ID: 920217683

View in Genome Browser
Species Human (GRCh38)
Location 1:204373028-204373050
Sequence CTGTAGTCCTAGCACTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8713
Summary {0: 3, 1: 30, 2: 170, 3: 1341, 4: 7169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920217683_920217688 -3 Left 920217683 1:204373028-204373050 CCCCCTGAGTGCTAGGACTACAG 0: 3
1: 30
2: 170
3: 1341
4: 7169
Right 920217688 1:204373048-204373070 CAGGCATGTACCACCATGTCTGG 0: 28
1: 1177
2: 13714
3: 44700
4: 99413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920217683 Original CRISPR CTGTAGTCCTAGCACTCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr