ID: 920222064

View in Genome Browser
Species Human (GRCh38)
Location 1:204411401-204411423
Sequence AAGAAAAAGGAGATGGAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1228
Summary {0: 1, 1: 0, 2: 6, 3: 117, 4: 1104}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920222064_920222071 2 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222071 1:204411426-204411448 CAGTCTCTCAGGTAGGGCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 135
920222064_920222077 27 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222077 1:204411451-204411473 CTCAGCGGCTGGAGGTCGACGGG 0: 1
1: 0
2: 0
3: 3
4: 94
920222064_920222073 16 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222073 1:204411440-204411462 GGGCCGCGGCGCTCAGCGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 230
920222064_920222075 19 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222075 1:204411443-204411465 CCGCGGCGCTCAGCGGCTGGAGG 0: 1
1: 0
2: 3
3: 8
4: 140
920222064_920222070 -4 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222070 1:204411420-204411442 TCTTGACAGTCTCTCAGGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
920222064_920222068 -9 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222068 1:204411415-204411437 CTTTTTCTTGACAGTCTCTCAGG 0: 1
1: 0
2: 3
3: 18
4: 317
920222064_920222076 26 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222076 1:204411450-204411472 GCTCAGCGGCTGGAGGTCGACGG 0: 1
1: 0
2: 0
3: 11
4: 119
920222064_920222069 -5 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222069 1:204411419-204411441 TTCTTGACAGTCTCTCAGGTAGG 0: 1
1: 0
2: 1
3: 15
4: 160
920222064_920222072 12 Left 920222064 1:204411401-204411423 CCCGGCTCCATCTCCTTTTTCTT 0: 1
1: 0
2: 6
3: 117
4: 1104
Right 920222072 1:204411436-204411458 GGTAGGGCCGCGGCGCTCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920222064 Original CRISPR AAGAAAAAGGAGATGGAGCC GGG (reversed) Exonic
900725655 1:4214816-4214838 AAAAAATAGCAGTTGGAGCCAGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901276896 1:7998852-7998874 AAGAAAAAGTAGAAGAGGCCAGG + Intergenic
901357252 1:8661682-8661704 AAGAAAAAGGACATCTGGCCTGG + Intronic
901369024 1:8780349-8780371 GAGAAAAAGGGGATGCAACCTGG + Intronic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901603578 1:10441607-10441629 AAAAAAAAAGAGTTGTAGCCAGG - Intronic
901749345 1:11396385-11396407 GAGAAAGAGGAGAGGGAGCTGGG + Intergenic
902142028 1:14365036-14365058 AAAAAAAAAGAGAGGGGGCCGGG - Intergenic
902315421 1:15615122-15615144 AATAAAAAGGAAATCAAGCCTGG + Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
903289446 1:22298716-22298738 AAGAAGAAGGCAGTGGAGCCAGG + Intergenic
903337172 1:22632947-22632969 AAGAAGAAGAAGATGGATACTGG + Intergenic
903394669 1:22990633-22990655 AAGAAAAAAAATATGCAGCCAGG + Intergenic
903748140 1:25602386-25602408 AAGACAAAGGGGATGCAGGCAGG - Intergenic
903783135 1:25835479-25835501 AAGAAAAAGGGGATTCTGCCAGG - Exonic
903834635 1:26195480-26195502 AAGAAAAAGAAAAAAGAGCCTGG - Intronic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
904288134 1:29466730-29466752 AAGCAAAGGGAGATGGGACCTGG - Intergenic
904501321 1:30914456-30914478 AGGAAAAAACAGAGGGAGCCTGG + Intergenic
904612647 1:31733831-31733853 GAAAAAAAGCAGATGGGGCCTGG + Intronic
904649012 1:31990225-31990247 AAGAAAAAAGAGAAGGATCTGGG - Intergenic
