TTGAACAGACAAAGGATCAAAGG + Intronic
1126087730 15:45024900-45024922 CTGAGCAGATAGAGGGCCAAGGG - Intronic
1128862907 15:71089687-71089709 TTGAACAGACACAGAGTCAATGG + Intergenic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1130630594 15:85564690-85564712 CTGAAGAGACAGATAATCTAAGG - Intronic
1134238249 16:12484713-12484735 CTGAACTGACATCTGGTGAATGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136733334 16:32440203-32440225 ATGAACAGAAAGAAGCTCAATGG - Intergenic
1138234408 16:55369606-55369628 CTTAACAGTCAGATGCTTAAAGG - Intergenic
1141212883 16:81997331-81997353 CAGAAGAGGGAGATGGTCAAAGG - Exonic
1142221706 16:88858082-88858104 CTGAACACACACAGGGTAAATGG + Intronic
1203019749 16_KI270728v1_random:389399-389421 ATGAACAGAAAGAAGCTCAATGG + Intergenic
1203038084 16_KI270728v1_random:662557-662579 ATGAACAGAAAGAAGCTCAATGG + Intergenic
1142597782 17:1037928-1037950 CGGAACAGACACATGGTCTCCGG + Intronic
1146904278 17:36608220-36608242 CTGCACAGACACAAGGACAAGGG - Intronic
1150310224 17:64122225-64122247 CAGAGCAGACAGATGGGAAAAGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152049683 17:77962611-77962633 CTGAACAGACTGAGCGTGAAAGG + Intergenic
1152885808 17:82848726-82848748 GCGAACAGACAAAAGGTCAATGG + Intronic
1154498435 18:14979652-14979674 CTGCCAAAACAGATGGTCAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164949658 19:32326519-32326541 TAGAACAGAGAAATGGTCAAGGG - Intergenic
1165941561 19:39417047-39417069 ATGAACCAACAGGTGGTCAAGGG - Intronic
1166576250 19:43841000-43841022 CTGGAAAGACAGATTGTCATTGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
925682923 2:6442042-6442064 GTGAACAGACAGAAGGGGAATGG - Intergenic
925735271 2:6958317-6958339 CAGAACAGACACACGGACAAGGG + Intronic
926304263 2:11626791-11626813 CTGACGTGACAGCTGGTCAAAGG - Intronic
927627489 2:24737296-24737318 TTGCACACACAGATAGTCAAGGG + Intronic
928056697 2:28063496-28063518 CTGAACTGAGAGGTGGTAAAGGG - Intronic
928111651 2:28515322-28515344 CTGCACAGACAGATGGTAGCTGG - Intronic
928764224 2:34622888-34622910 CTGAACGGAGAAATGTTCAAAGG - Intergenic
929807855 2:45162714-45162736 CTGAACTGCCTGATGGCCAAAGG - Intergenic
931400251 2:61925001-61925023 ATGGAGAGACAGACGGTCAAGGG + Intronic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
932786837 2:74612752-74612774 CTGAACAACCAGTGGGTCAATGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933969904 2:87461933-87461955 CAGAGCAGGCAGATGGTCACAGG + Intergenic
934312380 2:91879048-91879070 ATGAACAGAAAGAAGCTCAATGG + Intergenic
936323877 2:111488563-111488585 CAGAGCAGGCAGATGGTCACAGG - Intergenic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937735695 2:125285690-125285712 CTGAACAGACAAATTACCAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938569254 2:132547064-132547086 CCGCACCGACAGAGGGTCAATGG + Intronic
939477767 2:142708191-142708213 CTGAAAAGACAGTGGATCAAAGG - Intergenic
940580850 2:155577737-155577759 TTGACCAGACAGATGATAAATGG - Intergenic
940903235 2:159146047-159146069 CTGAACAGCCAGATGGTTTTAGG - Intronic
940984574 2:160039816-160039838 CTGAACAAATAGATGGTCTGGGG + Intronic
941701901 2:168612749-168612771 CTGTTCAGACAGATGGCCTAAGG - Intronic
941714320 2:168748141-168748163 CTGTACACTCAGATGGCCAATGG + Intronic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
945289951 2:208117040-208117062 GTGTACACACAGATGATCAAGGG + Intergenic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
946611027 2:221458108-221458130 CTGAAGAGTAAAATGGTCAAGGG - Intronic
946845294 2:223853591-223853613 CTGAACCTACACATGGTCATAGG - Intergenic
