ID: 920215177

View in Genome Browser
Species Human (GRCh38)
Location 1:204357843-204357865
Sequence CAGGCTGGGTCTGGGCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 6, 3: 92, 4: 775}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920215167_920215177 9 Left 920215167 1:204357811-204357833 CCAAGAGAGCTCGCTCTATGAGC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 775
920215162_920215177 28 Left 920215162 1:204357792-204357814 CCTAGGCCAGTCCCCTGGGCCAA 0: 1
1: 0
2: 0
3: 19
4: 298
Right 920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 775
920215165_920215177 16 Left 920215165 1:204357804-204357826 CCCTGGGCCAAGAGAGCTCGCTC 0: 1
1: 0
2: 0
3: 13
4: 116
Right 920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 775
920215166_920215177 15 Left 920215166 1:204357805-204357827 CCTGGGCCAAGAGAGCTCGCTCT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 775
920215164_920215177 17 Left 920215164 1:204357803-204357825 CCCCTGGGCCAAGAGAGCTCGCT 0: 1
1: 0
2: 0
3: 8
4: 108
Right 920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 775
920215163_920215177 22 Left 920215163 1:204357798-204357820 CCAGTCCCCTGGGCCAAGAGAGC 0: 1
1: 0
2: 1
3: 19
4: 215
Right 920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG 0: 1
1: 0
2: 6
3: 92
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920215177 Original CRISPR CAGGCTGGGTCTGGGCGAGG TGG Intronic
900126594 1:1071603-1071625 CAGGCTGGGTCCTGACGGGGTGG - Exonic
900390611 1:2432321-2432343 CCGGCTGGGACTGGGGCAGGTGG + Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900988550 1:6087058-6087080 GAGGCCGGGTGTGGGCCAGGGGG - Intronic
901229665 1:7634679-7634701 CAGGCTGGGGCTGCCGGAGGAGG + Intronic
901425805 1:9182014-9182036 CATGCTGGGACGGGGCGAGCAGG + Intergenic
901477001 1:9496714-9496736 CATGCTGGGGCTGGGCACGGTGG - Intergenic
901502039 1:9658421-9658443 GAGGGTGGGGCTGGGTGAGGTGG + Intronic
901652406 1:10750610-10750632 GAGGCTGAGGCTGGGCGAGGTGG + Intronic
901727623 1:11254425-11254447 GAAGCTGGGGCTGGGCGTGGTGG - Intronic
901758253 1:11454434-11454456 CAGGCTGGGACTGGCGGAGCCGG - Intergenic
902192177 1:14771536-14771558 TAGGATAGGCCTGGGCGAGGTGG + Intronic
902708450 1:18222475-18222497 CATCCTGGATCAGGGCGAGGTGG - Intronic
902821791 1:18947895-18947917 AAGGCTGGCTCAGGGTGAGGAGG - Intronic
902861370 1:19248703-19248725 CAGCTTGGGGCTGGGCGTGGTGG - Intronic
903019080 1:20381089-20381111 CTGGGTGGGCCTGGGGGAGGGGG - Intergenic
903132736 1:21290246-21290268 CAGGCCGGGGCGGGGCGCGGCGG - Intronic
903167857 1:21533631-21533653 TAGACTGGGTCTGGGCACGGTGG + Intronic
903234116 1:21938396-21938418 CAGGCTGAGGCTGGGTGCGGTGG - Intergenic
903387394 1:22936484-22936506 AAGGCTGGGGCTGGGCCTGGGGG - Intergenic
903615076 1:24646238-24646260 CAGATTGTGGCTGGGCGAGGTGG + Intronic
903670169 1:25030876-25030898 CAGGGTGGGGCTGGGTGGGGTGG - Intergenic
903755377 1:25657110-25657132 AAGGTTGGGGCTGGGCGCGGTGG - Intronic
903817701 1:26076883-26076905 TTGGCTGGGGCTGGGCGCGGTGG + Intergenic
903929697 1:26855140-26855162 CAGGCTGAGCCTGGGCGTGGTGG + Exonic
904042087 1:27591015-27591037 CAGGCTGGGGCTGGGAGGTGGGG - Intronic
904137541 1:28325354-28325376 AAGGCTGGGGCTGGGCACGGTGG + Intergenic
904145804 1:28390500-28390522 CAGGCTGGGGCAGGGCATGGTGG + Intronic
904285328 1:29450076-29450098 CAGGCAAGGTTTGGGAGAGGAGG + Intergenic
904330145 1:29753524-29753546 CAGGATGAGTCTGGGGCAGGGGG + Intergenic
904390328 1:30180991-30181013 GAGGGTGGTTCTGGGCGAGTTGG + Intergenic
905231001 1:36514906-36514928 CCTGGTGGGTCTGGGAGAGGTGG + Intergenic
906086046 1:43135578-43135600 CAGCCTTGGGCTGGGAGAGGAGG + Intergenic
906568786 1:46818876-46818898 CAGGCTGGGTGTGGAGGAGTTGG + Exonic
906714266 1:47955317-47955339 CAGGCGGGATTTGGGAGAGGTGG - Intronic
906941006 1:50255304-50255326 CAGTCTGGGGCTGGGGGTGGTGG + Intergenic
907162063 1:52378057-52378079 CGGGCTGGGGCGGGGCGCGGTGG + Intronic
907875942 1:58488735-58488757 CACACTGGGGCTGGGCGTGGTGG - Intronic
908260263 1:62334805-62334827 CAGGGTGGGTCAGGGAGTGGTGG + Intergenic
910028128 1:82682863-82682885 CAGGTTCGGGCTGGGCGCGGTGG - Intergenic
910717102 1:90244125-90244147 CAGTTTGGGGCTGGGCGTGGTGG - Intergenic
911793986 1:102053942-102053964 CAGGTTGGGGCTGGGTCAGGTGG - Intergenic
912514625 1:110210270-110210292 AAGGGCGCGTCTGGGCGAGGCGG + Intergenic
913300686 1:117366765-117366787 CAGGCTGGGTGGGGGAGGGGCGG + Intergenic
914233806 1:145789983-145790005 TAGGCCGGGACTGGGCGTGGTGG - Intronic
915085059 1:153380866-153380888 GTGGCGGAGTCTGGGCGAGGAGG - Intergenic
915472524 1:156134575-156134597 CAGACTTGGGCTGGGCTAGGGGG + Intronic
915493912 1:156267582-156267604 CAGGCTGAGGTTGGGTGAGGAGG + Exonic
915504011 1:156340746-156340768 CAAGCTGGGGCTGGGCGCGGTGG - Intronic
915674253 1:157515794-157515816 CAGGGTGGGCCTGGGGGTGGGGG + Intronic
915831714 1:159137367-159137389 CGTGCTGGGGCTGGGCGTGGTGG + Intronic
915958990 1:160248446-160248468 CAGGCTGGGGCTGGGCGTGGAGG + Intronic
916067576 1:161148702-161148724 AAGACTGGGGCTGGGCGCGGTGG - Intergenic
916097080 1:161360823-161360845 TAGGCTGGGGCTGGGCGTGGTGG + Intronic
916164729 1:161955898-161955920 CAGGCTAGGTTTGGTCTAGGTGG - Intronic
916439275 1:164806969-164806991 CAAGATGGGGCTGGGCGCGGTGG + Intronic
916729446 1:167553341-167553363 CAGGCGGGCTGTGGGCGGGGCGG - Intronic
917455495 1:175182438-175182460 CAGGCTGATTGTGGGTGAGGGGG - Intronic
917633880 1:176916899-176916921 GAGGCTGGTTGTGGGCGGGGCGG - Intronic
917722429 1:177798403-177798425 CAGGCTGTGTCATGGTGAGGTGG + Intergenic
919563975 1:199160737-199160759 TAGACTGGGACTGGGAGAGGAGG - Intergenic
919780288 1:201216763-201216785 AAGGCTGGGGCTGGGGGTGGGGG + Intronic
919802368 1:201361505-201361527 CAGGCTGGGTCAGGCCCAGGGGG - Intronic
919855539 1:201703836-201703858 CAGCCTGGGTGTGGTGGAGGGGG + Intronic
920032849 1:203047992-203048014 AAGGCTAGGCCTGAGCGAGGAGG + Intronic
920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG + Intronic
920387781 1:205580542-205580564 GAGGGTGGGGCTGGGGGAGGGGG + Intronic
922178402 1:223215056-223215078 GAGGCTGGGTAGGGGCGGGGAGG - Intergenic
922457386 1:225785971-225785993 CACTCTGGGGCTGGGCGTGGTGG - Intronic
922766282 1:228158196-228158218 CATGCTGGGCCTGGGCGAGGAGG + Exonic
922798451 1:228353099-228353121 CAGCCTGGGTCTGGGCCGTGGGG - Intronic
924336230 1:242989144-242989166 CAGGCTGGGTGGGGGCGGGTAGG + Intergenic
924560628 1:245154685-245154707 CGGGCTGGGGCTGGGGGCGGGGG - Intergenic
1063373098 10:5534310-5534332 CAGTCTGCGTCTGGGTGGGGCGG - Intergenic
1063577566 10:7275371-7275393 CAGGCTGGCTCTGGTGGGGGTGG + Intronic
1064075418 10:12264788-12264810 GAGGCTGTGTCCGGGCGCGGTGG + Intergenic
1064146525 10:12830404-12830426 CTGGCTGGGCCTGGCGGAGGTGG - Exonic
1064245537 10:13665157-13665179 TAAGCTGGGGCTGGGTGAGGTGG - Intronic
1065694771 10:28369772-28369794 CAGACAGGGGCTGGGCGCGGTGG + Intergenic
1067067731 10:43113122-43113144 CAGGCAGGGTCAGGGACAGGGGG + Intronic
1067088416 10:43254629-43254651 AAGGCTGGGTGGGGGCTAGGTGG + Intronic
1067448904 10:46369232-46369254 CAGACTGAGTCTGTGGGAGGCGG + Intronic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1067588467 10:47491533-47491555 CAGACTGGGTCTGTGGGAGGCGG - Intronic
1067635593 10:47999624-47999646 CAGACTGGGTCTGTGGGAGGCGG - Intergenic
1067851761 10:49759210-49759232 CTGGCTGGGCCTGGGAGAGAGGG - Intronic
1068380173 10:56242869-56242891 CTGGCTGGGGCTGGGCGTGGTGG - Intergenic
1068462106 10:57342050-57342072 CAGGCTGGACCTGGTCAAGGTGG + Intergenic
1069849656 10:71396804-71396826 CGGGCGGGGGCCGGGCGAGGCGG + Intergenic
1069862016 10:71477454-71477476 GAGCCTGGGGCTGGGCGCGGTGG - Intronic
1070173379 10:73950036-73950058 TAGGCTGGGGCTGGGCGCAGTGG - Intergenic
1070488292 10:76951829-76951851 CAGGGTGGGGCTGGGGGAAGAGG - Intronic
1070488302 10:76951873-76951895 CAGGGTGGGGCTGGGGGAAGAGG - Intronic
