ID: 920217461

View in Genome Browser
Species Human (GRCh38)
Location 1:204371115-204371137
Sequence TCATTGCCACATGTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920217459_920217461 7 Left 920217459 1:204371085-204371107 CCTCAGTGATGCTTGTAACATTT 0: 1
1: 1
2: 0
3: 22
4: 257
Right 920217461 1:204371115-204371137 TCATTGCCACATGTGGCTCATGG 0: 1
1: 1
2: 4
3: 47
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920217461 Original CRISPR TCATTGCCACATGTGGCTCA TGG Intronic
900072483 1:782839-782861 TAATAGCCACATGTGGCTACAGG - Intergenic
900967318 1:5967721-5967743 ACATTGCCAAATGTGCCTTAGGG - Intronic
900970450 1:5989794-5989816 TCAGTGCCACACTTGGCCCAAGG + Intronic
901048043 1:6410736-6410758 TCACTGCAACCTGTGCCTCATGG + Intergenic
901157903 1:7152759-7152781 ACATGGCCACATGAGGCTCTGGG - Intronic
901171903 1:7265184-7265206 TCACCACCACATGTGGCTCATGG - Intronic
902529233 1:17079867-17079889 TCATTGCAACCTGTGCCTCTTGG + Intronic
902840841 1:19072883-19072905 TCGCTGCTTCATGTGGCTCAGGG - Intergenic
903135223 1:21305064-21305086 AAATAGCCACATGTGGCTCATGG - Intronic
903398974 1:23025105-23025127 TAATAGCCACATGTGGCTACAGG - Intronic
903682021 1:25103495-25103517 TCAGAGCCACATGTGGCTGTGGG + Intergenic
903836562 1:26207218-26207240 TCATTGCAACCTGTGCCTCCCGG + Intergenic
904349184 1:29893879-29893901 CCATGGCCACATGGTGCTCATGG + Intergenic
905392684 1:37647888-37647910 TCATTGCAACCTCTGCCTCACGG + Intergenic
905696392 1:39977248-39977270 TCATTACCACATGTGACTGTTGG + Intergenic
905806226 1:40879703-40879725 CAGTAGCCACATGTGGCTCATGG + Intergenic
907220535 1:52904249-52904271 TAATAGCCACATGTGGCTTGTGG - Intronic
907438842 1:54465926-54465948 TCAATGCCACATGAGGTTCTAGG + Intergenic
908157804 1:61373978-61374000 TAGTAGCCATATGTGGCTCATGG - Intronic
908678887 1:66636579-66636601 TCATAGCCACTTGTGGCTAGTGG + Intronic
908744053 1:67358499-67358521 TCACTGCAACATGTGTCTCCTGG - Intronic
910164038 1:84304403-84304425 TCGTAGCCACATGTGGCTAGTGG - Intronic
911108195 1:94154445-94154467 CCATAGCCACATGTGGCTGGTGG - Intronic
911237692 1:95429226-95429248 TCTTTGCCACATGGGTCTCTCGG - Intergenic
912966070 1:114238716-114238738 TCATAGCCCCATGTGGCTGGTGG - Intergenic
913204097 1:116519825-116519847 CCATAGCCACATGTAGCTCATGG + Intronic
914336079 1:146716111-146716133 TCACTGTCTCCTGTGGCTCAAGG + Intergenic
916430628 1:164724549-164724571 TCTGGGCCGCATGTGGCTCATGG + Intronic
917156740 1:172009457-172009479 TAATAGCCACATGTGGATAAAGG - Intronic
917204280 1:172554384-172554406 TAATGGCCACATGTGGCTAGTGG - Intronic
917826389 1:178825682-178825704 TAATAGCCACATGTAGCTAATGG - Intronic
918433354 1:184485171-184485193 CAATAGCCACATGTGGCTCATGG - Intronic
918475002 1:184915037-184915059 TAATAGCCACGTGTGGCTAATGG + Intronic
918496121 1:185138859-185138881 TCACTGCAGCATGTGGCTCCTGG + Intronic
918860792 1:189824477-189824499 TCATTGCAACATCTGCCTCCTGG + Intergenic
918941008 1:190996749-190996771 CAATAGCCACATGTGGCTAATGG - Intergenic
920057600 1:203204079-203204101 TCATTGCCTCATGGTGATCAAGG + Intergenic
920217461 1:204371115-204371137 TCATTGCCACATGTGGCTCATGG + Intronic
922212890 1:223499038-223499060 TCATTTCAACATGAGGCCCAGGG - Intergenic
922267425 1:223996796-223996818 TAATAGCCACATGTGGCTACAGG - Intergenic
923267617 1:232329682-232329704 TCATTGGCACATCTGGGTCTAGG + Intergenic
923940931 1:238825736-238825758 CAATAGCCACATGTGGCTCATGG - Intergenic
924047485 1:240046896-240046918 TCACTGCAACATGTGCCTCCCGG + Intronic
924096697 1:240559416-240559438 TCATTGCAACATTTGCCTCCTGG + Intronic
924382492 1:243477254-243477276 TCTATGCTGCATGTGGCTCAAGG - Intronic
1062918088 10:1257360-1257382 TCCTGGCAACAGGTGGCTCAGGG - Intronic
1063591944 10:7403565-7403587 TCATTGCGACCTCTGGCTCCTGG - Intronic
1063615403 10:7595931-7595953 TCACTGCAACCTGTGCCTCATGG - Intronic
1064048029 10:12036462-12036484 TCAATTCCACATGTGACTAATGG + Intronic
1064506274 10:16033823-16033845 TCCTTGGCACATGTGGGTCATGG - Intergenic
1064662866 10:17623857-17623879 TCACTGCAACATCTGCCTCATGG + Intergenic
1064822368 10:19351811-19351833 ACATTGCAACATATGACTCAAGG + Intronic
1065546373 10:26825584-26825606 TCACTGCCACCTCTGGCTCCTGG - Intronic
1065713703 10:28543488-28543510 TAATTGCCACATGTGAATGATGG + Intronic
1065887354 10:30090464-30090486 TCATTGCAACCTCTGGCTCTGGG - Intronic
1066131538 10:32399283-32399305 TCATTGCCACATGGAACTCCTGG + Intergenic
1066144410 10:32541584-32541606 TTCTTGCCAGATGAGGCTCAAGG - Intronic
1066605039 10:37157438-37157460 TCATTGCAACATCTGCCTCCTGG + Intronic
1066726286 10:38398805-38398827 TAATAGCCACATGTGGCTACAGG + Intergenic
1067122457 10:43485742-43485764 TAGTTGCCACATGTGGCTAGTGG + Intergenic
1067203166 10:44192472-44192494 TCCTTCCCACAGGTGGCACATGG - Intergenic
1067944128 10:50679687-50679709 CCATGGCCACAAGGGGCTCATGG + Intergenic
1068448200 10:57151061-57151083 TCACTGCCACCTCTGTCTCAAGG - Intergenic
1069100717 10:64317062-64317084 TCATTGTGACATATGGCACATGG - Intergenic
1069436653 10:68390496-68390518 TAGTAGCCACATGTGGCTCATGG - Intronic
1070649746 10:78226402-78226424 AAATAGCCACATGTGTCTCATGG - Intergenic
1070778150 10:79122209-79122231 TCATTGGCAGATGAGGCTTATGG - Intronic
1070865622 10:79706557-79706579 CCATGGCCACAAGGGGCTCATGG + Exonic
1070879415 10:79844688-79844710 CCATGGCCACAAGGGGCTCATGG + Exonic
1071632523 10:87228778-87228800 CCATGGCCACAAGGGGCTCACGG + Exonic
1071645972 10:87360996-87361018 CCATGGCCACAAGGGGCTCACGG + Exonic