904662787 1:32097626-32097648 AAAAAAAAGAAGTTGGGGCCGGG - Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905064244 1:35166360-35166382 AAGAAAAAGGAAATTGTGGCTGG + Intergenic
905135326 1:35794867-35794889 AAAAAAAAGGAGAGGCAGCGGGG - Intergenic
905150396 1:35922548-35922570 AAGAAAAGGGAAAGGAAGCCAGG - Exonic
905303269 1:36999783-36999805 AAGAAATAGAAGATGGGGTCAGG - Intronic
905432567 1:37935201-37935223 AAAAAAAAAAAGATGGAGTCTGG + Intronic
905530506 1:38675042-38675064 AAGAAAAAGGAGCTGGGGATGGG + Intergenic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
905932963 1:41802549-41802571 AATAAAAAGGTGATGGAGGGTGG + Intronic
906243177 1:44254882-44254904 AAGAAATACTAGATGGAGCAAGG - Intronic
906334846 1:44920014-44920036 AAGAAAAAGGACATTCAGGCCGG - Intronic
906348548 1:45037094-45037116 AAAAAAAAGGAGGTGGGGCTGGG - Intronic
906648881 1:47496268-47496290 AAAAAAAAGGAGGGGGTGCCAGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907381191 1:54091704-54091726 AAGTAAAGGGGAATGGAGCCTGG - Intronic
907402757 1:54234773-54234795 AAAAAAAAAGAGATGGAGTCTGG + Intronic
907407404 1:54262118-54262140 AAGAAAATGGAAATGCAGTCAGG - Intronic
907579174 1:55556386-55556408 AAATAAAATAAGATGGAGCCTGG - Intergenic
907646829 1:56252721-56252743 GAGACAAAGAAGATGGGGCCTGG + Intergenic
907866294 1:58402497-58402519 AAGAAACAAGAGATGGAGGGAGG + Intronic
908767744 1:67569690-67569712 AAAAAAAAGGAGAGGGAGTGGGG + Intergenic
908909834 1:69060328-69060350 AAGAGAAAGGAGGGGGAACCAGG + Intergenic
908995046 1:70141246-70141268 AAAAATAAGGAAATGGAGCATGG + Intronic
909091911 1:71236586-71236608 AAGAGAAAGGAAAGGGAGACAGG - Intergenic
910272353 1:85410342-85410364 GAGAAAAAGGAAATGAGGCCGGG + Intronic
910368335 1:86489595-86489617 AAGAAACAGGAGAAGTAGCAGGG + Intronic
910536240 1:88300985-88301007 AAGAAAAAGGAGATAGGTCCTGG - Intergenic
910993290 1:93078092-93078114 TAAAAAAAGCAGATGCAGCCGGG - Intergenic
911034473 1:93526318-93526340 GATGAAAAGGAGATGGAGCCTGG - Intronic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912920034 1:113857671-113857693 AAGAAAAAGGAGAGGGAAATTGG - Intronic
912963073 1:114213332-114213354 AAGAAAATGAAGATGGAGACAGG + Intergenic
912980818 1:114369950-114369972 AAGAAAATGGAGAAGGCACCAGG + Intergenic
913425412 1:118723572-118723594 AAGAATAAGGAGATTGAACTGGG + Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
913978871 1:143489521-143489543 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
914073278 1:144315170-144315192 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
914105876 1:144651190-144651212 AAAAAAAAGGAGCAGCAGCCAGG + Intergenic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915231125 1:154446055-154446077 AAGACAAAGAAGATGGGGGCAGG - Intronic
915824309 1:159058536-159058558 AAGTAAAAGGCCATGGAGACAGG + Intergenic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916544630 1:165792110-165792132 AAGAAAAACCATATGGAGTCAGG - Intronic
916646583 1:166792599-166792621 CAGGAAAATGGGATGGAGCCAGG + Intergenic
916996374 1:170306028-170306050 AACAAACAGGAGAGGCAGCCTGG - Intergenic
917300765 1:173571442-173571464 ATGAAAGAGGTGAGGGAGCCAGG - Intronic
917542432 1:175927240-175927262 AAGAGAGAGGAGAAGGTGCCAGG + Intergenic
918160005 1:181889539-181889561 ATGAAAAGGGGGATGAAGCCAGG + Intergenic
918473925 1:184903566-184903588 AAGAGAGAGGAGAAGGTGCCAGG - Intronic