1071609530 10:87020444-87020466 CAGACTGGGTCTGTGGGAGGCGG + Intronic
1072193840 10:93097798-93097820 CATTCTGGGGCTGGGCGCGGTGG + Intergenic
1072797323 10:98365971-98365993 CAGGCTGGCTCCGGGTCAGGCGG - Intergenic
1072831255 10:98661042-98661064 AAGGCTGTGTCAGGGCAAGGAGG - Intronic
1072834344 10:98695221-98695243 CAGGATGGGTCTGAGAAAGGGGG + Intronic
1072986583 10:100146125-100146147 CAGTCTTGGGCTGGGCGTGGTGG - Intergenic
1073116416 10:101094254-101094276 CAGGGTTGGTATGGGGGAGGTGG - Intronic
1073126815 10:101155984-101156006 CAGGCTGGGGCTGGGGAAGATGG + Intergenic
1073295852 10:102438248-102438270 AAGGCTGGGGCAGGGCCAGGAGG + Intergenic
1073315942 10:102580892-102580914 TAGGCTTGGGCTGGGCGTGGTGG + Intronic
1073465658 10:103693291-103693313 CGGGCTGGGGCGGGGCGGGGCGG - Intronic
1073978503 10:109127312-109127334 TATGCTGGGACTGGGGGAGGAGG + Intergenic
1074120152 10:110488051-110488073 CAGGCTGGGGCTGGACTGGGAGG + Intergenic
1074249572 10:111731089-111731111 CAGGCTGAGACTGGGAGGGGAGG - Intergenic
1075259875 10:120953958-120953980 GTGGCTGGGGCTGGGAGAGGGGG + Intergenic
1075647999 10:124109141-124109163 GAGCCTGGGGCTGGGCGAGTGGG + Intergenic
1076167588 10:128294775-128294797 CAGGCTGCCTCTGGGCCATGTGG + Intergenic
1076364513 10:129913542-129913564 CAGGCTGGGCTTGGAGGAGGCGG - Intronic
1076502405 10:130947736-130947758 GATGCTGGGTCTGGAGGAGGAGG + Intergenic
1076828306 10:132981510-132981532 CAGGCTGGGGCATGGCAAGGCGG + Intergenic
1076988068 11:253669-253691 CAGGCGAGGCCTGGACGAGGTGG - Intergenic
1077043172 11:533394-533416 CTGGCTGGGGCGGGGCGGGGCGG + Intronic
1077245824 11:1537546-1537568 CAGGCTGGGTCTGGGTGCCAGGG - Intergenic
1077281308 11:1747454-1747476 CTGGCTAGGTCTGGGCGGGCAGG - Intronic
1077323324 11:1952265-1952287 GAGGCTGTGGCTCGGCGAGGTGG - Intronic
1077357123 11:2123548-2123570 CAGCCTGGGACTGGGAGTGGAGG + Intergenic
1077410413 11:2401250-2401272 CAGGCTGCTTCTGGCCGCGGCGG + Intronic
1077551776 11:3203587-3203609 CAGGCTGGGGGTGGGGGTGGGGG + Intergenic
1077581438 11:3419692-3419714 CAGGCTGTGGCTGGGCGGGGTGG + Intergenic
1078259529 11:9691840-9691862 CAGGGTGGGTATGGGAGAGATGG + Intronic
1078390209 11:10930861-10930883 CCGGCTGCGGCCGGGCGAGGCGG - Intergenic
1078660025 11:13278487-13278509 GAGGCTGGGTGGGGGCGGGGAGG + Intronic
1078894172 11:15583560-15583582 CAGGCTGGTTCTGGGTGCAGTGG - Intergenic
1079476729 11:20838449-20838471 CAGACTGGGTGTGGGCTATGTGG + Intronic
1080447624 11:32352064-32352086 CTTGCTGGGTCTGGGGGTGGAGG + Intergenic
1080758527 11:35225527-35225549 CAAGCTGTGGCTGGGCGCGGGGG + Intronic
1080870233 11:36230309-36230331 CAGGCTGGGTGTGGGCCACAGGG - Exonic
1081494812 11:43597920-43597942 CAGGAGGGGGCTGGGCGCGGTGG - Intronic
1081713092 11:45230525-45230547 AAGGCTGGGGCTGGGCCAGGTGG - Intronic
1081811102 11:45914505-45914527 CAGGCTGGGGCAGGGGAAGGTGG + Intronic
1081842995 11:46216959-46216981 CACGCTGGGGCTGGACGTGGTGG + Intergenic
1081893846 11:46567859-46567881 CTAGCTGGGGCTGGGCGCGGTGG + Intronic
1081978327 11:47249804-47249826 CAGGCTTGGCCTGGGCGCCGTGG + Intronic
1083249943 11:61459905-61459927 GAGGCCGGGGCTGGGCGCGGTGG - Intronic
1083281475 11:61629622-61629644 CAGGCAGGCCCTGGGGGAGGGGG + Intergenic
1083344756 11:61981588-61981610 CACCTTGGGGCTGGGCGAGGTGG + Intergenic
1083383925 11:62293458-62293480 CAGGCTGGGACAGGGAGAAGAGG - Intergenic
1083579795 11:63817823-63817845 CGGGCTGGGTCTAGGCGGTGGGG - Exonic
1083720266 11:64600395-64600417 CGTGCTGGGGCTGGGCGGGGTGG + Exonic
1083747622 11:64744603-64744625 CGGCCCGGGTCTGGGAGAGGGGG - Intronic
1083802807 11:65056692-65056714 AAGGCTGGGCATGGGCGTGGTGG - Intronic
1083840574 11:65302012-65302034 CAGGCAGGCTCTGGGTGGGGAGG - Intronic
1083932313 11:65852796-65852818 CAGGCTGGGGCTGGGGGCTGCGG - Intronic
1084031049 11:66480680-66480702 GAGGCCGGGGCAGGGCGAGGAGG + Intronic
1084150183 11:67284495-67284517 CAGGCTGGGGCCGGGCATGGTGG + Intronic
1084238348 11:67802527-67802549 CAGGCTGTGGCTGGGCCGGGTGG + Intergenic
1084276751 11:68055755-68055777 CAGGCTGAGGCCGGGCGCGGTGG + Intronic
1084653615 11:70502764-70502786 CAGGCTGGAGCTGGGCGATGTGG + Intronic
1084716434 11:70877257-70877279 CAGCCAGGGTCAGGGCCAGGAGG + Intronic
1084834065 11:71790303-71790325 CAGGCTGTGGCTGGGCCGGGTGG - Intronic
1084872942 11:72109937-72109959 GAGGCTGGGTGTGGGTGGGGAGG + Exonic
1084899606 11:72299798-72299820 TAGGCTGGGGCTGGGGGAAGGGG + Intronic
1085264580 11:75229668-75229690 CAAGCTGGCTCTGGGCCAGCTGG + Intergenic
1085338346 11:75714788-75714810 CAAGCTAGGGCTGGGCGCGGTGG + Intergenic
1088271765 11:108041561-108041583 CAGGCCGGGTGTGGGCATGGTGG - Intronic
1088522302 11:110712557-110712579 CAGGCTGGGACGAGGCTAGGAGG - Intronic
1089072212 11:115709557-115709579 CATGCTGGGGCTGGGCGGGGTGG + Intergenic
1089216536 11:116837658-116837680 CAGCCAGGGTCTGGGCTGGGAGG + Exonic
1089576475 11:119447905-119447927 GGGGCTGGCTCTGGGAGAGGAGG - Intergenic
1089708714 11:120299695-120299717 CAGGCTGGGTCTGAGATAGCAGG - Exonic
1090026357 11:123170726-123170748 CAGGCTTCGGCTGGGCGTGGTGG - Intronic
1090130973 11:124141887-124141909 CAGGCTGGTTCTGTGGGTGGAGG - Intronic
1090399702 11:126441194-126441216 CAGTCTGGGTATGGACGTGGAGG - Intronic
1090781663 11:130012314-130012336 TAGGCTGGGGCTGGGCACGGTGG - Intergenic
1090822541 11:130356740-130356762 CAGCCTGGGGCCGGGCGTGGTGG + Intergenic
1090868822 11:130725254-130725276 CAGGGTGGGGCTGGGCGAGCTGG - Intergenic
1091223495 11:133944577-133944599 CAGGCTGGGGCAGGGCCAGCTGG - Intronic
1202806312 11_KI270721v1_random:7460-7482 GAGGCTGTGGCTCGGCGAGGTGG - Intergenic
1091460613 12:641551-641573 CAGGCTAGGGCCGGGCGCGGTGG + Intronic
1091562152 12:1623013-1623035 CAGGATGGGTTTGGGTAAGGAGG + Intronic
1091739064 12:2946964-2946986 TAGGCCGGGTGTGGGCGCGGTGG + Intergenic
1092159945 12:6310681-6310703 CAGCGCGGGTCCGGGCGAGGAGG - Intronic
1092210572 12:6643690-6643712 GAGGGTGGGGCTGGGCCAGGTGG + Intronic
1092409035 12:8240163-8240185 CAGGCTGTGGCTGGGCCGGGTGG + Intergenic
1092633849 12:10417621-10417643 CAGGGTGGTTGTGGGTGAGGAGG + Intronic
1092820014 12:12344752-12344774 TAGGCTGGGGCTGGGCGTGGTGG - Intronic
1094406131 12:30118275-30118297 CAGGCTGAGCCTGGGTTAGGTGG + Intergenic
1094644309 12:32306528-32306550 AAAGCTGGGGCTGGGCGCGGTGG - Intronic
1095206305 12:39443429-39443451 CAGGCTGGGGGAGGGCGAGGTGG - Intergenic
1095989603 12:48025600-48025622 CAGGCTTGGGCTGGGGGCGGGGG - Intergenic
1096499150 12:52054912-52054934 CAGGCTGGGGCTGGGGCCGGTGG - Exonic
1096651106 12:53062361-53062383 CAGGCTGCCTGTGGGAGAGGAGG - Exonic
1096771630 12:53939241-53939263 CAGGGTGGCGCTGGACGAGGTGG - Exonic
1096784699 12:54010257-54010279 CAGGCTGGTTCTCTGAGAGGAGG - Intronic
1096874976 12:54621577-54621599 AAGGCTGCGGCTGGGCGCGGTGG - Intergenic
1097090676 12:56501996-56502018 CAAGCTGGGGCTGGGTGTGGTGG - Intergenic
1097229268 12:57499306-57499328 AAGGCTGGGGCTGGGCGCGGTGG + Intronic
1097450157 12:59728227-59728249 CATAATGGGTCTGGGCCAGGTGG + Intronic
1097800043 12:63903918-63903940 CAGGCTGGAGCTGGGTGTGGTGG - Intronic
1098223619 12:68297929-68297951 CAGGCAGGGGCTGGGTTAGGTGG - Intronic
1098556429 12:71824079-71824101 CAGGCTGGGTCTGGGGAATCAGG + Intergenic
1100976741 12:100130626-100130648 CAAGTTGGGGCTGGGCGCGGTGG + Intronic
1101126876 12:101644322-101644344 CACGCTGGGGCTGGGCACGGTGG - Intronic
1101431709 12:104632571-104632593 CAGGGTTGGTCTGGGGGAGGAGG + Intronic
1102092861 12:110207804-110207826 AAGGCTGGGGCTGGGCGCGGTGG - Intronic
1102177667 12:110887880-110887902 AAGGCTGGGGCCGGGCGCGGTGG - Intronic
1102261293 12:111445001-111445023 CAGGCTGGCTGTGGGTGAGGAGG + Intronic
1102466380 12:113133107-113133129 CAGGCTGGGTCTGCAGGAGGGGG - Intronic
1103011783 12:117463649-117463671 CAGGCTGGGTATGGCCTATGGGG + Exonic
1103089498 12:118087547-118087569 AAGGAGGGGGCTGGGCGAGGTGG + Intronic