1072955103 10:99881151-99881173 TCACTGCAACATCTGGCTCCTGG - Intronic
1073773029 10:106756052-106756074 TCATTGCCACCTCTGCCTCCCGG - Intronic
1073911686 10:108352153-108352175 ACATTGCCCAATGTGGATCAAGG + Intergenic
1074173845 10:110975983-110976005 TCATTGCAACCTCTGCCTCACGG + Intronic
1074214931 10:111374972-111374994 TCATTGGCACAGGTGGCAAAAGG - Intergenic
1075006426 10:118833732-118833754 TCTTTGCAGAATGTGGCTCAGGG - Intergenic
1075059044 10:119241856-119241878 TCATAGGGAAATGTGGCTCAAGG + Intronic
1075387955 10:122070847-122070869 TCATTGCCACCTCTGCCTCCAGG - Intronic
1076743079 10:132497670-132497692 TCATTGCTCCCTGTGGCTCTTGG + Intergenic
1078487977 11:11741601-11741623 TAATAGCTACATGTGGCTAATGG + Intergenic
1078506698 11:11955536-11955558 CAATAGCCACATGTGGCTAATGG + Intronic
1078593224 11:12663968-12663990 TCATTGCAACTTCTGCCTCATGG + Intergenic
1079634695 11:22721668-22721690 CAATAGCCACATGTGGCTAATGG + Intronic
1080247007 11:30190586-30190608 CAATAGCTACATGTGGCTCATGG + Intergenic
1081041426 11:38219306-38219328 TGATAGCCACATGTGGCTCATGG + Intergenic
1081784141 11:45734503-45734525 TCATTTCCACTTGTGTCTCTTGG + Intergenic
1082771365 11:57210413-57210435 GCATAGCCACATGTGGCTATTGG + Intergenic
1083159472 11:60845930-60845952 ACATAGCCACATGTGGCTGGCGG - Intronic
1083896902 11:65624585-65624607 TGATGCCCACAGGTGGCTCAGGG + Intronic
1083935404 11:65867338-65867360 TCAAGGCCACATGTGGCTCTTGG + Intronic
1085427317 11:76416011-76416033 TAATAGCCACATGTGGTTAATGG + Intergenic
1085544751 11:77307158-77307180 TAATAGCCACATGTGGCTAGTGG + Intergenic
1085763892 11:79265355-79265377 CCATAGCCACATGTGGCCAATGG - Intronic
1086431660 11:86742323-86742345 TCAATGCCTCAAGTGGCTCCAGG - Intergenic
1088082720 11:105938836-105938858 TCAATGCCACTTGTGTCCCAGGG + Intronic
1088605675 11:111528574-111528596 TCTTTGCAAGATGTGGCTAAAGG - Intronic
1089065309 11:115658258-115658280 TCACTGCCACTTCTGCCTCAGGG - Intergenic
1089437109 11:118478471-118478493 CAATAGCCACATGTGGCTAATGG - Intronic
1089846011 11:121459231-121459253 AAATAGCCACATGTGGCTCTTGG + Intronic
1090085089 11:123643550-123643572 TCATAGCCACATGTGGCTGGTGG + Intronic
1090537704 11:127662605-127662627 TTATGGCCTCATGTGGCTTAAGG + Intergenic
1092146612 12:6219078-6219100 TCATTGCAACCTCTGGCTCCCGG + Intronic
1093064778 12:14645908-14645930 TCATTGCAACCTGTGCCTCCGGG + Intronic
1093106592 12:15094939-15094961 CAATTGCCACATGTGGCTAGTGG - Intergenic
1093372140 12:18378061-18378083 ACTCTGCCACATGTGCCTCAGGG + Intronic
1093513182 12:19952868-19952890 GCATGGCCACATGTGGCTAGTGG - Intergenic
1093574772 12:20713835-20713857 TAATAGTCACATGTGGCTTATGG + Intronic
1094284540 12:28778121-28778143 CAATAGCCACATGTGGCTAATGG + Intergenic
1095216500 12:39556334-39556356 TCCTTGACACATGGGGCTTATGG - Intronic
1095739358 12:45590292-45590314 TCATTGCAACATTTGCCTCCCGG - Intergenic
1095991097 12:48035152-48035174 CCCTTTCCACATGTGGCTGAGGG - Intergenic
1096428656 12:51525145-51525167 CCATAGCCACATGTGGCTAATGG + Intergenic
1096547916 12:52353930-52353952 CCACTGCCTCCTGTGGCTCAGGG + Intergenic
1096939338 12:55325128-55325150 TCACTGCAACATCTGCCTCATGG - Intergenic
1096999722 12:55866362-55866384 TCATTGCAACTTGTGCCTCCTGG - Intergenic
1097269849 12:57767232-57767254 TCATTGCAACATGAGACCCAAGG - Exonic
1098275906 12:68810938-68810960 TCATTGCAACCTCTGCCTCACGG + Intronic
1099212948 12:79815444-79815466 TCATTGCAACATCTGCCTCCCGG - Intronic
1099447753 12:82772408-82772430 TAATTGTCACATGTGGCTACTGG - Intronic
1100224805 12:92545299-92545321 TCATTGCAACATCTGCCTCCCGG - Intergenic
1100412100 12:94329989-94330011 TCACTGCCAAATGTTGCTGATGG - Intronic
1100605831 12:96151244-96151266 CAATAGCCACATGTGGCTAACGG - Intergenic
1101315614 12:103626292-103626314 AAATAGCCACATGTGGCTCGTGG + Intronic
1101658031 12:106741485-106741507 TAATAGCCACAGGTGGCTAATGG - Intronic
1102453953 12:113059888-113059910 TCATAGCCACATGTGTCTTGTGG + Intronic
1102580484 12:113883355-113883377 TTGATGCCACATGTGGGTCAGGG + Intronic
1103403191 12:120657197-120657219 ACATAGCCACATGTGGCTAGCGG + Intronic
1104948268 12:132427219-132427241 AAACTGCCCCATGTGGCTCAAGG + Intergenic
1106014417 13:25854746-25854768 CAATAGCCACATGTGGCTAATGG - Intronic
1106024314 13:25942495-25942517 TCACTGCCACATCTGCCTCCCGG + Intronic
1107049566 13:36032666-36032688 TCCTTTCCTGATGTGGCTCAAGG - Intronic
1107120350 13:36789119-36789141 CCCTTGCCAGATGTGGCTCCTGG - Intergenic
1107473999 13:40717274-40717296 TCATTGCAACATCTGCCTCCTGG - Intergenic
1107637183 13:42404374-42404396 TAATAGCCATATGTGGCTCATGG + Intergenic
1107813965 13:44227652-44227674 ACATTGCCAAATGTGCCCCAGGG - Intergenic
1107924128 13:45241479-45241501 TAATTGCCACATGTAGCTAGTGG - Intronic
1108250224 13:48559327-48559349 TCATTGCAACCTCTGGCTCCTGG - Intergenic
1108728915 13:53212562-53212584 TCATTGCAACCTGTGGCTCCTGG + Intergenic
1109076350 13:57840958-57840980 AGATAGCCACATGTGGCACATGG - Intergenic
1109672651 13:65629520-65629542 TCATTGCAACCTCTGCCTCATGG - Intergenic
1110114784 13:71799520-71799542 TCATTGCCCCATGTGGCAAATGG - Intronic
1110619299 13:77577512-77577534 CCCTTGACACATGGGGCTCATGG + Intronic
1111499303 13:89094684-89094706 TCATTGCCACCTGTGCCTACTGG - Intergenic
1112328553 13:98459961-98459983 TCAGTGAAACATGTGGCTCAGGG + Intronic
1112560756 13:100511782-100511804 TCATTGCAACATTTAGCGCATGG + Intronic
1113957463 13:114106999-114107021 TCCTTGCCAGATGTGGCTCTGGG - Intronic
1114619628 14:24087563-24087585 TCATTCCTACTTCTGGCTCATGG + Intronic
