ID: 920217152

View in Genome Browser
Species Human (GRCh38)
Location 1:204368976-204368998
Sequence CCTGCCACTCTGCAGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920217152_920217155 21 Left 920217152 1:204368976-204368998 CCTGGGTTCTGCAGAGTGGCAGG 0: 1
1: 0
2: 3
3: 28
4: 286
Right 920217155 1:204369020-204369042 TTATTCACCTGTATTTATCAAGG 0: 1
1: 0
2: 0
3: 39
4: 360
920217152_920217156 22 Left 920217152 1:204368976-204368998 CCTGGGTTCTGCAGAGTGGCAGG 0: 1
1: 0
2: 3
3: 28
4: 286
Right 920217156 1:204369021-204369043 TATTCACCTGTATTTATCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920217152 Original CRISPR CCTGCCACTCTGCAGAACCC AGG (reversed) Intronic