1103325411 12:120116880-120116902 CAGGCTGCGGCTGCGCAAGGCGG - Intronic
1103594821 12:122018217-122018239 CTGGCTGGGGCTGGGGAAGGAGG + Intergenic
1103762995 12:123264870-123264892 CAGGCAGGGTCGGGGGCAGGGGG + Intronic
1103850342 12:123928857-123928879 CAGGCTGTGTGTGGGGGGGGGGG - Exonic
1103930743 12:124449577-124449599 CAGGCTGGGTTTGGGAGGGTGGG - Intronic
1104623820 12:130337595-130337617 CAGGCGGGGTCTTGGCGGGATGG + Intergenic
1104935294 12:132361145-132361167 CAGGCTGGGCCAGGGCTGGGGGG + Intergenic
1105031023 12:132883823-132883845 CAAGTTCTGTCTGGGCGAGGTGG + Intronic
1105052060 12:133063588-133063610 CAGCCTGAGTCTGGGTGATGGGG - Intergenic
1105214660 13:18277284-18277306 CTGACTGGGTCTGGGCTGGGGGG - Intergenic
1106971644 13:35147645-35147667 CAGACTGTGTCTGGGTCAGGAGG + Intronic
1107089342 13:36460019-36460041 GAGGCTGGGGCCGGGCGCGGTGG + Intergenic
1107848713 13:44548227-44548249 TAGACTGGGGCTGGGCGCGGTGG + Intronic
1108256943 13:48620017-48620039 CAGGCCGGGGCTGGGTGTGGTGG - Intergenic
1110253809 13:73409762-73409784 CAGGTTGGTGCTGGGTGAGGTGG + Intergenic
1110630201 13:77698207-77698229 CGGGCTGGCGCTGGGCGCGGGGG + Intronic
1111983412 13:95040521-95040543 CAAACTGGGGCTGGGCGCGGTGG - Intronic
1112277158 13:98032118-98032140 CAGGCTGGGGCCAGGCGCGGTGG - Intergenic
1112503149 13:99957332-99957354 CTGGCTGGGGCTGGGCTGGGGGG + Intergenic
1113262654 13:108582484-108582506 CTGGCTGGGTTTGGGTGAGCTGG - Intergenic
1113605190 13:111599957-111599979 CAGGCTGGGTCTGTTCCTGGCGG + Intronic
1113808880 13:113125630-113125652 CAGGCCGGGTCTGGGCCACGTGG - Intronic
1113813273 13:113154464-113154486 GAGGCGGGGTGTGGGGGAGGAGG + Intergenic
1115234681 14:31197315-31197337 AGGGCTGGGACTGGGCGTGGTGG - Intronic
1115411497 14:33080391-33080413 CAGACTGGGGCCGGGCGCGGTGG - Intronic
1115684325 14:35779236-35779258 CAGGCTTGGGCTGGGCAAGGTGG + Intronic
1115906669 14:38209421-38209443 CGGGCTGGGGCTAGGAGAGGAGG - Exonic
1116915366 14:50520075-50520097 AAAGCTGGGGCTGGGCGTGGTGG + Intronic
1117132046 14:52695960-52695982 CGGGCTGGGGCTGGGCGGGGCGG - Intergenic
1117828108 14:59724575-59724597 CAGCCTGGGGCTGGGCGTGGTGG + Intronic
1118030480 14:61813097-61813119 AAGGCTGGCTCTGGGCCTGGGGG - Intergenic
1118322860 14:64763503-64763525 CAGGGAGGGGCTGGGAGAGGTGG - Intronic
1118815256 14:69307886-69307908 CAGGGTGGGACTGGGGGTGGGGG - Intronic
1119355312 14:74001213-74001235 CAGGGTGTGTCTGGGCGCAGTGG + Intronic
1119367544 14:74106876-74106898 CAGGCCGGGGCCGGGCGTGGTGG - Intronic
1119543683 14:75456865-75456887 GAGGAGGGGTCTGGGTGAGGCGG + Intronic
1119633658 14:76256575-76256597 CAGGATGGGGCTGGGCTTGGAGG + Intergenic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1119900073 14:78251913-78251935 CAGGCTGTGGCTGGCAGAGGAGG + Intronic
1120953166 14:90060951-90060973 AAGGCGGGGTCTCGGGGAGGGGG + Intergenic
1121086567 14:91150968-91150990 CAGGCTGGGTCCAGGAGATGGGG - Intronic
1121109593 14:91303420-91303442 GAGGCGGGGTCTGGGGGAGGTGG - Intronic
1121323782 14:93007982-93008004 CAGGCTGAGCCTGGGCCTGGTGG - Intronic
1122319343 14:100844316-100844338 CAGCCAGGGGCTGGGCCAGGAGG - Intergenic
1122816415 14:104316295-104316317 CAGGCTGGGACTGGCCCTGGAGG - Intergenic
1122856777 14:104563792-104563814 GAGGCTGTGTGTGGGGGAGGAGG + Intronic
1122864902 14:104599298-104599320 CCGGCTGGGTTTGGGCAATGGGG + Intronic
1123012494 14:105356162-105356184 CAGGCTGGGCCTGGGGGTGTGGG - Intronic
1123035245 14:105469314-105469336 CAGGATGGGCCTGGGGGACGTGG - Intronic
1123627521 15:22238045-22238067 CAGGCTGGGTCCGGGGAATGTGG + Intergenic
1124023483 15:25944476-25944498 CAGGGTGGGTCCCGGCGTGGTGG - Intergenic
1124593664 15:31076327-31076349 GAGGCTGAGTCTGGGGGAAGGGG - Intronic
1124595779 15:31090349-31090371 CATCCTGGGGCTGGGCGTGGTGG + Intronic
1125064722 15:35468778-35468800 CAGGCAGAGGCTGGGCGCGGTGG + Intronic
1125503198 15:40252298-40252320 CAGGTCGGGTCTCCGCGAGGCGG + Exonic
1125514019 15:40307985-40308007 CAGGGTGGGGCTGGGGGTGGGGG - Intergenic
1125535350 15:40439007-40439029 CAGACTGGGACAGGGAGAGGGGG + Intergenic
1126689787 15:51280383-51280405 CAGGCTTTGGCTGGGCGTGGTGG - Intronic
1126705524 15:51401918-51401940 CAGGCAGGGGCTGGGCCATGGGG - Intronic
1126715007 15:51506348-51506370 CAGGCTGGGCATGGGCATGGTGG - Intronic
1127362416 15:58256101-58256123 CACTCTGGGTCTGGGAGATGAGG - Intronic
1127772552 15:62243272-62243294 CAGGCTGGCTCAGGACAAGGAGG - Intergenic
1128044642 15:64606854-64606876 CAGGCATGGGCTGGGCGTGGTGG + Intronic
1128087436 15:64895739-64895761 CAGACTGGGACTGGGGGTGGGGG + Intronic
1128754507 15:70172276-70172298 CAGGCTGCCTCTGGGTGAGCTGG + Intergenic
1128758834 15:70201094-70201116 GAGCCTGGGCCTGGGCGAGGGGG + Intergenic
1129016682 15:72474753-72474775 TACCCTGGATCTGGGCGAGGTGG + Exonic
1129204721 15:74030122-74030144 CAAGCTGGGGCTGGGCAAGGAGG - Intronic
1129241979 15:74257305-74257327 CAGCATGGGGCTGGGGGAGGCGG + Intronic
1129459055 15:75690788-75690810 CAGACTTGTTCTGGGCCAGGAGG - Exonic
1129601757 15:77003196-77003218 CAGCCAGGCTCTGGGTGAGGAGG - Intronic
1129847092 15:78772977-78772999 CAGGCTGGGTGGGGGCCACGAGG + Intronic
1130272844 15:82461306-82461328 CAGGCTTGTCCTGGGCCAGGAGG + Intergenic
1130371391 15:83287696-83287718 CAGGCTGAGTCAGGGGGAAGTGG + Intergenic
1130465194 15:84188659-84188681 CAGGCTTGTCCTGGGCCAGGAGG + Intergenic
1130487494 15:84406143-84406165 CAGGCTTGTCCTGGGCCAGGAGG - Intergenic
1130499071 15:84484877-84484899 CAGGCTTGTCCTGGGCCAGGAGG - Intergenic
1130587485 15:85193272-85193294 CAGGCTTGTCCTGGGCCAGGAGG + Intergenic
1131116228 15:89797758-89797780 CAGGCTGTGGCTGGGCTGGGTGG - Intronic
1132496565 16:266204-266226 CAGCCTGGGTCAGGGTGGGGAGG + Intronic
1132563692 16:610759-610781 CAGGCAGGGTCAGGGCAAGCAGG - Intronic
1132618627 16:854247-854269 CAGGCTGGGCCTCTGGGAGGAGG + Exonic
1132670785 16:1101555-1101577 CAGGCTGGGACTGGGGCAGCAGG + Intergenic
1132746490 16:1438425-1438447 CAGGCTGGGTGAGGGACAGGAGG + Intronic
1132748396 16:1446401-1446423 GAGGCTGGGCCTGCGCAAGGAGG + Exonic
1133305208 16:4804139-4804161 CAGGCTGGGTCTGGGCCAAAGGG + Exonic
1133335633 16:5005021-5005043 CAGAATAGGGCTGGGCGAGGTGG + Intronic
1133350002 16:5094971-5094993 CAGGCTGTGGCTGGGCCGGGTGG + Intronic
1133405681 16:5522684-5522706 AAGGTTGTGTCTGGGTGAGGGGG - Intergenic
1133565153 16:6986484-6986506 CAGCCTGGGGCTGGACGTGGTGG - Intronic
1133782589 16:8951469-8951491 CCGGCTGGCTCAGGGCGAGGTGG - Intronic
1133946032 16:10349211-10349233 CAATCTGGGGCTGGGCGCGGTGG - Intronic
1133964682 16:10522014-10522036 CACTTTGGGTCTGGGCGTGGTGG + Intergenic
1134187003 16:12092235-12092257 CAGGCAGGATTTGGGGGAGGAGG - Intronic
1135268930 16:21052315-21052337 CAGGTTGGGGGTGGGCAAGGAGG - Intronic
1136240228 16:28938901-28938923 CAGGCTGGGTCTGGCCCATCGGG - Exonic
1136535022 16:30894116-30894138 CAGGCCGGGGCGGGGCGCGGCGG - Exonic
1136584218 16:31173561-31173583 GAGGCTGAGTCTGGGGCAGGGGG - Intergenic
1136592888 16:31228235-31228257 GAAGCTGGGGCTGGGCGCGGCGG - Intergenic
1137032203 16:35533477-35533499 GATGCTGGCTCTGGGTGAGGGGG - Intergenic
1137444266 16:48522275-48522297 CAGGCTGGGGTTGGGGGTGGTGG + Intergenic
1137743919 16:50807009-50807031 CAGGCTCCGGCTGGGCGTGGTGG + Intergenic
1137977945 16:53046729-53046751 CAGGATGTGTCTGGGAGAGGTGG - Intergenic
1138132630 16:54494116-54494138 CATTCTGGGTCTGGGCGTGGTGG + Intergenic
1138285831 16:55809690-55809712 CAGGGCGGGTGTGGGAGAGGTGG - Intronic
1138442834 16:57045557-57045579 CAGCATGGGTCTGGGGGTGGGGG - Intronic
1138486793 16:57350540-57350562 CAGGGTGGGTCTGGGAGGTGGGG - Intergenic
1139127097 16:64091365-64091387 CAGGCTGTGTCTCTGCAAGGGGG - Intergenic
1139336191 16:66232984-66233006 CAGAATCGGGCTGGGCGAGGTGG - Intergenic
1139368629 16:66450426-66450448 CAGGATGGGTCTGGATGGGGTGG + Intronic
1139511613 16:67431216-67431238 CGGGCTGGGGCGGGGCGGGGCGG - Exonic