1115101487 14:29706590-29706612 TCATTGCCAGATGTTGCACAAGG + Intronic
1115145367 14:30219919-30219941 TCATTGCAACATCTGCCTCTTGG - Intergenic
1115244168 14:31277929-31277951 TCACTGCCACCTCTGGCTCCTGG - Intergenic
1115758500 14:36554030-36554052 TCAAAGCCACATGTGGCTATTGG + Intergenic
1115986896 14:39111334-39111356 TCACTGCCACCTGTGCCTCCCGG - Intergenic
1116411429 14:44627962-44627984 TAATAGCCACATGTGGCTAGTGG - Intergenic
1116850520 14:49904254-49904276 CCATAGCCACATGTGGCTAGTGG + Intergenic
1117571401 14:57052491-57052513 TCATAGCTACCCGTGGCTCAAGG + Intergenic
1117618438 14:57558951-57558973 CAATAGCCACATGTGGCTAATGG + Intergenic
1118769573 14:68933206-68933228 TCACTGCAACATCTGCCTCAGGG + Intronic
1119055182 14:71412220-71412242 CCTGTGCCACATGTGGCTCGTGG - Intronic
1119387891 14:74269347-74269369 TCATTGCAACATCTGCCTCCTGG + Intergenic
1119422116 14:74513478-74513500 TCAGTGCCACATGTCCATCAAGG - Intronic
1119435136 14:74593680-74593702 CGATACCCACATGTGGCTCAGGG + Intronic
1119480967 14:74957487-74957509 TCACTGCAACATCTGCCTCATGG + Intergenic
1119812979 14:77539562-77539584 TCATTGCAACCTCTGGCTCCTGG + Intronic
1120124220 14:80721373-80721395 TAATAGTCATATGTGGCTCATGG - Intronic
1120205594 14:81583849-81583871 TAAGTGCTTCATGTGGCTCATGG + Intergenic
1120783889 14:88512675-88512697 GAATAGCCACATGTGGCTAATGG - Intronic
1122093639 14:99355676-99355698 TCATAGGCACATGGGGCTGATGG - Intergenic
1122527255 14:102396175-102396197 TCATTGCAACCTCTGCCTCATGG + Intronic
1122885723 14:104709507-104709529 TCATGGCTCCCTGTGGCTCACGG - Intronic
1124350740 15:28953864-28953886 TCATTCCGACTTGTGGCACAAGG + Intronic
1124359085 15:29021451-29021473 TCACTGCAACCTGTGGCTCCTGG - Intronic
1124807570 15:32901077-32901099 TCATTGCAACCTCTGCCTCAAGG - Intronic
1125239450 15:37557685-37557707 TCAGTGGCACATGTTGCTCCTGG - Intergenic
1125986396 15:44057197-44057219 TCACTGCCACCTCTGGCTCCGGG + Intronic
1126163381 15:45634099-45634121 TCACTGCAACATCTGCCTCATGG - Intronic
1126209360 15:46082342-46082364 TAATAGCCACATGTGGCTAGTGG + Intergenic
1126832869 15:52626782-52626804 TCAATTCCAATTGTGGCTCAGGG + Intronic
1127494068 15:59493133-59493155 TCATTGCCACCTCAGGCTGACGG - Intronic
1129797326 15:78388073-78388095 CAATTGCCACATGTGGCTGGTGG + Intergenic
1130097307 15:80865528-80865550 ACATAGCCACATGTGATTCATGG + Intronic
1130120752 15:81045645-81045667 CCATTGACACATGGGGCTTATGG - Intronic
1130850397 15:87787494-87787516 AAATAGCCACATGTGACTCATGG - Intergenic
1130954731 15:88619611-88619633 TCACTGCAACATGTGCCTCCCGG - Intergenic
1131294835 15:91138364-91138386 AAATAGCCACATGTGGCTCTTGG + Intronic
1131402071 15:92133187-92133209 ACATTGCCACATGTCCCTCGGGG + Intronic
1132080239 15:98857646-98857668 CCATAGCCACATGTGGCTAGCGG - Intronic
1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG + Intronic
1134114712 16:11539269-11539291 TCATTGAGACCTGTGTCTCAAGG + Intergenic
1134201340 16:12202011-12202033 TCATATCCAGCTGTGGCTCAGGG - Intronic
1135044935 16:19147428-19147450 TCATTTCAACATGTGGCACTAGG - Intronic
1136013587 16:27381048-27381070 TCAGCCCCACATGTGGCCCAAGG + Intergenic
1136062301 16:27735053-27735075 TCATGGGCAGATGTGGCCCAAGG - Intronic
1136566990 16:31076550-31076572 TCCTTGCCACAGGTGGTACAGGG - Exonic
1138090159 16:54167384-54167406 CAGTTGCCACACGTGGCTCATGG + Intergenic
1138133907 16:54504854-54504876 TCATTGTCACAAGTGTCTCCTGG - Intergenic
1138564929 16:57826102-57826124 TCATTGCCACCAGTGGCTGGAGG + Intronic
1139830684 16:69795443-69795465 CAATAGCCACATGTGTCTCATGG + Intronic
1139997543 16:70995108-70995130 TCACTGTCTCCTGTGGCTCAGGG - Intronic
1140830275 16:78744504-78744526 TCATTGCAACATCTGCCTCCTGG + Intronic
1140837384 16:78807785-78807807 AAATAGCCACATGTGGCTAATGG - Intronic
1141007963 16:80370833-80370855 TCATTGCAACCTGTGCCTCCTGG - Intergenic
1141338191 16:83177139-83177161 TAATAGCCACATGTGGCTAGTGG + Intronic
1141949764 16:87332980-87333002 CCATGGCCACATGTGGCTGGTGG - Intronic
1142687138 17:1583968-1583990 TCATTGCCACCTCTGCCTCCTGG + Intronic
1143179884 17:4978024-4978046 TAATAGGCACATGTGGCTAATGG + Intronic
1143518669 17:7432975-7432997 TAATAGCCACATTTGGCTAATGG - Intergenic
1143712582 17:8744666-8744688 GCAGAGCCACAGGTGGCTCAGGG + Exonic
1143759616 17:9091526-9091548 TCACTGCAACATTTGCCTCACGG + Intronic
1143979485 17:10856015-10856037 TCATAGCCACATGTGGCTAGTGG - Intergenic
1144184779 17:12786858-12786880 TAAGAGCCACATGTGGCTAAAGG - Intergenic
1144607253 17:16677730-16677752 TCATTGCAACATCTGCCTCCCGG - Intergenic
1145236165 17:21209801-21209823 TCAGAGCCACACGTGGCTAATGG + Intronic
1145393009 17:22470547-22470569 TCATTGCCACATATGTAACATGG - Intergenic
1146435749 17:32845644-32845666 TAATAGCCACATGTGGCTCGTGG - Intronic
1146435762 17:32845730-32845752 CAATTGCCACAGGTGGCTCGTGG + Intronic
1146782742 17:35689690-35689712 ACATAGCCACATGTGGCTAGTGG - Intronic
1147767818 17:42848865-42848887 TCATAGCCACGTGTGGCTAGTGG + Intronic
1147783255 17:42959291-42959313 TCACTGCCACCTCTGGCTCCTGG + Intronic
1149990485 17:61380540-61380562 TCACTGCCACGTGTCTCTCAGGG - Intronic
1150968386 17:69998380-69998402 TCATTGCAACCTGTGCCTCCTGG + Intergenic
1151336861 17:73444903-73444925 TCATAGGCACGTGTGGCTCATGG - Intronic
1151388401 17:73769596-73769618 CAATAGCCACATGTGGCTCAGGG + Intergenic
1151910749 17:77081325-77081347 TAGTAGCCACATGGGGCTCATGG - Intergenic
1152346895 17:79758162-79758184 TCATTGCCACCTCTGCCTCCTGG - Intergenic