919236713 1:194855154-194855176 AAGAAAAAGGAAAAAGGGCCCGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919800089 1:201348608-201348630 AGGGAAAAGGACAGGGAGCCGGG + Intergenic
920015798 1:202907304-202907326 AAAATATAGGAGAGGGAGCCAGG + Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920368572 1:205462218-205462240 TAGAAAAAGGTGTGGGAGCCAGG - Intergenic
920613550 1:207466670-207466692 AAGACAAAGTGGATGGAACCTGG + Exonic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921149681 1:212390045-212390067 AAAAAAAACCAAATGGAGCCCGG + Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921493511 1:215808020-215808042 AAGAAATGGGATATGGAGCCAGG + Intronic
921815914 1:219563254-219563276 AGGGAAAGGGAGATGGAGCTGGG + Intergenic
922179178 1:223220261-223220283 AAGAGAAAGGGGAGGGGGCCAGG - Intergenic
922490818 1:226015022-226015044 TAGAAATATGAGATGCAGCCAGG - Intergenic
922976017 1:229784014-229784036 AAGAAAAATAAGATAAAGCCAGG - Intergenic
923127853 1:231047683-231047705 AAGAAAGAGGAGAGGGAGAAAGG - Intergenic
923160722 1:231312427-231312449 AAGAAAAAGAAGAGGGAGAGTGG + Intergenic
923218197 1:231869611-231869633 AAGAAAGAGGAGGAGGTGCCAGG + Intronic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
924359459 1:243221626-243221648 AAGAAAAAGAAAATGTAGCTAGG + Intronic
924430035 1:243988889-243988911 AAGAAAAAGAAAATGGATTCTGG - Intergenic
924617346 1:245623221-245623243 AAGGAAGAGGAGCTGGAGGCAGG - Intronic
924645663 1:245875195-245875217 AAGAGAATGGAGGTGGAGGCAGG - Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924735504 1:246752073-246752095 AAAAAAAAGGAGAATTAGCCGGG - Intronic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063147891 10:3312987-3313009 AAGGAGAGGGAGATGAAGCCAGG - Intergenic
1063549667 10:7018826-7018848 AAGAAAAAGTAGATTGAACATGG + Intergenic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1065038130 10:21661605-21661627 AATAAAAAGGAAATGGAGAAAGG - Intronic
1065300324 10:24315250-24315272 AAGAAAAGGAAGATGGAACTGGG + Intronic
1065664207 10:28040672-28040694 AAGAAAAATGAGATTGGGCTGGG - Intergenic
1065930043 10:30471329-30471351 AAAAAAAAGGAGTTTGGGCCGGG - Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1067909641 10:50332870-50332892 AAGACAGAGGAGGTGGAGGCAGG - Intronic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068521043 10:58077791-58077813 AAGAAAAAGAAGAAGAAGACAGG + Intergenic
1068755014 10:60643066-60643088 ATTAAAAATAAGATGGAGCCAGG - Intronic
1068858995 10:61827647-61827669 ACTAAAAAGGTGATGCAGCCTGG + Intergenic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1069871722 10:71537084-71537106 GGGAAAATGGAGATGGAGCTGGG - Intronic
1070331132 10:75418100-75418122 AAGAAGAGGGAGATGGAGAGTGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070390406 10:75965649-75965671 AAGAGAAAGGAAACTGAGCCGGG - Intronic
1070525497 10:77292634-77292656 AAGAGAAAGGAGCTGGGGCCTGG - Intronic
1070608059 10:77913496-77913518 AAGAAAAATGACATGCTGCCTGG + Intronic
1070673808 10:78398146-78398168 TAGAGAAAGGAGATGGAGACAGG + Intergenic
1070738191 10:78879683-78879705 AAGTAAAAAGATATGGAGACTGG + Intergenic
1071573934 10:86712283-86712305 AAAGAAAAGGAGGTGGATCCGGG + Intronic
1071591209 10:86875023-86875045 AAAAAAAAGAAAAAGGAGCCAGG - Intronic
1071597339 10:86937895-86937917 AGGAAAGAGCAGGTGGAGCCAGG + Intronic
1071936954 10:90542609-90542631 ACCAAATAGGAGATAGAGCCAGG + Intergenic