1139661791 16:68425762-68425784 CAGGCTGGGGCTGGGTGGTGGGG + Intronic
1139772209 16:69287280-69287302 CAGGCTGGGGCCGGACGCGGTGG + Intronic
1139823092 16:69736151-69736173 CAGGCTGGGGCTGGGCGTGGTGG - Intergenic
1139931623 16:70531557-70531579 GGGGCTGGGCCTGGGTGAGGTGG - Intronic
1140097885 16:71891059-71891081 CAGGAAGGGGCTGGGCGCGGTGG - Intronic
1140275629 16:73506274-73506296 CATACTGGGTCCGGGCCAGGTGG - Intergenic
1140460321 16:75134467-75134489 CAGGCCTGGGCTGGGCGCGGTGG + Intergenic
1140911380 16:79456179-79456201 CAGGCAGGCTCTGTGCGGGGTGG - Intergenic
1141116816 16:81315684-81315706 CGGGCCCGGCCTGGGCGAGGGGG - Intronic
1141494010 16:84394363-84394385 CAGACTGGGACTGGGGAAGGGGG - Intronic
1141635054 16:85310182-85310204 CAGGCTGGGTCAGGGCGTGGGGG - Intergenic
1141658577 16:85429504-85429526 CAGGAAGGTTCTGGGCAAGGAGG - Intergenic
1141744760 16:85918496-85918518 CAGGCTGGCTCAGGGACAGGCGG - Exonic
1142142648 16:88479461-88479483 CAGGCTGGGTCTGGGGGCCGTGG - Intronic
1142154179 16:88525774-88525796 GGGGCTGGGACAGGGCGAGGTGG - Intronic
1142686025 17:1577419-1577441 CTGGCAGGGTCTGAGGGAGGGGG - Intronic
1142696773 17:1638374-1638396 CAGCCCGGCTCTGGGCCAGGAGG - Intronic
1142847687 17:2690117-2690139 CAGGCTGGGCCCGGGGGTGGTGG + Exonic
1143067741 17:4263476-4263498 CGGGCTGGGTTGGGGTGAGGTGG - Intronic
1143352008 17:6295698-6295720 CAGGCTGGGGCTGAGGGAAGAGG - Intergenic
1143362424 17:6382812-6382834 CAGCCTGGCTCTGGGCCATGTGG - Intergenic
1143628200 17:8122735-8122757 GAGGCTGGCTGTGGGGGAGGGGG + Intronic
1143747927 17:9006980-9007002 TATGCTGGGTCTTGGCCAGGGGG - Intergenic
1143785626 17:9253547-9253569 CAGGCTGGGATGGGGCGAAGGGG + Intronic
1144357464 17:14459807-14459829 AGGGCTGGGGCTGGGCGTGGTGG - Intergenic
1144814303 17:18022836-18022858 CCGGCTGGGGCCGGGCGCGGTGG + Intronic
1145766714 17:27463220-27463242 GAGGCTGGGCCTGGGTGCGGTGG + Intronic
1145815240 17:27790379-27790401 GTGGCTGGGGCTGGGCGCGGTGG - Intronic
1145934554 17:28707125-28707147 CAGCCAGGGTCTAGGCAAGGAGG + Intronic
1145999301 17:29121816-29121838 GGGGCTGGGTGTGGGGGAGGAGG - Intronic
1146211884 17:30949459-30949481 CAGACTAGGGCTGGGCGCGGTGG + Intronic
1146956185 17:36937529-36937551 CGCGCTGGGCCTGGGGGAGGGGG - Exonic
1147130935 17:38408382-38408404 AAAGCTGGGGCTGGGCGCGGTGG + Intergenic
1147169755 17:38611025-38611047 CGGGGTGGGGCCGGGCGAGGTGG + Intergenic
1147606654 17:41777472-41777494 CAGGCTGGGGCTGCCCAAGGAGG + Intronic
1147675575 17:42202694-42202716 GAGGCAGGGTCTGGGGGAGGAGG + Intronic
1147689990 17:42309139-42309161 GAGGCAGGGTCTGGGGGAGGAGG - Intronic
1147858686 17:43503073-43503095 TAAGCTAGGTCTGGGCAAGGTGG + Intronic
1148052950 17:44778069-44778091 GAGGCTGGAGCTGGCCGAGGGGG + Intronic
1148178178 17:45585213-45585235 GAGCCTGGGACGGGGCGAGGTGG + Intergenic
1148219010 17:45849372-45849394 CAGGGAGGGTCTGGGTCAGGAGG + Intergenic
1148678671 17:49460158-49460180 CAGGCTGGGTCTGTGCCTGTGGG - Intronic
1148716807 17:49721800-49721822 AAGGCTAGGGCTGGGCGTGGTGG + Intronic
1148735842 17:49864466-49864488 TAGGCTGGGTCTGGGCTGGAGGG - Intergenic
1148799376 17:50213755-50213777 CAGGCTGGGTCAGGAGGAGGGGG - Intergenic
1148860562 17:50602326-50602348 CAGGCTGGGGCAGGGCAGGGAGG - Intronic
1148898714 17:50858235-50858257 TAGACTGGGTCAGGGGGAGGGGG - Intergenic
1149266961 17:54937405-54937427 TGGGATGTGTCTGGGCGAGGAGG + Intronic
1149494526 17:57108897-57108919 CTGACAGGGGCTGGGCGAGGGGG - Intronic
1149599505 17:57884481-57884503 GCGGCTGGGGCCGGGCGAGGTGG - Intronic
1149655882 17:58309371-58309393 CGGGCTGGGACTGGTGGAGGTGG + Exonic
1149657185 17:58316381-58316403 AATGCTGGGGCTGGGCTAGGGGG + Intronic
1149828383 17:59850087-59850109 CATACTGGGGCTGGGCGCGGTGG + Intergenic
1150247540 17:63687700-63687722 AAGTCTGGGGCTGGGCGCGGTGG + Intronic
1150408074 17:64919503-64919525 GAGCCTGGGACGGGGCGAGGTGG + Intergenic
1150424676 17:65067821-65067843 CAGGCCGGGCATGGGCGCGGTGG + Intergenic
1150690467 17:67362385-67362407 CAGGCTCTGGCTGGGCGCGGTGG + Intronic
1150701841 17:67453960-67453982 CAGGCTCGGGCTGGGCGTGGTGG + Intronic
1150782699 17:68135637-68135659 CTGGCGGGGTCTGGGCAGGGGGG - Intergenic
1151448353 17:74181877-74181899 CAGGCAGGGTCTGGAAGAGAAGG - Intergenic
1151548219 17:74806337-74806359 GAGGCTGGGTCTGGGTTAGCCGG - Intronic
1151890714 17:76949158-76949180 AAGGCCGGATCTGGGCCAGGTGG + Exonic
1152068945 17:78125766-78125788 CAGGCGGAGGCTGGGCCAGGCGG + Exonic
1152266142 17:79296018-79296040 CAGGGTGGGGCTGGGCTTGGGGG + Intronic
1152389072 17:79992169-79992191 CGGGGTGGGTCTGGCGGAGGCGG + Intronic
1152657902 17:81528412-81528434 CCGGCTGGGTCTGGGGGCTGTGG + Intronic
1152693844 17:81734162-81734184 CAGGCTGGGGTTGGGTGAGGAGG - Intergenic
1152740069 17:82014886-82014908 CAGGCTGTGTCAGGGCAGGGCGG + Intronic
1152791405 17:82282390-82282412 AGGGCTGGGTCTGGGGCAGGGGG - Intergenic
1152800524 17:82328689-82328711 CAGCCTGGGTCTGTTCCAGGTGG + Intronic
1153547262 18:6220477-6220499 CAGGGTGGGACTGAGCGAGAAGG - Intronic
1153886925 18:9475543-9475565 CAGGCAGAGGCTGGGCGGGGTGG + Intronic
1153932401 18:9889778-9889800 AAGACTGGGACTGGGCGCGGTGG + Intergenic
1154123460 18:11670087-11670109 CAGGCTGGGGCTGGGGGAGAGGG - Intergenic
1156352209 18:36311196-36311218 CAGGATGTGTCTGGGCAGGGAGG + Intronic
1156370152 18:36465757-36465779 GAGGCTGTGTGTGGGCGTGGTGG + Intronic
1157185953 18:45540243-45540265 CAGGATGTGGCTGGGCAAGGGGG - Intronic
1157426066 18:47585157-47585179 CACCCTGGGTCTGGGAGAGGGGG + Intergenic
1157755158 18:50211073-50211095 CATTCTGGGGCCGGGCGAGGTGG - Intergenic
1157862519 18:51153851-51153873 CAGGCCAGGGCTGGCCGAGGGGG + Intergenic
1157948437 18:52007153-52007175 CAGGCTGGGGCTGTGCAAGTAGG - Intergenic
1158366570 18:56743962-56743984 GAGGCTGGGGCCGGGCGCGGTGG + Intronic
1160023983 18:75204256-75204278 CAGCCTGGGGCGGGGAGAGGGGG - Intronic
1160344171 18:78117768-78117790 CACACTGGGTCTTGGAGAGGAGG - Intergenic
1160375719 18:78410201-78410223 CAGGCTGGGGCTGGGCAGAGAGG - Intergenic
1160702957 19:517402-517424 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160702982 19:517453-517475 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703023 19:517546-517568 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703051 19:517608-517630 CAGGCTGGGTGGGGGCTAGAAGG + Intronic
1160703079 19:517670-517692 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703167 19:517876-517898 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703332 19:518295-518317 CAGGCTGGGTAGGGGCTGGGAGG + Intronic
1160858296 19:1227174-1227196 GGGGCTGGGGCTGGGAGAGGAGG - Intronic
1160956426 19:1694447-1694469 CAGGCTGGGCGTGGCCAAGGTGG - Intergenic
1161023260 19:2021743-2021765 CAGCCTGGGGCTGGGCCAGGTGG - Intronic
1161251017 19:3280288-3280310 GGGGCTGGGGCTGGGCGTGGTGG + Intronic
1161331906 19:3692575-3692597 GAAGCTGGGGCTGGGCCAGGTGG - Intronic
1161400769 19:4065633-4065655 CAGGCCGGGCCCGGGCGTGGGGG - Intronic
1161457542 19:4377061-4377083 CAGGCTGGGAATGGGCCTGGCGG - Intronic
1161497361 19:4594206-4594228 CAATCTCGGTCTGGGCGCGGTGG - Intergenic
1161564996 19:4997018-4997040 CAGTGTGGGTCTGGGTGAGTGGG + Intronic
1161605811 19:5214330-5214352 CAGGCTGGGGCTGGGGGCTGAGG - Intronic
1161741765 19:6025242-6025264 CAGGATGGGACTGGGGGACGTGG - Intronic
1161853992 19:6753378-6753400 CAGGCTGGGTTTGGGGGATCCGG + Intronic
1161989930 19:7678814-7678836 CAGGGTGGGTGTGGGGCAGGGGG + Intronic
1162523951 19:11197029-11197051 CGGGCTGGGCCTGGGCTTGGCGG - Intronic
1162532782 19:11245537-11245559 CCTGCTGGGGCTGGGCAAGGGGG - Intronic
1162645644 19:12048229-12048251 CAGGCCTGGGCTGGGCGCGGTGG + Intronic
1163035696 19:14567661-14567683 GAGGCTGGGTCTGAGGGAGGCGG - Intronic
1163054262 19:14706451-14706473 CAGGCAGGGGCTGGGGAAGGTGG - Intronic
1163089746 19:15011406-15011428 TAGGCTGGGGTTGGGCGTGGGGG - Intronic
1163263932 19:16207130-16207152 GAGGATGGGCCTGGCCGAGGTGG + Intronic