1152592483 17:81220567-81220589 TCATTGCCACCTCTGCCTCCCGG + Intronic
1152756690 17:82089996-82090018 TCCTGCCCACATGTGGCCCATGG + Intronic
1152860908 17:82696907-82696929 CCACAGCCACACGTGGCTCATGG + Intronic
1153361753 18:4205726-4205748 CAATAGCCACATGTGACTCATGG + Intronic
1155441386 18:25865959-25865981 TCACTGCAACATCTGCCTCATGG - Intergenic
1155957463 18:31965836-31965858 TCATTGCCACATGTGTGGGAGGG - Intergenic
1155961170 18:31996185-31996207 TCAATGCCAGATGGCGCTCAAGG - Intergenic
1156336376 18:36176196-36176218 TCATAGCCACATGTGGCTCATGG + Intronic
1157016901 18:43726014-43726036 CAATAGCCACATGTGCCTCATGG + Intergenic
1159194635 18:65096762-65096784 TCATTGCAACATCTGCCTCCCGG - Intergenic
1161273629 19:3403973-3403995 CCAGTGGCACATGTGGCTCCCGG + Intronic
1161549436 19:4903385-4903407 TCACTGCCACATCTGCCTCCCGG + Intronic
1161839777 19:6672573-6672595 TCATTGCAACTTGTGCCTCCCGG - Intergenic
1162149637 19:8635909-8635931 TCATTGCCACCTCTGCCTCCTGG + Intergenic
1162336924 19:10067557-10067579 TGGTAGCCACATGTGGCTAATGG + Intergenic
1163260493 19:16186790-16186812 ACATTGCCACATGTGCTTCGGGG - Intronic
1163352620 19:16787783-16787805 TCACTGCAACCTGTGTCTCATGG - Intronic
1163812593 19:19443091-19443113 AAATAGCCACATGTGGCTAATGG + Intronic
1164297102 19:23921219-23921241 TCATTGCAACCTCTGGCTCCTGG - Intronic
1164659759 19:29953187-29953209 TAATAGCCACATGTGGTTAATGG - Intronic
1165310847 19:35028827-35028849 TCATTGCCACCTCTGCCTCCCGG + Intergenic
1165847739 19:38829384-38829406 TCATTGCAACATCTGCCTCCTGG - Intronic
1166943941 19:46385703-46385725 TCATTGCAACATGTGCCTCCTGG - Intronic
1167053599 19:47095155-47095177 TCAGTGCCACCTGAGGCTGAGGG + Intronic
1167438582 19:49494879-49494901 AAATAGCCACATGTGGCTAAAGG - Intergenic
1168487592 19:56777615-56777637 TGATAGCAACATGTGGCTAATGG - Intronic
924973932 2:156176-156198 TCCTTGCCTCCTGTGGCTAAGGG - Intergenic
925038798 2:714206-714228 TCAGAGCCATATGTGGCTCGAGG - Intergenic
925299555 2:2800860-2800882 ACATTCCCAGATGTGGCCCATGG + Intergenic
925979017 2:9162137-9162159 TCATTGCAGCATGTGCCTCCTGG - Intergenic
926170790 2:10551315-10551337 TCACTGCCACCTGTGCCTCCCGG - Intergenic
926292525 2:11542125-11542147 TCATTACCACTTGTTGCTAAGGG - Intronic
926390210 2:12382439-12382461 TAATAGCCACATGTGGCTAATGG + Intergenic
926930251 2:18030620-18030642 TCATTGCAACCTGTGCCTCCTGG - Intronic
928140880 2:28727925-28727947 TCCTGGCCACATTTGGCCCAAGG - Intergenic
928533349 2:32215267-32215289 TCACTGCAACATCTGCCTCATGG + Intronic
929089173 2:38197828-38197850 TCATGGACACATTTGGCTCTTGG - Intergenic
929397400 2:41539076-41539098 TCATTGCAACATCTGCCTCCTGG + Intergenic
930572338 2:53102700-53102722 TCAATGCCACATCTGCCTCCAGG - Intergenic
931353652 2:61514992-61515014 TCATTGCAACCTCTGGCTCTCGG - Intronic
931760123 2:65409237-65409259 TCAGTGCCACTTGTGGCTGCTGG - Intronic
932406559 2:71516559-71516581 TCATTGCCACAAGTGATTTAAGG - Intronic
932754419 2:74396633-74396655 TAATGGCCACATGTGGCCAAGGG + Intergenic
932891023 2:75597711-75597733 TCCTTCCCACATGTGTCTCTGGG + Intergenic
933527430 2:83460333-83460355 CAATAGCCACATGTAGCTCACGG + Intergenic
935096885 2:99953226-99953248 TCAGTGCCACCTGTGTCTCCTGG + Intronic
935640061 2:105281827-105281849 GCATTGCCACATGTTCCCCAGGG - Intronic
935748894 2:106213120-106213142 TCCTCGCCACCTGTGGCTAAAGG + Intergenic
937204741 2:120228244-120228266 TCATTGCTACATGTGTATCCAGG - Intergenic
937514613 2:122638967-122638989 TCATTGCAACATTTGCCTTATGG - Intergenic
938168783 2:129056803-129056825 GCATTTCCACATCTGGCACAGGG - Intergenic
938476346 2:131617929-131617951 TCATTGCAACCTCTGCCTCATGG + Intergenic
938755896 2:134378688-134378710 TCACTGCCACCTGTGACTCCCGG + Intronic
938919255 2:135978736-135978758 TAATGACCACATGTGGCTAACGG - Intronic
938950108 2:136247408-136247430 TCATGGCCACGTGTGGCTTGTGG + Intergenic
939421769 2:141980716-141980738 TACTTGCCACATGTGGCTACTGG + Intronic
940036950 2:149320937-149320959 TCCTTGCCACCCGTGGCCCAAGG - Intergenic
940941100 2:159561622-159561644 AAATAGCCACATGTGGCTTATGG + Intronic
941118152 2:161495751-161495773 TCATTGACAGATGTGGCTGGTGG - Intronic
941614678 2:167705880-167705902 TAATAGCCACATGTGGCTATTGG + Intergenic
942368370 2:175254655-175254677 TTATAGCCACATGTGGCTGATGG - Intergenic
942533873 2:176942257-176942279 TGATAGCCACATGTGGCTAGTGG + Intergenic
943321590 2:186450631-186450653 TCATTGCAACCTGTGCCTCCTGG - Intergenic
943332952 2:186581986-186582008 TCATTGTCACATGTATCTAATGG - Intergenic
943655411 2:190503369-190503391 TAATAGCCACATATGGCTTATGG - Intronic
943655419 2:190503444-190503466 AAATAGCCACACGTGGCTCAAGG + Intronic
944545978 2:200799333-200799355 ACATAGCCACATGTGGCTGGTGG - Intergenic
944655630 2:201874137-201874159 AAATAGCCACATGTGGCTAATGG - Intronic
944682954 2:202093396-202093418 CAATAGCCACATGTGGCTAATGG - Intronic
944907168 2:204273864-204273886 TTAATGCCACATGTGGCTTGTGG - Intergenic
945042845 2:205756475-205756497 AAATTGCCACACATGGCTCATGG - Intronic
946101774 2:217331530-217331552 TCATCGTTGCATGTGGCTCAGGG + Intronic
946113716 2:217443701-217443723 TAATTCCCACATGTTGCACAAGG - Intronic
946432048 2:219631262-219631284 TCAGTGCCCCATTGGGCTCAGGG - Intronic
946888048 2:224244303-224244325 TCATTGCCACTTGGGGCACGTGG - Intergenic
948307399 2:236959508-236959530 TAATAGCCACATGTGGCTAGAGG + Intergenic
1168879045 20:1190938-1190960 TCAATGCCAAGTGTGGCTTATGG + Intergenic
1169651728 20:7876240-7876262 CAATAGCCACATGTGGCTGATGG + Intergenic