1071957940 10:90779446-90779468 AACAAAAAGCAGGTGGAGGCAGG - Intronic
1072457534 10:95589869-95589891 AAGAAAAATGAGATCTGGCCAGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072853200 10:98918992-98919014 AAGAAAAATAAGATACAGCCTGG + Intronic
1073302547 10:102479876-102479898 AGGAAAAGGGAGAAAGAGCCTGG + Exonic
1073337224 10:102718846-102718868 GAGAGAAAGGAGGTGGAGACAGG - Intronic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1074412341 10:113239210-113239232 AAGAAAAAACAGGTGGGGCCAGG - Intergenic
1075034010 10:119047319-119047341 AAGAAAAAGGAAGGGGTGCCAGG + Intronic
1075056975 10:119226271-119226293 AAGAAAAAGAAGAAGATGCCAGG - Intronic
1075382662 10:122031696-122031718 AAGAAAAAGGAGGCTGGGCCAGG - Intronic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075966964 10:126621300-126621322 AACAAAAAGGAGATGTAACTAGG - Intronic
1076082682 10:127597914-127597936 AAGAGAAGGGAGATAGAGTCTGG + Intergenic
1076265363 10:129105537-129105559 GAGAAAAATAAGATAGAGCCAGG + Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1077223615 11:1428089-1428111 AAGTGAAAGAAGATGGAGGCAGG + Intronic
1078226198 11:9393676-9393698 AAGAAAAAGGAAATTAGGCCTGG - Intronic
1078235654 11:9482263-9482285 AAAAAAAAAGAGTTGGGGCCGGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078848207 11:15140732-15140754 AAGAAAAATTAGATGGGGCATGG - Intronic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1079049737 11:17143641-17143663 AAAAAAAAGGGTATGGGGCCAGG + Intronic
1079196058 11:18328213-18328235 AAAAAAAAGAATATGGGGCCAGG + Intronic
1079250384 11:18782832-18782854 AATATATAGGAGATGGGGCCAGG + Intronic
1080487018 11:32719033-32719055 AAGAACAAGGAGATACAGCAAGG + Intronic
1080697493 11:34615507-34615529 AAGAAAAAGTAGAAGAGGCCAGG - Intergenic
1081057824 11:38431990-38432012 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1081568745 11:44276527-44276549 AAGAAAGAAGAGGTGGAGGCTGG + Intronic
1081780120 11:45704648-45704670 AAGAAAGAGGAGGTGGGACCTGG - Intergenic
1081959611 11:47125719-47125741 AAGAAAAAGGTAGTGGGGCCAGG + Intronic
1082048936 11:47754216-47754238 AAAAAAAAGGAGAGACAGCCAGG + Intronic
1082073757 11:47960725-47960747 AAAAAAAAAAAGATGGAGGCTGG - Intergenic
1082080350 11:48007951-48007973 AAGAACCAGGAACTGGAGCCAGG - Intronic
1082280433 11:50265954-50265976 AAGAAAGAAGAGACAGAGCCAGG + Intergenic
1082655966 11:55857320-55857342 AAGGAAAAGGACCTGGAGCCTGG - Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1083236721 11:61355693-61355715 AAAAAAAAAAAGATGGATCCCGG + Intronic
1083373793 11:62203401-62203423 CAGAAACAGGATATGAAGCCAGG - Intergenic
1083611859 11:64008179-64008201 AGGAGAAGGGAGAGGGAGCCAGG + Intronic
1083870143 11:65482292-65482314 AAGAAAAAGAAAAAGCAGCCTGG + Intergenic
1084563935 11:69919130-69919152 AAGAACAAGGAAGTGGGGCCTGG - Intergenic
1084584192 11:70046776-70046798 AAGAAAAAGGACATTAAGCTGGG + Intergenic
1084887618 11:72221335-72221357 AGGAAAAAGGAGATTGAGGTAGG + Intronic
1085228430 11:74943795-74943817 CAGAAAAAAGAAATGTAGCCTGG - Intronic
1085540438 11:77262870-77262892 AAAAAAAAGGAGCTGGGGCTAGG + Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086384726 11:86295487-86295509 GAGAAAAAGAAGATGAAGACAGG + Intergenic
1086578698 11:88371022-88371044 AAGAAAAAGAACTTGGAGGCAGG - Intergenic
1086610842 11:88753877-88753899 AAGAAAAAAGAGCTTGAGCAGGG + Intronic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1087330976 11:96779493-96779515 AAGAAAAATGATATGGATCTAGG + Intergenic