1163369416 19:16893660-16893682 CAGGCAGGTTCTGGGCCTGGGGG + Intronic
1163504110 19:17694525-17694547 TAGCCTGGGGCTGGGCGTGGGGG - Intergenic
1163520331 19:17788090-17788112 CAGGGTGGGGCTGGAGGAGGGGG - Intronic
1163588384 19:18176433-18176455 GAGGCTGGGGCCGGGCGTGGTGG - Intronic
1163634397 19:18431530-18431552 CTGGCTGGTTCTGGAGGAGGGGG + Intronic
1163743716 19:19032908-19032930 AAGGATGGGACTGGGGGAGGCGG - Intronic
1163799119 19:19354463-19354485 CAGGCTGGGGCTGGGGAAGAGGG - Intronic
1164037649 19:21468400-21468422 CAGGTTGGGTCTGGGGGTAGTGG - Intronic
1165065515 19:33225935-33225957 CAGGCCGGGACTGGGGGAGGGGG - Intergenic
1165094558 19:33403113-33403135 AAGGCTGGGCCTGGCTGAGGGGG + Intronic
1165243914 19:34487079-34487101 CAGGCAGGGACTGGGCTTGGTGG - Intronic
1165263870 19:34644319-34644341 AAGGCTGGGGCTGGGCAAGGTGG - Intronic
1165328191 19:35126245-35126267 GAGGCTGGGCCTGGGGGCGGGGG - Intronic
1165403017 19:35613727-35613749 CAGGCTGTGTCTGGGCCAGGGGG + Exonic
1165476238 19:36032577-36032599 GGGGCTGGGCCTGGGGGAGGTGG - Intronic
1165601701 19:37059564-37059586 CAGGCGGAGTCTGGGGGAAGCGG + Intronic
1165620883 19:37246481-37246503 CAGTCTGAGGCTGGGCGCGGTGG + Exonic
1165767084 19:38358355-38358377 CAGGGTGGCTGTGGGCCAGGAGG + Intronic
1165928553 19:39342267-39342289 AAGGCGGGGTCGCGGCGAGGGGG - Intronic
1166006300 19:39909596-39909618 CAGGATGGGGCTGGGTGTGGTGG - Intronic
1166120632 19:40684380-40684402 CAGGGTGCGGCGGGGCGAGGGGG - Intronic
1166389247 19:42399937-42399959 CAGTCTGGGGCTGGGTGTGGTGG - Intergenic
1166660664 19:44644590-44644612 CAGGCTGGGTCTGGACGGAGGGG + Intronic
1166665186 19:44675497-44675519 CAGATTGGGTCTGGGCTCGGTGG + Intronic
1166679002 19:44756343-44756365 GAGGCTCGGTCTGAGGGAGGAGG + Intronic
1166827134 19:45616606-45616628 GGGGCTGAGTCTGGGCGAGGAGG - Intronic
1167314642 19:48756486-48756508 GAGCCTGGGTCTGAGGGAGGAGG + Intronic
1167334735 19:48877828-48877850 CAGGCCGGGTCTGGGTGCGGTGG - Intergenic
1167378406 19:49124776-49124798 CATGTTGGGGCTGGGCGCGGTGG + Intronic
1167441702 19:49512906-49512928 GACGCTGGGTCTGAGGGAGGAGG + Intronic
1167502868 19:49857329-49857351 GAGGGTGGGTCTTGGCGCGGCGG + Intronic
1167564418 19:50247349-50247371 CAGGATGTGTCTGGGAGTGGTGG + Intronic
1167617255 19:50542244-50542266 CAGGCTGGGCCCAGCCGAGGTGG + Intronic
1167708963 19:51098666-51098688 CCGCCGGGGTCTGGACGAGGAGG - Exonic
1167946615 19:52993578-52993600 TGGGCGGGGCCTGGGCGAGGTGG + Intergenic
1168111541 19:54194581-54194603 CATGGTGAGTCTGGGCGTGGTGG + Intergenic
1168149223 19:54435956-54435978 CCGCCTGGGTCTGAGGGAGGAGG + Intronic
1168685218 19:58345374-58345396 TAAGCTGGGGCTGGGCGTGGTGG + Intronic
925025928 2:607265-607287 CCGTCTGGATCTGGGTGAGGTGG + Intergenic
925849654 2:8068164-8068186 CAGGCAGGGAGTGGGAGAGGAGG - Intergenic
926008274 2:9389464-9389486 CAGGCTGGGTCGGTGCGTGAGGG + Intronic
926155001 2:10448610-10448632 CAGGGCGGGGCGGGGCGAGGCGG - Intergenic
926157233 2:10463238-10463260 TAGGCTGGGGCTGGGCGCAGTGG + Intergenic
926332345 2:11835984-11836006 CAGGAGGGGTGTGGGGGAGGGGG - Intergenic
926772951 2:16394242-16394264 CAGGCAGGGGCTGGTCCAGGAGG - Intergenic
927090308 2:19705577-19705599 AAGGCAGGGTCTGGGTGAGGAGG - Intergenic
927604841 2:24477535-24477557 CAGGCTGGATCTGGGAGCTGAGG - Intergenic
927617083 2:24609471-24609493 CAGGCTGGGTGTGGTGGAGCAGG + Intronic
927881594 2:26693226-26693248 CCGGCTGGGGCTGGGGGCGGGGG + Intronic
928014855 2:27646327-27646349 CAAGCTGGGGCTGGGCATGGTGG - Intronic
928166596 2:28976904-28976926 CAGGCTGGGGCTGGCCTTGGAGG + Intronic
929542979 2:42836566-42836588 CAGGAAGAGTCTGGGCGTGGTGG + Intergenic
930044584 2:47158085-47158107 GAAGGTGGGGCTGGGCGAGGTGG + Intronic
930075142 2:47400438-47400460 CAGGCTGAGGCTGGGCGGGGTGG + Intergenic
930347448 2:50202217-50202239 TAAGCTGGGGCTGGGCGCGGTGG + Intronic
931290719 2:60870737-60870759 CAGGCTTGGGCTGGGCGTGGTGG - Intergenic
931309353 2:61064110-61064132 CTGGCTGGGGCTGGGTGTGGTGG + Intergenic
931542190 2:63341414-63341436 AAGTCTGGGGCTGGGCGTGGTGG - Intronic
931732687 2:65167133-65167155 TAGGCTGGGGCTGGGTGTGGTGG - Intergenic
931763588 2:65436160-65436182 CAGGCTGGGCCGCGGCGGGGCGG - Intergenic
931819983 2:65942019-65942041 CAGGCTGTTGCTGGGGGAGGAGG + Intergenic
932716213 2:74101972-74101994 CCGGCTGGGCCTGGGCCAGCAGG + Exonic
934562596 2:95320888-95320910 GAGGCTGGGTGGGGCCGAGGGGG - Intronic
934576180 2:95402884-95402906 CTGGCTGGGTCTAGGCCAGAAGG + Intronic
935229027 2:101079971-101079993 CTGGTTGGGGCTGGGCGCGGTGG - Intronic
935291482 2:101614228-101614250 GAGGCTGAGTCAGGGCGAGGTGG + Intergenic
935589796 2:104835824-104835846 TAGGCAGGGTGTGGGGGAGGTGG + Intergenic
935911062 2:107896525-107896547 CAGGCATGGGCTGGGCGCGGTGG - Intergenic
936029412 2:109059286-109059308 CAGCATGGGGCTGGGCAAGGTGG + Intergenic
936381598 2:111991511-111991533 CAGCATTGGGCTGGGCGAGGTGG - Intronic
937045692 2:118850279-118850301 CAGGCCGGGCCTCGGGGAGGTGG - Intergenic
937184935 2:120031154-120031176 GAGGCTGGGGCTGGGCGTGGTGG - Intronic
938089699 2:128423372-128423394 CATGCAGGGGCTGGGCGTGGTGG + Intergenic
938892017 2:135715239-135715261 CAGGCTGGGACTGAGGCAGGAGG + Intronic
940252388 2:151693415-151693437 GAGGCTGGGGGTGGGGGAGGCGG - Intronic
940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG + Intergenic
941266664 2:163371468-163371490 GAGGCTGGGGCCGGGCGCGGTGG + Intergenic
941793062 2:169573921-169573943 CAGGGTGGGTCGCGGCGAGGTGG + Intronic
942857009 2:180561363-180561385 TATGCTGGGTCTGGGCATGGTGG + Intergenic
943783146 2:191846812-191846834 CAGGCTGGGGCTTGGTGTGGAGG + Exonic
944821748 2:203439713-203439735 AAGGCTGGATTTGGGAGAGGTGG + Exonic
944843978 2:203650663-203650685 CACACTGGGGCTGGGCGCGGTGG - Intergenic
945080768 2:206085250-206085272 CAGGCCGGGGCGGGGCGGGGCGG - Intronic
946158494 2:217822080-217822102 CAGGGTGGGTCTGGGCAGGCAGG - Intronic
946282035 2:218672517-218672539 CAGGCTGGGTGAGGGAGAAGGGG + Intronic
947549031 2:231033354-231033376 CAGCCTGGGCCTGGCAGAGGAGG + Intergenic
947564658 2:231186121-231186143 CAGGCTAGGGCTGGGCAGGGAGG - Intergenic
947615185 2:231551568-231551590 CAAGTTGGGGCTGGGCGTGGTGG + Intergenic
947734320 2:232446811-232446833 CAGGAAGGGTCTGGGTGAGCTGG - Intergenic
947820778 2:233067996-233068018 CATGCTGGTGCTGGGCAAGGTGG + Intronic
948178487 2:235961988-235962010 CAGGCTGGGGCAGGGCGGGGTGG + Intronic
948213352 2:236211182-236211204 CAGGCTGGGGCTGGGCCTGTTGG - Intronic
948253398 2:236549257-236549279 CAGGCTGGGGCTGGCAAAGGTGG - Intergenic
948561944 2:238860137-238860159 CAGGCTGGTTCTGGGCTCAGAGG + Intronic
948569867 2:238911140-238911162 CAGCCTGGGTCTGGTGCAGGCGG + Intergenic
948686400 2:239672666-239672688 CACGCATGGGCTGGGCGAGGCGG - Intergenic
948740750 2:240044273-240044295 GAGGCTGGGTATGGGCTGGGTGG - Intergenic
948778919 2:240305051-240305073 CAGGCTGGGAGCTGGCGAGGAGG - Intergenic
948789512 2:240370082-240370104 CCAGCTGTGTCTGGGGGAGGAGG + Intergenic
1168796250 20:611803-611825 CAGGCTGGGCTTTGGGGAGGAGG + Intergenic
1168838821 20:895546-895568 CAGGCAGGGGCTGGGGGAGAGGG + Intronic
1169063135 20:2675922-2675944 CAGGCATGGGCTGGGCGTGGTGG + Intergenic
1169083817 20:2815032-2815054 CTGGGTGGGTATGGGGGAGGGGG + Exonic
1169351611 20:4872592-4872614 CAGTCAGGGTGAGGGCGAGGCGG - Intronic
1169832381 20:9838872-9838894 CTGGCTGGGTAGGGGCAAGGGGG + Exonic
1170460499 20:16573145-16573167 CAGGCTGGCTTTGGGGGAGCTGG + Intronic
1171021539 20:21588605-21588627 TAGGATTGGGCTGGGCGAGGTGG + Intergenic
1171865210 20:30484317-30484339 CAGGGTGTGGGTGGGCGAGGAGG + Intergenic
1171992899 20:31709971-31709993 CAGGCTGTGGCTGGGCGTGGTGG - Intronic
1172099276 20:32475586-32475608 AAGGCTGGGCCTGGAGGAGGTGG - Intronic
1172155414 20:32820345-32820367 CTGGGAGGGTGTGGGCGAGGTGG + Intronic
1172612104 20:36260052-36260074 CAGGCTGGGGGTGGGTGGGGTGG - Intronic