1169750055 20:8982406-8982428 TTATTTCCAGATGTTGCTCATGG - Intergenic
1170171294 20:13416059-13416081 AAATAGCCACATGTGGCTCGTGG - Intronic
1170409499 20:16073393-16073415 AAATTGCCACATGTGGCTAGTGG + Intergenic
1170933446 20:20790158-20790180 TCATTGCAACCTCTGCCTCACGG - Intergenic
1171009309 20:21499658-21499680 TGATAGCCACATGTGGCTAGTGG + Intergenic
1171266724 20:23777182-23777204 CCATGGCCACATGTGGCTGGTGG + Intergenic
1171276269 20:23858826-23858848 CCATGGCCACATGTGGCTGGTGG + Intergenic
1171964429 20:31518569-31518591 TCATTGCAACCTGTGCCTCCCGG - Intronic
1171998181 20:31749718-31749740 TCACTGCAACCTCTGGCTCACGG - Intronic
1172595119 20:36145735-36145757 TCATAGCCACATGTGGTTAGTGG - Intronic
1172627921 20:36359055-36359077 CAATAGCCACATGTGGCTCATGG - Intronic
1172659764 20:36559611-36559633 TCATTGCCACCTCTGCCTCCCGG - Intergenic
1174129769 20:48335005-48335027 TCATTGCCACCTCTGTCTCCTGG - Intergenic
1174462773 20:50694576-50694598 TCATTGCAACATCTGCCTCCCGG + Intergenic
1174580055 20:51564910-51564932 TAATAGCCACATGTGGCTAGTGG - Intergenic
1174622511 20:51886845-51886867 AAATTGCCACATGTGGCTAGTGG - Intergenic
1175414296 20:58791515-58791537 AAATAGCCACACGTGGCTCAGGG - Intergenic
1175566783 20:59986081-59986103 ACATTGCCAAATGTCCCTCAGGG + Intronic
1176071297 20:63227847-63227869 TCACTGCCACCTGTGCCTCCTGG + Intergenic
1176290073 21:5039018-5039040 TCATTGCAACATCTGCCTCCCGG + Intronic
1177179652 21:17731202-17731224 TAATTCCCAGATGTGTCTCATGG + Intergenic
1178392543 21:32211113-32211135 TCATTGCAACATTTGCCTCCCGG + Intergenic
1178752608 21:35318816-35318838 TCATAGCCACATGTGGCTCTTGG + Intronic
1178983535 21:37284378-37284400 TTATTGCCACATGGGACTCCTGG - Intergenic
1179011837 21:37562536-37562558 ATATGGCCACATGTGGCTCTAGG + Intergenic
1182852552 22:33488162-33488184 AAATTGCCACATGTGGCTAGTGG - Intronic
1182995770 22:34810577-34810599 TTATTGCTACCTGTGGCTAACGG - Intergenic
1184969560 22:48006062-48006084 TCATTGCAACCTGTGCCTCCCGG + Intergenic
950505225 3:13390474-13390496 GCACTGCCACATGTGGGACAGGG - Intronic
950714163 3:14836099-14836121 TCCATGCCACATGTTGCACAAGG + Intronic
951126704 3:18993338-18993360 CAATAGCCACATGTGGCTAATGG - Intergenic
951641896 3:24845600-24845622 TGATTGCCAAATCTGGCACATGG - Intergenic
951648012 3:24915461-24915483 CAATAGCCACATGTGGCTAATGG + Intergenic
952483408 3:33785615-33785637 TCATTGCAACCTCTGGCTCCCGG + Intergenic
952541866 3:34375298-34375320 TATTTGCTGCATGTGGCTCAAGG + Intergenic
952695912 3:36264797-36264819 TCTTTGCAACCTGTGGATCAGGG - Intergenic
952761229 3:36916199-36916221 ACATAGCCACATGTGGCTAGTGG + Intronic
953049436 3:39327536-39327558 TCCTTGCCACTTCTGGCTCTTGG - Intergenic
953236148 3:41109397-41109419 CAATAGCCACATGTGCCTCATGG + Intergenic
953245859 3:41191304-41191326 TAATAGCTACATGTGGCTAATGG + Intergenic
953499787 3:43422189-43422211 TCATTGCAACCTCTGCCTCACGG + Intronic
954220525 3:49150788-49150810 TCATTGCAACCTGTGCCTCCTGG - Intergenic
954967417 3:54623838-54623860 TAAATTCTACATGTGGCTCAAGG + Intronic
955065668 3:55531779-55531801 TCATTGCCAGTGGTGGCCCAGGG - Intronic
955102454 3:55863895-55863917 CAATAGCCACATATGGCTCATGG + Intronic
955112751 3:55965293-55965315 CAATAGTCACATGTGGCTCATGG - Intronic
955123838 3:56089642-56089664 CAATAGCCATATGTGGCTCATGG + Intronic
955137661 3:56235798-56235820 TAATAGCCACATGTGGCTAGCGG + Intronic
955908014 3:63828108-63828130 TCAAAGCCAAATGTGGCTAACGG - Intronic
956630331 3:71310891-71310913 TCATGGCCACATCTGGCTCTTGG + Intronic
958450657 3:94268398-94268420 TCATTGCAACCTGTGCCTCCCGG - Intergenic
958898555 3:99858388-99858410 TCATTGCAACCTCTGCCTCACGG - Intronic
958962638 3:100524544-100524566 CAATAGCCACATGTGGCTCGTGG - Intronic
958996134 3:100907417-100907439 TCACTGCAACCTGTGCCTCATGG - Intronic
959471968 3:106763541-106763563 TCATTGCAACATCTGCCTCCAGG + Intergenic
960326848 3:116307167-116307189 TCTTTGCCAAATTTGACTCAGGG + Intronic
960514233 3:118585735-118585757 TAGTGGCCACATGTGGCTCATGG + Intergenic
960535919 3:118813985-118814007 TTATAGCCACGTGTGGCTAATGG + Intergenic
960562497 3:119100507-119100529 TACTTGCCACATGTGGTTAAAGG + Intronic
960699419 3:120426116-120426138 TTATTTCCACATGTAGTTCAAGG + Intronic
961503301 3:127352548-127352570 TCAGAGCCACATGTGGCTTGTGG - Intergenic
961919284 3:130409009-130409031 TAATAGCCACATATGGCTAATGG + Intronic
962255102 3:133865142-133865164 TCATTTCCCCATGTCTCTCATGG + Intronic
962489677 3:135881168-135881190 TCACTGCAACATCTGCCTCATGG - Intergenic
963547251 3:146675570-146675592 CAATAGCCACATGTGGCTAAGGG + Intergenic
963725187 3:148911924-148911946 GCATGGCCCCAGGTGGCTCATGG + Intergenic
964683984 3:159374836-159374858 CTATAGCCACATGTGGCTAATGG - Intronic
964705769 3:159616963-159616985 TCAATGCCACATGTAGCCAATGG + Intronic
964874577 3:161351933-161351955 TAATAGCCACATGTGGCTAGTGG + Intronic
965392969 3:168128186-168128208 TCATAGCAACAGGTGGCTTATGG - Intergenic
965432318 3:168604952-168604974 TGATTGTCACATGTGGCTTGTGG - Intergenic
965833014 3:172817116-172817138 TCATAGCCACAAGTGGCTAGTGG + Intronic
966696672 3:182796424-182796446 TAATGGCCACTTGTGGCTAATGG - Intronic
966942723 3:184757118-184757140 TCATTTCCGCCTGTGGCTCCTGG - Intergenic
967015598 3:185478795-185478817 TCATTGCAACCTGTGCCTCCTGG - Intronic
967247373 3:187501544-187501566 TCACTGCAACATTTGCCTCATGG - Intergenic
968128947 3:196180946-196180968 TCATTGCAACATCTGCCTCCTGG + Intergenic