1087478217 11:98664787-98664809 AAGGAAAAGGAGTTGCAGCCGGG - Intergenic
1087633965 11:100682523-100682545 AGGAAAAAGGAGAGGGAGAGAGG - Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1087973609 11:104516604-104516626 AAGAAAAAGAAGATGGAGAAAGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088188771 11:107204291-107204313 AAGAAGAAGAAGATAGTGCCAGG + Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088698276 11:112388988-112389010 AAGCAAAAGAAGAAGCAGCCTGG - Intergenic
1088759364 11:112914622-112914644 AAGGAAAAGGACATGGGGCAGGG + Intergenic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089185070 11:116609416-116609438 AAGAAAACTGAGATCCAGCCGGG + Intergenic
1089348100 11:117804553-117804575 AAGAAAAAAGATACGTAGCCTGG - Intronic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089702327 11:120252970-120252992 GGGAAAAAGGAGGGGGAGCCTGG + Intronic
1089784834 11:120900578-120900600 GAGGAAAAAGAGCTGGAGCCGGG + Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090004005 11:122984355-122984377 AAGAAAAGAGAGATGGAGGGAGG + Intergenic
1090441601 11:126729346-126729368 AAGAAACAGGAAGTGGAGCCTGG + Intronic
1090657420 11:128856584-128856606 AAGGAAAAGAAGATGGTGCTAGG - Intronic
1091106091 11:132921049-132921071 AAGAAAAAAGTGATGAAGCAAGG - Intronic
1091474405 12:757740-757762 AAGAAAACATTGATGGAGCCGGG + Intronic
1091494034 12:956840-956862 AAGAATATGGAAATGGGGCCAGG - Intronic
1091893561 12:4082633-4082655 TAGAAAATGGATATGGGGCCAGG - Intergenic
1092517490 12:9230601-9230623 AGGAAAAAAGAAATGAAGCCTGG - Intergenic
1092690167 12:11099872-11099894 AAGAAAAAGTAGATGGGGAATGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1092871247 12:12807659-12807681 AAAAAAAAGGAGGGGGGGCCAGG + Intronic
1092996470 12:13955856-13955878 AAGATCAAGAAGATGCAGCCTGG + Intronic
1093090692 12:14917106-14917128 AGGAAAAGGGAGATGGGGCTAGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094181188 12:27594101-27594123 AAGAAAAAGTAGGTGGGACCGGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094535100 12:31314196-31314218 AAGAAAAATCAGATCCAGCCTGG + Intronic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1095292649 12:40493184-40493206 AAGAATAAGGTGAGGGTGCCAGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096101580 12:48973242-48973264 AAGAAAAAGGATAAGGACACTGG - Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096648526 12:53050653-53050675 AAGAGAGAGGAGAGGGAGTCAGG + Intronic
1096676563 12:53229575-53229597 AAGGAAAAGGAGAGGGACCCTGG - Intronic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097619493 12:61922761-61922783 ATGGAAAGGGAGATGAAGCCAGG + Intronic
1097655426 12:62355969-62355991 AAGAAAAAGGGGGTGGGGGCAGG - Intronic
1097682038 12:62658069-62658091 AAAAAAAATGAGGTGGGGCCAGG + Intronic
1098045538 12:66396813-66396835 AAGAGAAAGGAGATTTGGCCAGG + Intronic
1098150906 12:67545352-67545374 AAGAGACAGGAGATGGAGACAGG - Intergenic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098783970 12:74725445-74725467 AAAATAAAGGTGATTGAGCCAGG + Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099263122 12:80409075-80409097 ATGATAAAGCAGCTGGAGCCAGG - Intronic
1099403496 12:82229389-82229411 ATGAAATAAGAGATGGAGGCAGG - Intronic
