ID: 920217683 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:204373028-204373050 |
| Sequence | CTGTAGTCCTAGCACTCAGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 8713 | |||
| Summary | {0: 3, 1: 30, 2: 170, 3: 1341, 4: 7169} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920217683_920217688 | -3 | Left | 920217683 | 1:204373028-204373050 | CCCCCTGAGTGCTAGGACTACAG | 0: 3 1: 30 2: 170 3: 1341 4: 7169 |
||
| Right | 920217688 | 1:204373048-204373070 | CAGGCATGTACCACCATGTCTGG | 0: 28 1: 1177 2: 13714 3: 44700 4: 99413 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920217683 | Original CRISPR | CTGTAGTCCTAGCACTCAGG GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||