968638174 4:1694155-1694177 TCATTGCCACCTCTGCCTCCCGG + Intronic
969218144 4:5739598-5739620 ACATGGCCAGATTTGGCTCAAGG - Intronic
969278998 4:6156798-6156820 TCATGGCCACACCTGGCACATGG + Intronic
970069985 4:12147364-12147386 TCATGGCCATATGTGGCTAATGG + Intergenic
970164902 4:13226399-13226421 CCCTTGCCCCATGTGGCTCCTGG - Intergenic
972578220 4:40371500-40371522 TCATTGCAACATCTGCCTCCTGG - Intergenic
972757293 4:42061325-42061347 AAATTGCCACATGTGGCTAGTGG + Intronic
973790097 4:54370397-54370419 TAATAGCCACATGTGGCTACTGG + Intergenic
974048880 4:56921310-56921332 TAATAGCCACATGTGGCTAGTGG - Intronic
976198620 4:82558293-82558315 CAATAGCCACATGTGGCTCATGG + Intronic
976880726 4:89921871-89921893 TCAAAGCCACATATGGCTTAGGG + Intronic
977567062 4:98591487-98591509 TAGTAGCCTCATGTGGCTCATGG - Intronic
977795754 4:101162638-101162660 TCATTGTCAAATGTTGCACAGGG - Intronic
978718946 4:111882395-111882417 TCATAGCCACATGTGGCCAGTGG - Intergenic
979335696 4:119458870-119458892 TAATAGCCACATGTGGCTACAGG - Intergenic
980040648 4:127935831-127935853 AAATAGCCACATGTGGCTAATGG + Intronic
980336981 4:131488158-131488180 TCATTGCCACCTCTGCCTCCTGG - Intergenic
980790625 4:137615196-137615218 TCATTGCCACCTCTGCCTCCAGG - Intergenic
981742547 4:148017874-148017896 TCATTTCCACATGTGGTCCCTGG + Intronic
982164978 4:152605957-152605979 TGACTTCCACATGTGGCTCATGG - Intergenic
982360614 4:154515286-154515308 TAATAGCCACATGTGGCTAATGG - Intergenic
982614243 4:157620443-157620465 GCATAGCCACATTTGTCTCAAGG + Intergenic
983212269 4:164971024-164971046 TCACTGCCACATCTGCCTCCCGG - Intronic
983382568 4:167016613-167016635 TCATTGCAACATTTGCCTCCTGG + Intronic
983536217 4:168860034-168860056 TAATAGCTACATGTGGCTAATGG + Intronic
983991538 4:174125984-174126006 TAGTAGCCACATGTGGCTCATGG + Intergenic
984172856 4:176381520-176381542 CCATGGCCACATGAGGCCCAGGG + Intergenic
985222954 4:187727333-187727355 CAATGGCCACATGTGGCTGAGGG - Intergenic
985827533 5:2204279-2204301 TCATGGGCACATTTGGCTTAAGG - Intergenic
986450788 5:7862337-7862359 CAGTAGCCACATGTGGCTCATGG - Intronic
986651817 5:9971570-9971592 TCATTGCCACATTTTCCTCTGGG + Intergenic
987301844 5:16604321-16604343 TCATTGCCCCATTTGGCAGAGGG - Intronic
987310186 5:16674392-16674414 TCATTGCAACATCTGCCTCCTGG - Intronic
987715419 5:21562777-21562799 TCATTTTTACATGTGGTTCAAGG - Intergenic
987775339 5:22358611-22358633 TCCTTTCCAAATGTGGCCCAGGG + Intronic
988182238 5:27811486-27811508 TCACTGCCACATCTGCCTCACGG - Intergenic
988611898 5:32734725-32734747 TCAATGCCACATGTGGCTAGTGG - Intronic
989168362 5:38451915-38451937 TCACTGCAACATCTGCCTCATGG - Intronic
989296235 5:39830259-39830281 TCACTGCCACCTCTGCCTCACGG + Intergenic
989748129 5:44856802-44856824 AAATTGCCACATGTGTCTAATGG - Intergenic
990488985 5:56285695-56285717 TCATTGCAACATCTGCCTCCCGG + Intergenic
990579208 5:57151747-57151769 TCATTGCAACCTCTGCCTCATGG - Intergenic
990876693 5:60494352-60494374 TCAGTGGCACAAGTGGCTCTGGG - Intronic
991943375 5:71876492-71876514 TAATAGCCACATGTGGCAAATGG - Intergenic
992230207 5:74656402-74656424 TCATTGCAACCTGTGCCTCCCGG - Intronic
992445310 5:76828042-76828064 TCATTGCAACCTGTGCCTCCCGG + Intronic
992733478 5:79695516-79695538 TCATAGCCACATGTAGCTAGTGG + Intronic
993110028 5:83645365-83645387 TCTGGGCCACATGTGGCTCATGG - Intronic
993402469 5:87470890-87470912 TAGTAGCCTCATGTGGCTCATGG + Intergenic
994236288 5:97367289-97367311 TTATGGCCACATGTGGCTAGTGG + Intergenic
994293867 5:98065289-98065311 CCAGTGCCACATGTGGCTAATGG - Intergenic
994384563 5:99114662-99114684 AAATAGCCACATGTGGCTAATGG + Intergenic
995338251 5:111027302-111027324 TCACTGCCACTTGTGCCTCCAGG - Intergenic
995511450 5:112914195-112914217 TCATTGCAACCTGTGCCTCCTGG + Intronic
995664702 5:114528555-114528577 TCATTGCAACCTGTGTCTCCTGG + Intergenic
995723325 5:115160474-115160496 TAATAGCCACATGTGGCTAGTGG + Intronic
996994243 5:129675951-129675973 TCATTGCAACCTCTGCCTCATGG - Intronic
997167799 5:131680150-131680172 AAATAGCCACATGTGGCTGACGG + Intronic
998833708 5:146184409-146184431 AAATTGCCACATGTGGCTAGTGG - Intergenic
998922629 5:147086499-147086521 TCACTGCCACATCTGCCTCCTGG + Intergenic
999982388 5:156970182-156970204 TCATGGGCACAATTGGCTCAAGG + Intergenic
1000214126 5:159138703-159138725 TGATAGTCACATGTGGCTAATGG + Intergenic
1000378284 5:160604817-160604839 CCATAGACACATGTGGCTCCTGG - Intronic
1000930907 5:167250065-167250087 TAATGGCCACATGTGGCTAGTGG - Intergenic
1001103705 5:168834947-168834969 GAATTGCCACGTGTAGCTCATGG - Intronic
1001219614 5:169889038-169889060 CCATTACCACATGTCTCTCAAGG - Intronic
1002670587 5:180863025-180863047 AAATAGCCACATGTGGCTAATGG + Intergenic
1003689156 6:8335850-8335872 CAATAGCCACATGTGGCTCGTGG + Intergenic
1003795672 6:9600312-9600334 TCATTGCCACTTCTGCCTCCTGG + Intronic
1003829814 6:9995424-9995446 CAATAGCCACATGTGGCTCATGG - Intronic
1005054830 6:21719845-21719867 TCATTGCCACATGTCTGTAATGG - Intergenic
1005093096 6:22079990-22080012 CCGTGGCCACATGTGGCTCTTGG + Intergenic
1005867928 6:29950158-29950180 TGATGGCCAAATGTGGCTCCAGG + Intergenic
1006219923 6:32480235-32480257 ACATTGCCACATGTTCCCCAAGG + Intergenic
1006229208 6:32567982-32568004 ACATTGCCACATGTTCCCCAAGG + Intronic
1006859637 6:37162187-37162209 TCACTGCAACATCTGCCTCATGG - Intergenic
1007367832 6:41407138-41407160 TCCTTGCCACGTGTGGCGCCCGG - Intergenic
1008913136 6:56758205-56758227 ACATAGCCACATCTAGCTCAAGG - Intronic
1009001306 6:57719269-57719291 TCATTTTTACATGTGGTTCAAGG + Intergenic