1099445134 12:82743145-82743167 ATGAAAAAGCAGATGTAGCTGGG + Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1100269727 12:93013541-93013563 AAGAAAATGAAGATGGGGCCAGG + Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100593910 12:96055359-96055381 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1100675993 12:96868713-96868735 TAGAAAAGTAAGATGGAGCCAGG + Intronic
1100692973 12:97058568-97058590 AATATCAAGGAGATGGAGCCAGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101352531 12:103945293-103945315 AATAAAAAAGAGACGGAGTCTGG - Intronic
1101746502 12:107545536-107545558 AATAAAAAGAAGAAGTAGCCTGG - Intronic
1101965626 12:109280045-109280067 TAGAAAAAGGGCATGGGGCCGGG + Intronic
1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG + Intronic
1102101350 12:110281273-110281295 AAGGAAAAGGAGGTGGCGTCGGG - Intronic
1102114909 12:110395583-110395605 AAAAAAAAGAAGATGAGGCCAGG - Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1102647598 12:114413992-114414014 AAAAAAAAAAAAATGGAGCCGGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102771049 12:115476695-115476717 AAGTAAAAGGTGGTGAAGCCAGG - Intergenic
1102776719 12:115526123-115526145 GAGAAAAAGAAGATAGAGACAGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103205727 12:119127430-119127452 AGGAAAAGGGAGGAGGAGCCAGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103616328 12:122155185-122155207 AAAAAAAAAGAGAAGAAGCCAGG - Intergenic
1103659980 12:122506447-122506469 TAGAAAATGGGGATGGAGGCTGG + Intronic
1103686515 12:122736285-122736307 AAGAAAAAGGAGCTTGTGCAGGG - Intergenic
1104337235 12:127910793-127910815 AAGGTAAATGAGATGGAGACAGG - Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1106120755 13:26858436-26858458 CAGAAAATGGAGCTGGAGCAGGG + Intergenic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106286538 13:28322900-28322922 AAGAAAGAAAAAATGGAGCCAGG - Exonic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106815372 13:33401669-33401691 GAGAAAATGGAGAGGGAGCTGGG - Intergenic
1107182775 13:37481194-37481216 AAGAAAAAGGAGATGTAAATGGG - Intergenic
1107364145 13:39651842-39651864 ATTAAAAAAGATATGGAGCCGGG - Intergenic
1107827975 13:44347432-44347454 AAAAAAAAGGAGGTAGAGCCTGG + Intergenic
1107908251 13:45081992-45082014 AAAAAAAAGGAGAGACAGCCGGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108068718 13:46605549-46605571 AAGAAAAATGAGGTGGAGGAAGG - Intronic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1109179386 13:59195631-59195653 AATAAAAAAGAGGTGGAACCTGG + Intergenic
1109189865 13:59311083-59311105 AAAAAAAAGGAGAGAGAGCATGG - Intergenic
1109658745 13:65430182-65430204 AAGAATAAGGTGCTGGTGCCTGG - Intergenic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110193579 13:72759802-72759824 AAGAAAAAGAAGATGAAGCTTGG - Exonic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110541954 13:76716236-76716258 AAGAAAAAGGATAAGGAACAGGG + Intergenic
1110718996 13:78740189-78740211 AAGAAAAAGGAGATGCATAGAGG + Intergenic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1111252130 13:85615418-85615440 AAAAAAAAGAAGATGGAGGAAGG - Intergenic
1111457152 13:88499728-88499750 AAAAAAAAGAAGGTGGGGCCGGG + Intergenic
1111697848 13:91647774-91647796 AAGAAAATTGAGAGGGAGCCAGG - Intronic
1112198221 13:97247290-97247312 AAGAAAAAGCACTTGAAGCCTGG + Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112878266 13:104073331-104073353 AAGAAGGTGGAGATGGAGACTGG - Intergenic