1172656475 20:36541472-36541494 CAGGCGGGGGCGGGGCGTGGCGG - Exonic
1173047721 20:39528527-39528549 GAGGCTGGGAGTGGGTGAGGTGG + Intergenic
1173322343 20:41999200-41999222 GAGGCGGCGGCTGGGCGAGGCGG + Intergenic
1173349551 20:42232625-42232647 CAGTCTGGGAGTGGGGGAGGAGG - Intronic
1173794268 20:45848059-45848081 AAGGCTGGGGCTGGGTGTGGGGG - Intronic
1174015170 20:47482046-47482068 CAGGCAGGGTCTGGGCATGCAGG - Intergenic
1174475942 20:50795454-50795476 CAGGCCGGCCCTGGGAGAGGCGG + Intronic
1175771601 20:61627813-61627835 CAGGGTGGTTCTGTGAGAGGCGG + Intronic
1175802213 20:61807290-61807312 AAGGCTGGGTCTGGCCCTGGTGG - Intronic
1175854199 20:62111476-62111498 CCGGCTGAGGCTGGGCGCGGTGG + Intergenic
1176020109 20:62958503-62958525 CAGGCTGGGTTGGGGCCAGCAGG - Intronic
1176034878 20:63031375-63031397 GAGCCTGGGGCTGGGGGAGGAGG + Intergenic
1176141126 20:63545542-63545564 CAGACTGGGACTGGGCAAGACGG + Intronic
1176211989 20:63929098-63929120 GAGGCTGGGTCAGGGTGAGGAGG + Intronic
1176223173 20:63979550-63979572 CCGGCTGGGGCGGGGCGGGGCGG - Exonic
1176877464 21:14147062-14147084 AAGGCTGGGGCTGGGCATGGTGG - Intronic
1178308250 21:31508675-31508697 CAAGATGAGTCTGGGCGCGGTGG - Intronic
1179144614 21:38756692-38756714 CAGACAGGGGCTGGGCGCGGTGG - Intergenic
1179154196 21:38835740-38835762 AGGGCTGGGGCTGGGGGAGGCGG - Intergenic
1179557583 21:42190299-42190321 CAGGGTGGTTCTTGGCCAGGGGG - Intergenic
1179622737 21:42628147-42628169 CAGGCTGGGGCTGAGACAGGTGG + Intergenic
1180014383 21:45073248-45073270 GAGGCTGGGGCTGGGCGGTGGGG - Intergenic
1180049423 21:45324514-45324536 GAAGCTGGGTCTGGGCGCTGTGG + Intergenic
1180069314 21:45428168-45428190 CAGGCGGCGTCTGGGCCTGGGGG + Intronic
1180084844 21:45503974-45503996 CAGGCGGGGTCTCGCTGAGGTGG - Intronic
1180110169 21:45643792-45643814 CGGGCGGGGTCGGGGCGAGGCGG - Exonic
1180681069 22:17627414-17627436 CAGGCTGGGGCCGGGCATGGTGG - Intronic
1180712641 22:17849976-17849998 CATCCTGGGACTGGGCGCGGTGG - Intronic
1180752477 22:18134093-18134115 CGGGCTGGGGCTGGGCATGGTGG + Intronic
1181162683 22:20967325-20967347 CAGGGTGGGGCTGGGCTAGGGGG + Intronic
1181629362 22:24142519-24142541 CAGGCTGGGGCTGGTCAGGGAGG - Intronic
1181953114 22:26569148-26569170 CAGGGTGAGGCTGGGCGCGGTGG - Intronic
1182051038 22:27313082-27313104 CAGACTGGGTCTGGGTGTGGGGG + Intergenic
1182306322 22:29371442-29371464 CAGGCAGCGGCTGGGCGCGGTGG + Intronic
1182593101 22:31397445-31397467 CAGGCTGGGGCTGGGCACAGTGG - Intergenic
1183272155 22:36868886-36868908 CAGCCTGGGTCAGGGCGGAGTGG - Intronic
1183521765 22:38299793-38299815 CACGCTGGGGCTAGGCGCGGTGG - Intronic
1184010152 22:41741686-41741708 CAGGCTGATGCTGGGCGTGGTGG + Intronic
1184019803 22:41813423-41813445 CAGGCTGAGGATGGGCGAGTGGG - Exonic
1184109961 22:42388809-42388831 CAGGCTGGGTCTGGGGAGAGGGG + Intronic
1184148441 22:42624789-42624811 CAGGCTGGGCAAGGGCGGGGTGG + Intronic
1184265782 22:43345125-43345147 CTGGCTAGGGCTGGGCGGGGGGG - Intergenic
1184339652 22:43879279-43879301 CAGGCAGGGGCTGGGTCAGGAGG - Intergenic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184614490 22:45628904-45628926 CAAGCTGGGGCTGGGCGCGCTGG + Intergenic
1184707060 22:46221786-46221808 CCAGCTGTGTCTGGGCGCGGTGG + Intronic
1184731926 22:46375297-46375319 GAGGCAGGGTCTGGGTGAGATGG - Intronic
1184760277 22:46539718-46539740 CAGGAGGGCTCTGGGGGAGGAGG + Intergenic
1184790434 22:46696480-46696502 GAGGCTGCGTCTGGGTGATGAGG - Intronic
1184797064 22:46738555-46738577 CAGGCGGGGTCCGGGCGGCGTGG + Intergenic
1185003625 22:48262426-48262448 CAGCATGGGGCTGGGAGAGGTGG + Intergenic
1185253223 22:49816609-49816631 AAGGCTGGGGCTGGGCGAGGTGG + Intronic
1185284149 22:49992902-49992924 TAGGGTGGGTCTGGGCACGGTGG - Intergenic
1185393127 22:50573274-50573296 CAGGCTGGGCCTGGAGGTGGGGG + Intronic
949287282 3:2421537-2421559 AAGGCTGGGGCTGGGAGCGGTGG - Intronic
949414197 3:3799177-3799199 CAGGCTGCGGCTGGGCAGGGAGG - Intronic
949944303 3:9177978-9178000 AAGCCTGGGGCTGGGCGTGGTGG + Intronic
949959756 3:9302317-9302339 CAGGCTGGGGAGGGGTGAGGGGG - Intronic
949994071 3:9602532-9602554 GAGGCTGGGGGTGGGCGTGGAGG - Intergenic
950393853 3:12718574-12718596 CAGCCTGGGGCCGGGCGCGGTGG - Intergenic
950519040 3:13485376-13485398 CAGCCTAGGGCTGGGCCAGGAGG + Intronic
951803478 3:26622761-26622783 CAGGCTGGGAATGAGGGAGGAGG - Intergenic
952363197 3:32651577-32651599 CAGCCTGGGGCCGGGCGCGGTGG + Intergenic
952744441 3:36764202-36764224 CAGGCTGGGGCTGGCCGGGCCGG + Intergenic
953771280 3:45780146-45780168 CACGCTGGGCCTGGCGGAGGGGG - Intronic
953797040 3:45993911-45993933 CAGGGTGGGTGGGGGTGAGGGGG + Intronic
954315535 3:49799328-49799350 CAGGGTGGGTGTGGGCGTGTAGG + Exonic
954365289 3:50142828-50142850 GAGGCTGGGGCTGGGCGTGGTGG - Intergenic
954378892 3:50209180-50209202 CAGGCTGGCAATGGGTGAGGTGG + Intronic
954501864 3:51025188-51025210 CAGGTTGGGTCAGGGTTAGGTGG + Intronic
954861445 3:53694254-53694276 CTGGCTGGGTCTGGGGCAAGGGG + Intronic
954863565 3:53710257-53710279 CAGGAGGGGTCTGGGGCAGGCGG + Intronic
954871305 3:53769410-53769432 CAGACTGAGTCAGGGCGAGGAGG - Intronic
955191737 3:56768033-56768055 GAGGCTGGGGCTGGGCATGGTGG - Intronic
955265948 3:57444878-57444900 CAGGCCGGGGCTGGGAGGGGAGG - Intronic
955279369 3:57579573-57579595 TAGGATGGGGCTGGGCGCGGTGG - Intronic
958785723 3:98594185-98594207 CAGGCTGGGGCCGGGCGCGGTGG + Intergenic
960137604 3:114121705-114121727 CGGGCTGTGGCTGGGCGCGGTGG + Intergenic
960637376 3:119796713-119796735 CATGCTGAGGCTGGGCCAGGGGG - Intronic
961028829 3:123584848-123584870 GAGGCTGGGGCTCGGGGAGGCGG - Intronic
961300539 3:125919385-125919407 CAGGCTGTGGCTGGGCCTGGTGG - Intergenic
961466109 3:127082667-127082689 CAAGCTGGGGCCGGGCGTGGTGG - Intergenic
961734936 3:128995407-128995429 CAGGTGGGGTGTGGGCAAGGTGG - Intronic
961769923 3:129241559-129241581 CAGGCTGGGGCCGGGCACGGTGG - Intergenic
961901302 3:130214545-130214567 TGGGCTGGGTCTGGTCAAGGTGG + Intergenic
963038072 3:141049622-141049644 CAGGCTGGGTGTGTGTGTGGAGG - Intergenic
963247860 3:143079255-143079277 CAGGCTGGGCCTGGGTGCAGAGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
965443510 3:168745980-168746002 GAGGTTGGGGCTGGGCGTGGTGG - Intergenic
966473940 3:180322897-180322919 CAGGCGGAGGCTGGGCGGGGTGG + Intergenic
966814398 3:183878076-183878098 CTGGCTGGGGCTGGGCGCGGTGG - Intronic
966835390 3:184045718-184045740 AAGGCTGGGGCTGAGCGTGGTGG + Intergenic
966872335 3:184299156-184299178 CAGGCGGGCTCTGGAGGAGGAGG + Exonic
966960627 3:184934456-184934478 AAGGATGGGGCTGGGCGTGGTGG - Intronic
967008958 3:185413532-185413554 CAGAATGGGGCTGGGCGCGGTGG + Intronic
967055592 3:185825992-185826014 CACGCGGGGTCTGGGCGGAGAGG - Intergenic
967182930 3:186922217-186922239 CCGGCGGGGGCTGGGGGAGGGGG + Intergenic
967982965 3:195076663-195076685 CTGGCTCTGTCTGGGCTAGGAGG + Intronic
968084199 3:195867329-195867351 CAGCCTGGCTGTGGGCGAAGCGG - Intronic
968084618 3:195868746-195868768 CAGGCAGGGTCTGGGACACGAGG + Intronic
968319377 3:197751351-197751373 AAAGCTGGGGCTGGGCGCGGTGG + Intronic
968578995 4:1380985-1381007 CCGGGTAGGTCTGGGCAAGGCGG + Exonic
968595246 4:1478985-1479007 CTGGCTGTGTAGGGGCGAGGAGG + Intergenic
968838468 4:2982264-2982286 CAGGCAGGGCCTGGATGAGGTGG - Intronic
968966046 4:3769576-3769598 CAGGCAGGGTCTGGCAGGGGAGG - Intergenic
968997109 4:3952635-3952657 CAGGCTGCGGCTGGGCCGGGTGG + Intergenic
969506672 4:7592273-7592295 CAGGCTGGATCTGGGCACGCTGG + Intronic
969518542 4:7662228-7662250 CAGGGTGGGGGTGGGGGAGGGGG - Intronic
969725449 4:8915655-8915677 CAGCCTGGGGCTGGCAGAGGAGG + Intergenic
969816864 4:9693618-9693640 CAGGCTGTGGCTGGGCCGGGTGG - Intergenic
970850006 4:20590190-20590212 AAGTCTGGGGCTGGGCGCGGTGG - Intronic
972209155 4:36815762-36815784 CAGGATGGGTCTCTGAGAGGAGG - Intergenic
972334967 4:38099684-38099706 CAGGCAGGGTCTGGGAGGGCAGG - Intronic