948108685 2:235436341-235436363 ATGAACAAACAAATGGTCTAGGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169935112 20:10875413-10875435 CTGCAAAGTCACATGGTCAATGG - Intergenic
1170401799 20:15993891-15993913 GTGAATAGAAAGCTGGTCAAAGG + Intronic
1170785134 20:19461111-19461133 CTGAAAAGGCAGATGATCAGGGG - Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172506529 20:35466954-35466976 CTGAACACACAGTTCTTCAAGGG + Exonic
1173171052 20:40724193-40724215 TTGAACAAACAGATGGACATGGG - Intergenic
1173474488 20:43349380-43349402 TTGAACAATCAGATGGTCAGAGG + Intergenic
1174230550 20:49042547-49042569 CTGAAAAGACACATTGTCTATGG - Intergenic
1174569866 20:51493853-51493875 CTGAGCAGGCTGATGGTCAAGGG - Intronic
1178744454 21:35235146-35235168 AAGAACAGAGAGATGGGCAAAGG + Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182102739 22:27669567-27669589 GTGGACAGACAGATGGTCTAGGG - Intergenic
1182474039 22:30566216-30566238 CTCAAAAGGCAGAAGGTCAATGG - Intronic
1182907729 22:33952534-33952556 CTGAACAGTCAGATGGGAACCGG - Intergenic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
953050077 3:39332959-39332981 CAGAACATAAAGATGGTGAATGG - Exonic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
958883489 3:99699488-99699510 TTGGACAGACAGATGATCAAAGG + Intronic
961061814 3:123834955-123834977 CTGGACAGAGAGCTGGGCAATGG + Intronic
963173546 3:142275617-142275639 GGGAACACACAGATGGTGAATGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964933503 3:162053297-162053319 CTGAACAGAACCATGATCAATGG - Intergenic
965948536 3:174274467-174274489 CTGAACTGACAGAATGGCAAAGG - Intronic
969388702 4:6874613-6874635 CAGTACAGACAGGTGGTGAAAGG + Intronic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
970236024 4:13958814-13958836 GGGAACAGAGAGATGATCAAAGG + Intergenic
972082167 4:35166456-35166478 ATGAAAAGACACATGTTCAAAGG - Intergenic
974883260 4:67785334-67785356 ATGAGAAGACAGAGGGTCAAAGG - Intergenic
977082249 4:92546067-92546089 CTGAACAGGCAGATTGTGATAGG - Intronic
977565318 4:98574781-98574803 CCCAACAGACACATGGTAAATGG + Intronic
977944581 4:102897086-102897108 ATGAACAGAAAGAAGCTCAATGG + Intronic
978716421 4:111848538-111848560 CTGAACAGACTAATGCTCTAAGG + Intergenic
980002507 4:127506959-127506981 CAGAACAGAAAGAGGTTCAAAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984263468 4:177469612-177469634 TTCAAAAGAGAGATGGTCAAAGG + Intergenic
984821338 4:183885397-183885419 CTGAACACTCAGATGTCCAAAGG + Intronic
986642615 5:9887497-9887519 CTCAACAGGCAGATAGTGAAGGG - Intergenic
987474661 5:18375773-18375795 TTGAGCAGCCAGAGGGTCAACGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988773269 5:34452586-34452608 CTGAACAGCCTGATAGTCACAGG - Intergenic
989820929 5:45795406-45795428 CTCAAGAGTCTGATGGTCAAAGG - Intergenic
990195570 5:53311271-53311293 CTTTGGAGACAGATGGTCAAGGG - Intergenic
990326669 5:54683471-54683493 AAGAACAGACAAATAGTCAATGG - Intergenic
991499809 5:67265934-67265956 CTGAACACACATGTGGTGAATGG + Intergenic
992483486 5:77174033-77174055 CTGAACAGAGAGTAGGACAAAGG - Intergenic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
1000205971 5:159058909-159058931 CTGAACAGTCAGAGGGGCTATGG + Intronic
1002964725 6:1952593-1952615 CTGAACAGACAGTTTAGCAACGG + Intronic
1003519825 6:6848785-6848807 CTCAACAGAAAAATGCTCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004943534 6:20586686-20586708 CTTAACAGACACATGGCCAGTGG - Intronic
1006956104 6:37873557-37873579 CTTAACAGATTGATGGTCCAGGG + Intronic
1008030868 6:46692264-46692286 CTGCACAGAGAGAAGGTCATTGG - Exonic
1010573916 6:77509643-77509665 TTGGCCAGACAGATTGTCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012844006 6:104366987-104367009 CAGAAAAGACAGATGGCTAAAGG - Intergenic