1112890144 13:104219658-104219680 AAAAAACAGGAAATGGAGGCTGG + Intergenic
1113225930 13:108159520-108159542 AAAAAAGAGGAGATGAGGCCGGG + Intergenic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113855833 13:113445025-113445047 GAGAAGAAGGAGCTGGAGCTGGG - Intronic
1113929802 13:113962105-113962127 ATTAAAAAAGAGATGGAGGCTGG + Intergenic
1114282930 14:21211363-21211385 AAGAAAAAGGTGGTGGAGGGGGG - Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114980894 14:28162648-28162670 AAAGAAAATGAGACGGAGCCAGG + Intergenic
1115394848 14:32896886-32896908 AACAAAAAGGAGACAGAACCAGG - Intergenic
1115395014 14:32898738-32898760 AAGAAAAAGGAAATGGAAAAGGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116251524 14:42489663-42489685 AAGAAAAAGCAGATGAAATCTGG - Intergenic
1116615302 14:47128983-47129005 AAGAAATAGTTGATGGAGGCTGG - Intronic
1116859446 14:49981974-49981996 AAGAGAAACGAGATTGGGCCGGG - Exonic
1116881851 14:50178450-50178472 AAGAAAAAGAAGACTGAGACTGG - Intronic
1116930911 14:50689486-50689508 AAGAGAAGTGAGATGGAACCTGG + Intergenic
1117871724 14:60208028-60208050 AAGAAAGAGGTGATGGAGTGTGG + Intergenic
1118125685 14:62901148-62901170 ATGAAAAAAGTGATGGAGGCTGG - Intronic
1118379166 14:65203890-65203912 AAGAAAAAGAAAATGCAGCACGG - Intergenic
1118850859 14:69582298-69582320 AAGAAAAAGGAGGGGGGGCTAGG - Intergenic
1119220439 14:72901964-72901986 AAGATAGAGGAAATGGAGCAGGG + Intergenic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119529465 14:75349572-75349594 AAGGAAAAGGAAATGGAGGTTGG - Intergenic
1119600607 14:75973844-75973866 AAAAGAAGGGAGATGGGGCCGGG + Intronic
1119843729 14:77812883-77812905 AATAAAAAGAATATGCAGCCGGG - Intronic
1120171205 14:81248479-81248501 AAAAAAAAAGAATTGGAGCCAGG - Intergenic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120658798 14:87228525-87228547 AAGTAAAAGGCAATGCAGCCTGG + Intergenic
1120753267 14:88218016-88218038 AAAAAAAAGAAAATCGAGCCGGG - Intronic
1120873315 14:89357309-89357331 TAAAAAAAGGAGATAGAGCAGGG + Intronic
1120941447 14:89954372-89954394 GAGAGAAAGGAGATGGAACTTGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121065498 14:90960140-90960162 AAGAAAAGTGAGACGGAGCAAGG + Intronic
1121276652 14:92672418-92672440 AAGAAAAAGAAAATAGAGACTGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121433984 14:93906764-93906786 AAGGAAAAGGAGCCGGAGTCTGG + Intergenic
1121652597 14:95570409-95570431 TAGAAAAAAGAAATGAAGCCTGG - Intergenic
1121659360 14:95623502-95623524 CAGAAAAAGCAGATGGTGCAGGG + Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121761876 14:96452619-96452641 AAGAAAAAGTTGATGCAGCCAGG - Intronic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122457161 14:101863309-101863331 AAAAAAAAAGACATGGAGTCTGG + Intronic
1122574252 14:102731824-102731846 GAGAAAAGGGAGCTGGAGCCAGG - Intergenic
1122618014 14:103034515-103034537 AAGAAAAGGGAGGTAGAGGCTGG + Intronic
1122624333 14:103076433-103076455 AAGAAAAAAAAAAAGGAGCCAGG - Intergenic
1123431532 15:20221466-20221488 AAGAAAAAGGGTATTGAGACTGG + Intergenic
1123432768 15:20232548-20232570 AAGAAATAGTAAATGGAGCTGGG - Intergenic
1123478858 15:20612741-20612763 ATTAAAAAGGAAATGCAGCCGGG + Intergenic
1123639155 15:22387644-22387666 ATTAAAAAGGAAATGCAGCCGGG - Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124358599 15:29017664-29017686 AAAGAAAAGAAGATGGTGCCGGG - Intronic
