ID: 920217155 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:204369020-204369042 |
| Sequence | TTATTCACCTGTATTTATCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 400 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 39, 4: 360} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920217152_920217155 | 21 | Left | 920217152 | 1:204368976-204368998 | CCTGGGTTCTGCAGAGTGGCAGG | 0: 1 1: 0 2: 3 3: 28 4: 286 |
||
| Right | 920217155 | 1:204369020-204369042 | TTATTCACCTGTATTTATCAAGG | 0: 1 1: 0 2: 0 3: 39 4: 360 |
||||
| 920217154_920217155 | -3 | Left | 920217154 | 1:204369000-204369022 | CCAGTTTCTAATCATTCATTTTA | 0: 1 1: 0 2: 0 3: 37 4: 564 |
||
| Right | 920217155 | 1:204369020-204369042 | TTATTCACCTGTATTTATCAAGG | 0: 1 1: 0 2: 0 3: 39 4: 360 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920217155 | Original CRISPR | TTATTCACCTGTATTTATCA AGG | Intronic | ||