ID: 920217155

View in Genome Browser
Species Human (GRCh38)
Location 1:204369020-204369042
Sequence TTATTCACCTGTATTTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920217152_920217155 21 Left 920217152 1:204368976-204368998 CCTGGGTTCTGCAGAGTGGCAGG 0: 1
1: 0
2: 3
3: 28
4: 286
Right 920217155 1:204369020-204369042 TTATTCACCTGTATTTATCAAGG 0: 1
1: 0
2: 0
3: 39
4: 360
920217154_920217155 -3 Left 920217154 1:204369000-204369022 CCAGTTTCTAATCATTCATTTTA 0: 1
1: 0
2: 0
3: 37
4: 564
Right 920217155 1:204369020-204369042 TTATTCACCTGTATTTATCAAGG 0: 1
1: 0
2: 0
3: 39
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920217155 Original CRISPR TTATTCACCTGTATTTATCA AGG Intronic