1013697673 6:112723431-112723453 CCAAAAAGAAAGATGGTCAAGGG + Intergenic
1014019230 6:116568403-116568425 CTGAACAGAAATATCTTCAAGGG - Intergenic
1014562833 6:122912390-122912412 CTGAACAGCTATTTGGTCAAAGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018295117 6:162337814-162337836 CTGAAGAGACTGATGTTAAATGG + Intronic
1018346315 6:162903205-162903227 CTGCACAGTCAGATGGTCGGGGG - Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1021420252 7:20439023-20439045 CTCAAGAGGCAGATGGTCCATGG - Intergenic
1022202573 7:28131551-28131573 ATGAACAGACATTTGGTCCATGG + Intronic
1025707405 7:63880259-63880281 AAGAAGAGACATATGGTCAATGG + Intergenic
1026006062 7:66601246-66601268 CTGAACAGGGAGATGGTTGAGGG - Intergenic
1026327146 7:69320601-69320623 CTGAACAGACTGCTGGGCCATGG - Intergenic
1026455713 7:70570869-70570891 GTGGACAGACATATTGTCAAGGG - Intronic
1027463848 7:78489862-78489884 CTGAACAGACACATACTAAAAGG + Intronic
1028303978 7:89238636-89238658 CTGAACAGAAATATTGCCAAGGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1030865282 7:114695167-114695189 CTGAACATACGGAGGGTAAAGGG - Intergenic
1032445331 7:131977566-131977588 ATGAAAGGACAGAAGGTCAAGGG - Intergenic
1032955581 7:136968207-136968229 GGGAACAGAGAGATGGTCAAGGG - Intronic
1033416087 7:141162330-141162352 ATGAGCAGACAGGGGGTCAAAGG - Intronic
1033786844 7:144742241-144742263 CAGAAATGACAGATGATCAATGG - Intronic
1033892785 7:146035961-146035983 CTGAGCTAACAGAGGGTCAAGGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035086171 7:156260271-156260293 TTCAACAGACAGATGCTCATCGG + Intergenic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036078130 8:5523499-5523521 CCGAACAGACATGTGGTCCATGG - Intergenic
1036821756 8:11945631-11945653 CTGAGCAGACAGCTTTTCAAGGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1044560409 8:93606662-93606684 CTGAACACAGAGATGGGCAGTGG + Intergenic
1045182499 8:99800049-99800071 CTTAACAGAATGATAGTCAATGG - Intronic
1045514442 8:102845062-102845084 CTGCCCAGACAGCTGGTCAATGG - Intronic
1046089868 8:109488886-109488908 ATGAACAAACAGATGATTAAAGG + Intronic
1048449422 8:134520369-134520391 CTGAAAAGAGAGATGGTTACTGG + Intronic
1048825834 8:138424993-138425015 CTGAAGTGACAGATAATCAATGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1051948314 9:22599248-22599270 CAGAACAGACAGATGTTGGATGG + Intergenic
1052179703 9:25509277-25509299 CAGAACACACAGCTGGTGAATGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054822908 9:69541482-69541504 GAGGACATACAGATGGTCAATGG - Intronic
1056233595 9:84570619-84570641 CTGAGCAAACAGATGGCCAGAGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060578799 9:124724766-124724788 CTGGCCAGATAGAGGGTCAAAGG - Intronic
1061913547 9:133737679-133737701 CTGACCAGGCAGGTGGTGAAGGG - Intronic
1062116220 9:134810648-134810670 ATGAACAGGCATTTGGTCAATGG - Intronic
1188190629 X:27167859-27167881 CTGATCAGACAGAATATCAAAGG - Intergenic
1192442457 X:71184827-71184849 GAGAGCAGACAGATGGTCCAGGG + Intergenic
1193661192 X:84260532-84260554 CTTAACACACAGCTGATCAATGG - Intergenic
1194207308 X:91027665-91027687 CTAAACAGACAAATTGTCATTGG + Intergenic
1194659328 X:96612130-96612152 ATGAACAGTGAAATGGTCAAAGG - Intergenic
1195559639 X:106268963-106268985 GTGGTCAGACAGATGGGCAATGG + Intergenic
1195562322 X:106297376-106297398 GTGGTCAGACAGATGGGCAATGG - Intergenic
1197085904 X:122474853-122474875 GGAAACAGAAAGATGGTCAAAGG + Intergenic
1198766731 X:140087943-140087965 GATAACAGACAGATGGTAAAGGG - Intergenic
1200553050 Y:4602396-4602418 CTAAACAGACAAATTGTCATTGG + Intergenic
1201180343 Y:11336540-11336562 ATGAACAGAAAGAAGCTCAATGG + Intergenic