1009925038 6:70110520-70110542 TTATTGCCACTTGTCCCTCATGG + Intronic
1010194668 6:73226961-73226983 TCATTGCAACCTGTGCCTCCTGG - Intronic
1011631693 6:89332543-89332565 CCATAGCCACATGTGGCTAATGG - Intronic
1011732418 6:90279076-90279098 CAAATGCCACATGTGGCTGATGG + Intronic
1011820380 6:91246224-91246246 CAATAGCCACATGTGGCTAATGG + Intergenic
1012197626 6:96363514-96363536 TCACTGCAACATGTGCCTCCCGG - Intergenic
1012236159 6:96818386-96818408 TCATTGCAACATCTGCCTCCTGG - Intronic
1013285844 6:108680703-108680725 TCATTGCCAAATGTCACTAAAGG + Exonic
1014518095 6:122403530-122403552 TCATTGCAACCTCTGCCTCATGG - Intronic
1014643166 6:123939484-123939506 TCATTGTAAAATGTGACTCATGG + Intronic
1014752658 6:125271719-125271741 TCATTGCCAAAGGTGGCCAAAGG - Intronic
1015112689 6:129610969-129610991 TCACTGCCACATGGGACTCCTGG + Intronic
1015506690 6:133995576-133995598 TGATTGCCACATGTGATTGAAGG + Intronic
1016098608 6:140069011-140069033 TTATTGCTACATATAGCTCATGG + Intergenic
1016267622 6:142250804-142250826 TCATTGCCACGTCTGCCTCCTGG - Intergenic
1016731662 6:147433937-147433959 TCATGGCAACATCTGGCTCCTGG + Intergenic
1017622838 6:156316909-156316931 TCTTTCCTACATGTGGCTGAAGG - Intergenic
1017773520 6:157661896-157661918 TCACTGCCACATCTGCCTCCTGG + Intronic
1017776248 6:157683320-157683342 TCATTGCAACATCTGCCTCCCGG + Intergenic
1019808112 7:3143691-3143713 TCACTGCAACATGAGTCTCATGG - Intronic
1020490967 7:8783691-8783713 TCATTGACACATCTTACTCAGGG + Intergenic
1021668954 7:23015553-23015575 TGATAGCCACATGTGGCTAATGG - Intergenic
1021776439 7:24059457-24059479 CCCTTGCCCCATGTGGCTCCCGG - Intergenic
1021912878 7:25403956-25403978 CAATAGCCACATGTGGCTGATGG - Intergenic
1022977070 7:35568605-35568627 ACATTGCCACATGTCCCCCATGG - Intergenic
1023005700 7:35864449-35864471 TAATAGCCACATGTGGCTACAGG - Intronic
1023326214 7:39060131-39060153 TCATTGCCACCTCTGCCTCCTGG - Intronic
1024068395 7:45764887-45764909 TAATAGCCACATGTGGCTACAGG + Intergenic
1024155189 7:46614839-46614861 CCATTGAAATATGTGGCTCAAGG + Intergenic
1026898579 7:74024599-74024621 TGCTGGCCACATGTGGCTAATGG + Intergenic
1027434384 7:78149162-78149184 CCACAGCCACATGTGGCTAATGG + Intronic
1027558136 7:79692268-79692290 TTCTTGCCTCATGTGACTCAGGG + Intergenic
1028180216 7:87711741-87711763 CCATTGCCACATGTAGCTAATGG + Intronic
1028184073 7:87760199-87760221 TGAATGCCACATGTGGCTAATGG - Intronic
1029129489 7:98319147-98319169 TCACTGCCACATGGGGGTCTGGG + Intronic
1029205627 7:98867878-98867900 CCTTTGCCAAATGTGGCTGAAGG + Intronic
1029314837 7:99702162-99702184 TCACTGCCACCTATGCCTCATGG + Intronic
1029597223 7:101544300-101544322 TCATTGCCACCTCTGCCTCCCGG + Intronic
1029882982 7:103836395-103836417 TCAATAGCACATGTGGCTCATGG + Intronic
1030412575 7:109200336-109200358 TCATAGCCCCATGTGGCTACTGG + Intergenic
1031061250 7:117053910-117053932 TCATTGCAACCTCTGCCTCATGG + Intronic
1032124593 7:129184060-129184082 TCATTGCAACATCCGGCTCCCGG + Intergenic
1032242000 7:130169580-130169602 TCAGTGCCACATGGGGCTGGTGG + Intronic
1032261856 7:130344619-130344641 AAATAGCCACATGTGGCTAATGG - Intergenic
1032334767 7:131015378-131015400 CCATGGCCACATGTGGCTGGTGG - Intergenic
1032434556 7:131889445-131889467 CCATGGCCACATGTGGCTAGTGG + Intergenic
1032872190 7:135998100-135998122 GCATTGCCAAATGTCCCTCAAGG + Intergenic
1033371806 7:140715626-140715648 TCTTTTCCACATGTGGGCCATGG + Intronic
1034327435 7:150249526-150249548 TCACTGCAACCTGTGGCTCCTGG + Intronic
1034330511 7:150278286-150278308 AAATTGCCATATGTGGCTGACGG - Intronic
1034667531 7:152831562-152831584 AAATTGCCATATGTGGCTGATGG + Intronic
1035098087 7:156372998-156373020 AAATAGCCACATGTGTCTCATGG + Intergenic
1035124039 7:156594986-156595008 ACAGTGCCACCTGTGTCTCAGGG - Intergenic
1036120083 8:6006791-6006813 TGATTTCCACATGTGCCTTATGG - Intergenic
1037198902 8:16225669-16225691 TAATAGCCACATGTAGCTAATGG + Intronic
1037467949 8:19178299-19178321 CAATTTTCACATGTGGCTCATGG - Intergenic
1038578537 8:28726718-28726740 ACATTGCCACATGTAGCCCGAGG + Intronic
1038930747 8:32191157-32191179 TCACTGCAACCTCTGGCTCATGG + Intronic
1039133704 8:34296741-34296763 AAATAGCCACATGTGGCTAATGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1039696789 8:39921376-39921398 TCACTGCCACATCTGCCTCCTGG - Intronic
1040036141 8:42871967-42871989 CAATGGCCACATGTGGCTCCTGG - Intronic
1040562895 8:48540416-48540438 TCTTTGCCCCATGTGGTTCCTGG + Intergenic
1041649561 8:60288468-60288490 TCATTGCAACCTCTGCCTCATGG + Intergenic
1041863777 8:62544729-62544751 TCAGTGCCCCATGTTGTTCAAGG - Intronic
1042131563 8:65591685-65591707 TCATTGCAACCTGTGCCTCCCGG - Intergenic
1042235195 8:66605257-66605279 CAATAGCCACATGTGGCTAATGG + Intronic
1042459784 8:69050300-69050322 TCATTGCAACCTCTGCCTCAGGG - Intergenic
1042881484 8:73496853-73496875 CAATAGCCACATGTGGCTAATGG + Intronic
1043384868 8:79738287-79738309 CCATAGCCACATGTGGCTAGTGG + Intergenic
1043417213 8:80063720-80063742 TCATTGCAACCTCTGGCTCCTGG - Intronic
1044243298 8:89911861-89911883 TCATTGCAACCTCTGCCTCACGG - Intronic
1044554763 8:93550955-93550977 TCATTGCAACATCTGCCTCCAGG - Intergenic
1044890651 8:96831949-96831971 CAATAGCCACATGTGGCTAATGG + Intronic
1045031174 8:98137714-98137736 CAACTGCCACATGTGGCTAATGG - Intronic
1045377480 8:101589302-101589324 TCATTAGTCCATGTGGCTCAGGG - Intronic
1045669898 8:104538776-104538798 TAATAGCTACATGTGGCTAATGG - Intronic