972406999 4:38756383-38756405 CAGGTTGGGGCTGGGCGCGGTGG - Intergenic
972680665 4:41303948-41303970 CAGACTGGGTTTGAGTGAGGTGG - Intergenic
975281659 4:72569034-72569056 CAGGCTAAGCCTGGGAGAGGGGG + Intergenic
975642402 4:76513260-76513282 CAGGCTGAGTGTGGGAGAAGGGG + Intronic
976236491 4:82902348-82902370 AAGGCTGGGGCTGGGCAGGGTGG - Intronic
976377243 4:84359581-84359603 CAGGAATGGTCTGGGCGTGGTGG - Intergenic
976912861 4:90328789-90328811 CAGGCTGGCTCTGGTCCAAGAGG + Intronic
976947251 4:90785314-90785336 CAGGTTTGGGCTGGGCGTGGTGG - Intronic
976959913 4:90957385-90957407 CAGGCTGGGGCTAGGCACGGTGG - Intronic
979240898 4:118446167-118446189 CAGGCTGGGTGGGGGCGGGTAGG - Intergenic
979349464 4:119628065-119628087 CAGCCAGGGCCAGGGCGAGGGGG + Intronic
979655257 4:123184821-123184843 CATGCTGGGGCCGGGCGCGGTGG - Intronic
980442429 4:132866792-132866814 CAGGCTGTGTCTGCCCGAAGAGG + Intergenic
982121816 4:152150371-152150393 GAGGCTGGGGTTGGGAGAGGTGG - Intergenic
982201794 4:152968615-152968637 CAGGCTTGGGCTGGGCGCGGTGG - Intronic
982552254 4:156817769-156817791 TAGGCTAGGGCTGGGCGTGGTGG + Intronic
985054170 4:186021649-186021671 CAGGCTGGGCCTGGGCCATACGG - Intergenic
985516026 5:345008-345030 GAGGCTGTGTGTGTGCGAGGGGG + Intronic
985584584 5:723652-723674 CAGGCGGGGTCTGGGGGTGCAGG + Intronic
985598091 5:807982-808004 CAGGCGGGGTCTGGGGGTGCAGG + Intronic
985936839 5:3103732-3103754 AGGGCTGGGGCTGGGGGAGGTGG - Intergenic
986316370 5:6591196-6591218 GAGGATGGGGCTGGGCAAGGGGG + Intergenic
986397546 5:7345170-7345192 CAAGCTGAGTCCGGGCGCGGTGG - Intergenic
986598312 5:9445956-9445978 CAGGCTGGATCTGGGCATGAAGG - Intronic
986723914 5:10580496-10580518 CAGGGTGGGGCTGGGGGTGGGGG - Intronic
988337631 5:29927093-29927115 CAGGCTGGGGCTGGGTGTGGTGG + Intergenic
988998211 5:36734672-36734694 CAGAATGGGTATGGGCGAGATGG - Intergenic
989106913 5:37871509-37871531 CAGGCTGGGTTTGGGGGCTGGGG + Intergenic
989586540 5:43078313-43078335 CAGGCTGGGGCTGGGCGCCGTGG + Intronic
990307994 5:54511548-54511570 CAGGCCAGGGCTGGGCGTGGTGG - Intergenic
990942792 5:61220258-61220280 AAGTCTGGGTATGGGCTAGGTGG + Intergenic
991217965 5:64177916-64177938 CTGCCTGGGGCTGGGCGTGGTGG + Intronic
991721349 5:69496691-69496713 CAGGCTGAGGCTGGGCAAGGTGG - Intronic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
993902486 5:93593948-93593970 CAGGCTGGGTGGGAGGGAGGAGG + Exonic
994573607 5:101546426-101546448 TAGGCTGGGTATGGGCATGGTGG - Intergenic
996046951 5:118884717-118884739 CAGGTTGGGGCTGGGCGTGGTGG + Intronic
997207577 5:132059148-132059170 CAGCCTGGGGCTGAGCCAGGAGG + Intergenic
997210436 5:132073882-132073904 CGTGCTGGGGCTGGGCGAGCGGG - Exonic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
997630308 5:135363080-135363102 AAGACTGGGTCTGGGAGTGGTGG + Intronic
998072118 5:139206099-139206121 CAGGTTGGGCAAGGGCGAGGGGG - Intronic
998621019 5:143794247-143794269 CAGGCTTGGCCTGGGGGAGTTGG + Intergenic
999088073 5:148910969-148910991 AAGGCTGGGCCTGGGTGAGGAGG - Intergenic
999673210 5:153975318-153975340 CTAGCTGGGTCTGGGGAAGGGGG - Intergenic
999744294 5:154579912-154579934 CTTCCTGGGGCTGGGCGAGGTGG - Intergenic
999755718 5:154663030-154663052 CAGTCTGGGGCTGGGGGCGGTGG - Intergenic
1000062119 5:157667115-157667137 CAGGCTGGGTTAGGGAGATGTGG + Intronic
1001276989 5:170358337-170358359 CAGCCTGGGCCTGGGCGGGAGGG - Intronic
1001317181 5:170652070-170652092 CTGGCTGGCTGTGGGGGAGGGGG + Intronic
1001419197 5:171573953-171573975 CAGCCTGGGTCTGTGTGGGGTGG + Intergenic
1001497793 5:172202051-172202073 CAGGCTGGGGTTGGGCGCGGTGG + Intronic
1001677193 5:173528518-173528540 CAGGCTGGGAGTGGGCTGGGAGG - Intergenic
1001781100 5:174369890-174369912 CATGCTGGGTCTGGAGTAGGTGG - Intergenic
1001809789 5:174618872-174618894 CAGGCTGGGCCTGGGCAGGGTGG + Intergenic
1002335887 5:178478066-178478088 GAGGCTGGGCCTGGGTGGGGCGG + Intronic
1002497064 5:179622950-179622972 CGGGCTGGGGCGGGGCGGGGCGG - Intronic
1002566987 5:180117704-180117726 CAGGCTGTGGCTGGGCGCAGTGG + Intronic
1004105536 6:12664264-12664286 CATGCTGGGGCCGGGCGCGGTGG - Intergenic
1004385647 6:15170434-15170456 CATCCTGGGACTGGGGGAGGTGG + Intergenic
1004396156 6:15248244-15248266 CAGGCTGGGCCGGGGCTGGGCGG + Intronic
1004493565 6:16141709-16141731 CAAACTTGGTCTGGGCCAGGAGG - Exonic
1005893661 6:30160570-30160592 CACACTGGGTTTGGGAGAGGAGG - Exonic
1006285725 6:33092494-33092516 GAGGATGGGCCTGGGAGAGGTGG - Intergenic
1006506847 6:34494722-34494744 CAGGCTGTGGCTGGGCTTGGTGG - Intronic
1006607608 6:35269786-35269808 AAGGGTGGGTCTGGACGAAGTGG - Intronic
1006782710 6:36643050-36643072 CTGGCTGGGGCTAGGCCAGGGGG + Intergenic
1006782988 6:36644694-36644716 CAGTTTGGGACTGGGCGCGGTGG - Intergenic
1007474098 6:42107469-42107491 GGGGCTGGGCCTGGGGGAGGTGG + Exonic
1010935031 6:81850676-81850698 CAGGAAGGGGCTGGGCGCGGTGG + Intergenic
1011464284 6:87639571-87639593 CAGGCTGGGTCAGGCCTGGGAGG - Intronic
1013216810 6:108034903-108034925 CCAGCTGGGGCTGGGCGCGGTGG - Intergenic
1013424984 6:110003516-110003538 GAGCCTGGGTCTGGGCACGGTGG + Intergenic
1014278601 6:119416576-119416598 CAGGTGGGGTCAGGGCCAGGTGG + Intergenic
1014622603 6:123687741-123687763 GAGGCTGGTTCAGGGCTAGGGGG + Intergenic
1015174830 6:130295692-130295714 CCACCTGGGTCTGGGAGAGGGGG - Intronic
1016465120 6:144317682-144317704 CAGATTGGGGCTGGGCGCGGTGG - Intronic
1016936264 6:149451167-149451189 CAGGCGGGGACCGGGAGAGGCGG + Exonic
1017722202 6:157251529-157251551 CAGGGTGGGCCTGGGCGCGGTGG - Intergenic
1017874964 6:158516739-158516761 CAGGCTCGGGCCGGGCGTGGTGG - Intergenic
1018438328 6:163783396-163783418 ATACCTGGGTCTGGGCGAGGTGG + Intergenic
1019432534 7:1005867-1005889 CTGCCTGGGTCTGCTCGAGGCGG - Intronic
1019433901 7:1012105-1012127 GAGGCTGGGCCTGTGCCAGGAGG - Intronic
1019509084 7:1408175-1408197 CAGGCCGGGCCTGGGGGAGCTGG + Intergenic
1019515593 7:1438529-1438551 CAGGGTGGGGCTGGGCCTGGAGG - Intronic
1019703674 7:2487521-2487543 CAGGCTGGGGCTGGACGCCGTGG + Intergenic
1021969440 7:25951630-25951652 CCGGCTGGGTTTGGAGGAGGGGG - Intergenic
1022164783 7:27747673-27747695 CAGGCTGGGTCTGGGATCTGTGG + Intronic
1022525407 7:31033984-31034006 CAGGCTGGGGCTGGAGGTGGGGG - Intergenic
1023063327 7:36350773-36350795 CAGGCTGAGGCTGGGCATGGTGG - Intronic
1023869623 7:44256000-44256022 CAGGCTGGGGCTGGGGGCAGGGG + Intronic
1023875732 7:44285325-44285347 CAGGCTGGGGCTGGGAGAAAGGG + Intronic
1023907809 7:44534593-44534615 CACGCTGGGCCTCGGCGGGGTGG - Exonic
1024811384 7:53216866-53216888 CTGGCTGGGCTTGGGGGAGGGGG + Intergenic
1026045392 7:66902962-66902984 CAGGCAGGGGCTGGGCCTGGAGG - Intergenic
1026877549 7:73888100-73888122 CCGGCTGGGACTGGGCTTGGTGG + Intergenic
1026878497 7:73893588-73893610 CAGGCTGGGCCAGGGCCAGGTGG - Intergenic
1027134944 7:75617502-75617524 CAGGCTGAGGCTGGGCGCGGTGG - Intronic
1027202407 7:76072242-76072264 CAGGCTGGGGCTGGGCATGGAGG + Intergenic
1029113092 7:98223347-98223369 CTGGCTGGGGCTGGGGGTGGGGG - Intronic
1029451730 7:100645327-100645349 CAGGTTGGTTCTGGGGCAGGAGG - Intronic
1029694015 7:102201537-102201559 CACGGTGGGCATGGGCGAGGTGG - Exonic
1029701534 7:102249289-102249311 CGGGCTGGGTCTGGGCCGCGGGG - Exonic
1030470191 7:109953754-109953776 GAGGCAGGGGCGGGGCGAGGGGG - Intergenic
1031202365 7:118704087-118704109 CAGTCTGGGGCCGGGCGCGGTGG - Intergenic
1032008022 7:128319928-128319950 CAAGCATGGGCTGGGCGAGGTGG + Intronic
1032341268 7:131075535-131075557 CAGCCTGGGTCTAGGAGTGGAGG - Intergenic
1032942550 7:136811244-136811266 CTGCCTGGGACTGGGAGAGGTGG - Intergenic
1033126335 7:138710474-138710496 GAGGCTGTGGCTGGGCGCGGTGG - Intronic
1033282230 7:140014407-140014429 CAGGCTGGGGCTGAGGTAGGAGG + Intronic
1034278105 7:149832915-149832937 CAGGGTGGGTCTGGGCAGGGAGG + Intergenic
1034446741 7:151117517-151117539 CTGGTTGGGACTGGGAGAGGTGG + Intronic