1046634949 8:116663854-116663876 TCACTGCAACATCTGCCTCACGG - Intronic
1046902642 8:119539480-119539502 TCATTTTAACATGTGGATCATGG + Intergenic
1047965075 8:130040444-130040466 TCACTGCAACATCTGCCTCAAGG - Intergenic
1048676713 8:136792127-136792149 TCATTGCCATTTGTGTCTAAAGG - Intergenic
1049098489 8:140562759-140562781 CCATAGCCACATGTGGCTAGTGG - Intronic
1049862178 8:144906991-144907013 TCATTGCAACATCTGCCTCCTGG + Intergenic
1049927629 9:424906-424928 TGATAGTCACATGTGGCTAATGG - Intronic
1050297326 9:4218728-4218750 AAATAGCCACATGTGGCTAATGG + Intronic
1051269054 9:15337069-15337091 TCATTGCAACCTATGGCTCTTGG - Intergenic
1051787505 9:20761493-20761515 TCATTGCAACCTCTGCCTCACGG + Intronic
1051860539 9:21620390-21620412 TCAATAGCACATGTGGCTCATGG - Intergenic
1052426835 9:28315325-28315347 TCATTGCAACCTGTGCCTCCGGG - Intronic
1052823072 9:33154763-33154785 TCCTGGCCGCATGTGGCCCATGG - Intronic
1052909793 9:33870215-33870237 TCATTGCCACCTCTGCCTCCTGG + Intronic
1052957750 9:34267778-34267800 CAATTGCCACATGTGGCTGGTGG + Intronic
1053266999 9:36722520-36722542 TGAATGCCACATGTGGATCAAGG - Intergenic
1054841094 9:69741025-69741047 CAATAGCCACATGTGGCTAATGG + Intronic
1055251314 9:74309903-74309925 ACATTGCCAAATGTCACTCAGGG + Intergenic
1055251584 9:74314330-74314352 TCATTGTAACATCTGCCTCATGG + Intergenic
1055363487 9:75520184-75520206 TGATTTGGACATGTGGCTCAGGG - Intergenic
1055385302 9:75755610-75755632 TAATAGCCACATGTGGCCAATGG + Intergenic
1056399466 9:86212527-86212549 TCACTGCCACATCTGTCTCCTGG - Intergenic
1056619408 9:88198741-88198763 GCATAGCCACATTTGTCTCAAGG + Intergenic
1057354995 9:94325400-94325422 CCATGGCCACAAGGGGCTCATGG - Exonic
1057565854 9:96165807-96165829 TCATTGCCACCTCTGCCTCTGGG + Intergenic
1057652757 9:96932234-96932256 CCATGGCCACAAGGGGCTCATGG + Exonic
1058432985 9:104935586-104935608 TCATTGCAACATCTGCCTCCCGG + Intergenic
1059245763 9:112848519-112848541 TCAAGGCCACACCTGGCTCATGG - Intronic
1059475429 9:114542995-114543017 TAGTGGCCACATGTGGCTCATGG + Intergenic
1059767139 9:117394307-117394329 TAATAGCCACATGTGACTCTTGG - Intronic
1059941436 9:119363745-119363767 ACATAGCTATATGTGGCTCATGG - Intronic
1060096476 9:120794900-120794922 TAATAGCCACATGAGGCTAATGG + Intergenic
1060615531 9:125009816-125009838 TCACTGCCACCTCTGGCTCCTGG - Intronic
1061078742 9:128357363-128357385 TCACTGCAACCTGTGGCTCCTGG - Intronic
1061106832 9:128537376-128537398 TCATTGCCACCTCTGCCTCCTGG - Intronic
1061265977 9:129505332-129505354 TCATTGCCAAATGGGGCTGCGGG + Intergenic
1061505352 9:131028764-131028786 ACACTGTCACATGTGGCTCTGGG - Intronic
1185632690 X:1526966-1526988 TCATTGCAACATCTGCCTCCCGG + Intronic
1186184193 X:7003949-7003971 TCATTGCAACCTGTGCCTCCAGG + Intergenic
1186430715 X:9502012-9502034 CCACAGCCACATGTGGCGCATGG - Intronic
1186771276 X:12820287-12820309 ACATTGCCACATGTCTCCCAGGG - Intronic
1187012263 X:15291958-15291980 TCATTGCAACCTCTGGCTCCTGG - Intronic
1187129794 X:16491485-16491507 GCATTGCCACATGTAGCTCATGG + Intergenic
1187527606 X:20068267-20068289 TAATAGCCACATGTGGCTGGCGG + Intronic
1187556365 X:20356156-20356178 TAATAGCCACATGTGGCTAGTGG - Intergenic
1187747547 X:22426107-22426129 TCCTTGCCTCATGTGGCCCGGGG - Intergenic
1187963583 X:24588779-24588801 ACATTGCCAAATGTTCCTCAGGG + Intronic
1188014573 X:25094111-25094133 TCATTGCCAAATGAGACTTATGG - Intergenic
1188022435 X:25173642-25173664 TCATTGTCACATTTGCCTTAAGG + Intergenic
1188436015 X:30159446-30159468 TCAGTGCCACATGTGGGGCCTGG - Intergenic
1188442764 X:30229476-30229498 TCATTGCAACCTGTGCCTCAGGG - Intergenic
1188467848 X:30502915-30502937 TCATTGCCTTCTGCGGCTCATGG - Intergenic
1188471992 X:30551467-30551489 TCCAGGCCACATGTGGCCCACGG - Intergenic
1188993345 X:36851673-36851695 TCATTGGCTCAATTGGCTCATGG + Intergenic
1189387905 X:40552321-40552343 TGATAGCCACATGTGGCTAGTGG + Intergenic
1189999050 X:46667456-46667478 ATATAGCCACATGTGGCTAATGG - Intronic
1190236699 X:48621798-48621820 TCATTGCCACCTCTGCCTCTCGG + Intergenic
1190477327 X:50841033-50841055 TCTTTGTCCAATGTGGCTCAGGG + Intergenic
1191235635 X:58131605-58131627 ACAATGCCAGATGTTGCTCAGGG - Intergenic
1192386362 X:70675702-70675724 TCATTGCAACATCTGCCTCCTGG + Intronic
1192455798 X:71274329-71274351 TCACTGCAACCTGTGGCTCCTGG - Intergenic
1192837364 X:74815423-74815445 TCATTGTCACATTTGGGTTAAGG + Intronic
1192902003 X:75509425-75509447 TAATAGCCACATGTGGCTAGTGG + Intronic
1193119898 X:77812515-77812537 TCACTGCAACATTTGCCTCATGG + Intergenic
1194647292 X:96473033-96473055 TCAGTGCCACATTTGGGACATGG + Intergenic
1194685662 X:96911071-96911093 TTATTGGCACATGTGTCTTAAGG + Intronic
1194751536 X:97690186-97690208 TCACTGCCACATGTGGCTATGGG + Intergenic
1195952413 X:110289204-110289226 AAATTGCCACATGTGGATAATGG - Intronic
1196112311 X:111960085-111960107 CAATAGCTACATGTGGCTCACGG + Intronic
1197424109 X:126273469-126273491 TGCTTGCCCCATGTGGCTCCTGG + Intergenic
1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG + Intergenic
1197951521 X:131902600-131902622 ACATAGCCACCTGTGGCTAATGG - Intergenic
1198672597 X:139097388-139097410 CCTGGGCCACATGTGGCTCATGG + Intronic
1199791913 X:151162728-151162750 AAATAGCCACATGTGGCTCCTGG - Intergenic
1200159768 X:154000430-154000452 TCCTTTTCACATGTGACTCATGG + Intergenic
1200523657 Y:4244501-4244523 AAATAGCTACATGTGGCTCATGG - Intergenic
1200750967 Y:6943829-6943851 TCATTGCCACAGCTGGCTAAGGG + Intronic
1200837556 Y:7748150-7748172 TGATAGCCACATATGGCTAATGG - Intergenic