1035259316 7:157651594-157651616 CTGGCTGGCTCTGAGTGAGGAGG - Intronic
1036210377 8:6835684-6835706 CAGGGTGGGTGGGGACGAGGTGG + Intergenic
1036493851 8:9251807-9251829 CAGGCTGGGGCTGGGCACGGTGG + Intergenic
1036604987 8:10296791-10296813 TTGGCGGGGTCTGGGAGAGGAGG - Intronic
1036849422 8:12191301-12191323 CAGCCTGTGGCTGGGCCAGGTGG + Intronic
1036870784 8:12433574-12433596 CAGCCTGTGGCTGGGCCAGGTGG + Intronic
1036950311 8:13133491-13133513 GAGGCGGGGCCTGGGCGGGGCGG - Intronic
1037432508 8:18828671-18828693 TTAGCTGGGGCTGGGCGAGGTGG + Intronic
1037751578 8:21685819-21685841 CTGGCAGGGGCTGGGCGTGGTGG - Intergenic
1037770283 8:21794883-21794905 CTGGGTGGGACTGGGCTAGGAGG + Intronic
1037807409 8:22066415-22066437 CAGGCCGGGCCGGGGCGGGGAGG + Intronic
1038288888 8:26230867-26230889 CAGCCTGGGGCAGGGAGAGGGGG - Intergenic
1038306895 8:26413188-26413210 AAGGCTGTGTGTAGGCGAGGAGG - Intronic
1038491504 8:27975269-27975291 CAGGGTGGGTCTGGGAGGAGGGG - Intronic
1038539598 8:28381326-28381348 CTAGCTGGGGCTGGGCGCGGTGG - Intronic
1038571526 8:28666860-28666882 GTGGCTGGGGCTGGGCGTGGTGG - Intronic
1038719996 8:30027250-30027272 GAGGCCGGGGCCGGGCGAGGAGG - Intergenic
1040013619 8:42682517-42682539 GAGGCTGAGGCTGGGCGCGGTGG + Intergenic
1040572754 8:48624784-48624806 CAGGCTGGGTGTGTGGGAGTGGG - Intergenic
1041093304 8:54325056-54325078 AGGGCTGGGGCTGGGCGTGGTGG + Intergenic
1041891156 8:62870055-62870077 GGGGCTGGGGCTGGGCGCGGTGG - Intronic
1042847580 8:73184212-73184234 CTGGCTGGGGCTGGGTGCGGGGG - Intergenic
1043961072 8:86419130-86419152 CAGACTAGGGCTGGGCGCGGTGG + Intronic
1044673794 8:94709884-94709906 GAGTCTGGGGCTGGGCAAGGTGG - Intergenic
1044728111 8:95209223-95209245 CAGCCTGGGTCTGGGCCAACAGG - Intergenic
1044827844 8:96215269-96215291 CAGACTGGGTCTGGGGTTGGGGG - Intergenic
1045411073 8:101919967-101919989 CAGTTTGGGGCTGGGCGTGGTGG + Intronic
1045468818 8:102492879-102492901 CAGCCTAGGGCTGGGCGCGGTGG - Intergenic
1045571236 8:103371319-103371341 CCTGCAGGGTCTGGGCGGGGTGG - Intergenic
1046670506 8:117051524-117051546 GAGCCTGGGGCTGGGCGTGGTGG + Intronic
1047101935 8:121686314-121686336 CACTCTGGGGCTGGGCGCGGCGG - Intergenic
1047740613 8:127803414-127803436 CCGCCTGGGGCTGGGCGCGGCGG - Intergenic
1047770434 8:128026228-128026250 AAGGCTGGGACTGGGTGCGGTGG - Intergenic
1047796693 8:128264307-128264329 CAGGCAGGGTTTGGGAGTGGAGG - Intergenic
1048469633 8:134695513-134695535 CAGGCAGGGCCTGGGGGTGGGGG - Intronic
1049455350 8:142683702-142683724 TGGGCTGGGTGTAGGCGAGGCGG - Intergenic
1049475981 8:142797196-142797218 TAGGCTGGGCATGGGAGAGGGGG + Intergenic
1049559183 8:143299678-143299700 CAGGCTGGGCCTGAGCGCTGTGG + Intergenic
1049570320 8:143367293-143367315 CAGCCTGGGCCTGGGCAATGTGG + Intergenic
1049576910 8:143393788-143393810 CTGGCTGGGCCTGGGGGTGGGGG - Intergenic
1049799587 8:144511631-144511653 CAGGCTGGGGCTGGGGGCTGGGG - Intronic
1049805058 8:144534939-144534961 CAGGCTGGGTCTGGAAGGCGCGG + Intronic
1049918366 9:340332-340354 CAGGCTCGGGCTGGGCGTGGTGG + Intronic
1050260162 9:3833102-3833124 TAGTCTGGATCTGAGCGAGGAGG + Intronic
1050455850 9:5833169-5833191 GAAGCTGGGTCTTGGCGCGGCGG - Intergenic
1050548865 9:6732078-6732100 GAGGCTGGGGCTGGGTGTGGTGG + Intronic
1050640070 9:7658078-7658100 CTGGCTGGGTTCGGGCGCGGCGG + Intergenic
1051027538 9:12630965-12630987 CAGGCCTGCTCTGGGGGAGGGGG + Intergenic
1051039179 9:12785312-12785334 CTGTCTGGGGCTGGGGGAGGGGG + Intronic
1051068095 9:13129173-13129195 CAGGATGAGGCTGGGCGTGGTGG + Intronic
1052093923 9:24362063-24362085 CTGCCTGGGTTTGGGGGAGGGGG - Intergenic
1053097170 9:35338769-35338791 CAGGCTGGGTCAGGACCAGCAGG - Intronic
1053170093 9:35872137-35872159 GAGGCTGGGTATGGGAGAGTGGG - Intergenic
1053170104 9:35872170-35872192 GAGGCTGGGTATGGGAGAGTGGG - Intergenic
1055327502 9:75146330-75146352 CAGGCTGTCACTGGGAGAGGAGG + Intronic
1055462248 9:76529990-76530012 CTGACTGGGGCTGGGCGCGGTGG + Intergenic
1056327573 9:85492695-85492717 AAGGCTGGGGCTGGGCATGGTGG + Intergenic
1057053240 9:91941749-91941771 CAGGGCGGGGCTGGGCGGGGTGG - Intronic
1057132065 9:92661237-92661259 CAGGCTGAGGCTGGGCCAGCAGG - Intronic
1057201641 9:93143572-93143594 CAGGTAGGGGCTGGGCGCGGTGG + Intergenic
1057316104 9:93969378-93969400 TGGGCTGGGGCTGGGGGAGGAGG + Intergenic
1057763124 9:97892173-97892195 CAGGCTGTATCTGTGCCAGGTGG - Intergenic
1058412322 9:104747666-104747688 CAGGCTGGGGCGGGGCTCGGCGG - Exonic
1059248529 9:112867757-112867779 CAGGAGGGGTTTGGGGGAGGTGG - Intronic
1060528091 9:124331856-124331878 CAGGGTGGGGCTGGGGCAGGAGG - Intronic
1060801378 9:126547799-126547821 CAGGCTGGCTCTGGGTGGGGAGG - Intergenic
1060853678 9:126898155-126898177 CAGGCAGAGGCTGGGCGTGGTGG + Intergenic
1060934148 9:127506064-127506086 CAGGCTGGGGCCGGGAGAAGGGG + Exonic
1061003449 9:127915593-127915615 CAGGCTGGGTCTAGGCCAGATGG - Intronic
1061048348 9:128179618-128179640 CAGTCTTGGGCTGGGCGCGGTGG - Intronic
1061187996 9:129066220-129066242 CAGGCTGGGTCCGGGCCACCTGG - Intronic
1061313317 9:129778010-129778032 AAGGCTGAGGCTGGGCGAGGTGG + Intergenic
1061339028 9:129963900-129963922 AAGGCTGGGGCTGGGCATGGTGG - Intronic
1061371789 9:130201537-130201559 AGGGCTGGGCCTGGGGGAGGAGG + Intronic
1061395484 9:130341399-130341421 CAGGCTGTGGCTGGGAGAGCTGG - Intronic
1061626074 9:131841502-131841524 CAGGCATGGCCTGGGCGAGGCGG - Intergenic
1061721032 9:132551581-132551603 CAGGCTTGGGCCGGGCGTGGTGG - Intronic
1061864781 9:133486449-133486471 GAGGCTGGGGCTGGGCCAGGCGG + Intergenic
1062446043 9:136595388-136595410 CAGGGTGCGCCAGGGCGAGGGGG + Intergenic
1062446420 9:136597254-136597276 CAGGCTGGGCTGGGGCCAGGTGG - Intergenic
1062473789 9:136717918-136717940 CAGGCTGGGTGTGGAGGATGGGG + Intronic
1062524876 9:136974125-136974147 CAGGGTGGTGCTGGGAGAGGTGG + Intergenic
1062664699 9:137663078-137663100 CAGGCCAGGACTGGGCGCGGTGG - Intronic
1062695321 9:137872778-137872800 AAGCATGGGACTGGGCGAGGTGG + Intergenic
1186479367 X:9884202-9884224 AAGGCAGGGTCTGGGAGGGGAGG - Intronic
1186742029 X:12528660-12528682 CAGGCTGGGTCAGGCCATGGAGG - Intronic
1186791521 X:13004187-13004209 CAGCCTGCGGCTGGGCGTGGTGG - Intergenic
1187879850 X:23836598-23836620 TAGGCTGGGGCTGGGCGTGGTGG - Intronic
1189803567 X:44714124-44714146 CAGGCTGGCTCTTGGAGAGGGGG - Intergenic
1190287667 X:48971648-48971670 CAGGATGGGTTAGGGCGTGGGGG + Intergenic
1190597013 X:52060904-52060926 GAGGCTGGGGCTGGGTGAGGGGG + Intergenic
1190611811 X:52193169-52193191 GAGGCTGGGGCTGGGTGAGGGGG - Intergenic
1190623875 X:52317178-52317200 CATGCTGGGTGTGGACCAGGTGG + Intergenic
1190744077 X:53310785-53310807 AAGGCTGGGCCTGAGCTAGGGGG + Intronic
1192172534 X:68865751-68865773 CAGGCTGGGTGCGGGGCAGGAGG + Intergenic
1192536203 X:71930040-71930062 CAGCCAGAGTCTGGGCGTGGTGG - Intergenic
1194156337 X:90393869-90393891 CAGGTTTGGGCTGGGCGTGGTGG - Intergenic
1197147414 X:123185112-123185134 CAGGCTGGTGCTGGGGGAGGTGG + Intronic
1197240502 X:124118333-124118355 CAGGATGGGGCTGGGTGTGGTGG + Intronic
1197617254 X:128707794-128707816 CAGGCTGGGTCTGCAGCAGGGGG + Intergenic
1197769936 X:130083272-130083294 CAGGCAGGGTCTGGTGGGGGTGG - Intronic
1198652181 X:138874952-138874974 CAGCTTGTGACTGGGCGAGGTGG + Intronic
1199736778 X:150693273-150693295 CCAGGTGGGGCTGGGCGAGGTGG + Intronic
1200055166 X:153456433-153456455 CAGCCTGGGGCTGGGACAGGAGG + Intronic
1200092366 X:153642095-153642117 TAGGCTGGGCCTGGGCTAGGTGG - Intergenic
1200208603 X:154335233-154335255 CAGCCTGGGTCTGCGTGAGCAGG - Intergenic
1200502685 Y:3970858-3970880 CAGGCTTGGGCTGGGCGTGGTGG - Intergenic
1200647560 Y:5805103-5805125 GAGCCTAGGGCTGGGCGAGGTGG + Intergenic
1200978119 Y:9235327-9235349 CAGGCTGTCCCTGAGCGAGGCGG + Intergenic
1202388615 Y:24347988-24348010 CAGGCTGGGTGGGGGCGGGTAGG - Intergenic
1202482172 Y:25322140-25322162 CAGGCTGGGTGGGGGCGGGTAGG + Intergenic