1125184795 15:36917944-36917966 AAGAGAAAGGAGATGAACCAGGG - Intronic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1126259305 15:46669226-46669248 AAACAAAAGGAGCTGGAGCAAGG + Intergenic
1126618503 15:50612298-50612320 AAGAAAGAAGAAATGCAGCCTGG - Intronic
1126666529 15:51080539-51080561 AAGAAACAGGAGATGGACACAGG - Intronic
1126985333 15:54300265-54300287 AAGTCAAAGGGGATGAAGCCTGG + Exonic
1127087384 15:55437110-55437132 AAGAACAAGGTAATAGAGCCAGG - Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127125152 15:55804221-55804243 AAGAACGAGGAGTTGCAGCCAGG - Intergenic
1127679965 15:61284682-61284704 GAGAAAAAGAGGTTGGAGCCGGG + Intergenic
1128251416 15:66166593-66166615 GGGAACAAGGAGATGCAGCCAGG - Intronic
1128521058 15:68375248-68375270 CAGAAAAGGAAAATGGAGCCAGG - Intronic
1128762440 15:70226497-70226519 AAGAAAAAAAATATGCAGCCAGG + Intergenic
1128832343 15:70781001-70781023 AAGAAAAAGAAGATGCATCGGGG - Intergenic
1129376545 15:75137334-75137356 GAGAAAATGGAGATGGACGCAGG - Intergenic
1129761741 15:78132712-78132734 AAAAAACAGGAGATGAGGCCGGG - Intronic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1129859427 15:78848754-78848776 AACAAAAATGGGAAGGAGCCAGG - Intronic
1129947761 15:79556102-79556124 CAGAAAAAGGACATGAATCCAGG - Intergenic
1130136753 15:81187975-81187997 AGGGAAGAGGAGATGGAGCAGGG + Intronic
1130914395 15:88293446-88293468 AAGAAAGAGGAGATGGATGCAGG + Intergenic
1131000993 15:88940051-88940073 AAGAAAACAGAGAAGGCGCCAGG + Intergenic
1131666971 15:94581084-94581106 AGGGAAAAAGAGATGGAGACAGG + Intergenic
1131735127 15:95323841-95323863 ACTAAACAGGAGATGGAGTCAGG - Intergenic
1131901056 15:97088472-97088494 AAGAAAAACAAGAGGGAGGCAGG - Intergenic
1132078857 15:98847416-98847438 AAGGAAAAGGCTTTGGAGCCAGG + Intronic
1132085258 15:98903317-98903339 AGGAAAAAGTAGATGGAGGGTGG + Intronic
1132092419 15:98957134-98957156 ATCAAAGAGGAGATGGAGCCTGG + Exonic
1132740140 16:1408113-1408135 AACAAAAAAAAGATGGACCCTGG + Intronic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133234104 16:4379745-4379767 AAGAAACAGTAGACGAAGCCGGG + Intronic
1133333286 16:4989640-4989662 AAAGAAAAGGCAATGGAGCCGGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1133692395 16:8229384-8229406 AAGAAAAAGAGGACGCAGCCTGG + Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134120494 16:11580752-11580774 AAGAAAAAGGAATAGGGGCCTGG - Intronic
1134475533 16:14570352-14570374 AAGAAAAAGGAAAGAGGGCCGGG + Intronic
1134615890 16:15650680-15650702 AGGAGAAAGAGGATGGAGCCTGG - Intronic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135153580 16:20032192-20032214 AAGATGAAGAAGATGGAGCAGGG + Exonic
1135342435 16:21660690-21660712 AATAAAAACAAGATGGAGGCTGG - Intergenic
1135525931 16:23213545-23213567 AATGAAAAGGAGAGGGGGCCAGG - Intronic
1135928438 16:26715594-26715616 AAGAAAAAAGAGATAAATCCAGG + Intergenic
1136345068 16:29669881-29669903 AAAAAAAAGGAGATAGAGCAAGG + Exonic
1136698491 16:32108973-32108995 AAGAAAAATGGCATGAAGCCGGG + Intergenic
1136798995 16:33052270-33052292 AAGAAAAATGGCATGAAGCCGGG + Intergenic
1136851862 16:33618568-33618590 AAGAAATAGTAAATGGAGCTGGG + Intergenic
1137423090 16:48352870-48352892 AAGAAATAGGAGACGGAATCAGG - Exonic
1137508095 16:49074088-49074110 AAGAAAAAAAAAATTGAGCCAGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137677341 16:50310228-50310250 GAGAACTGGGAGATGGAGCCGGG + Intronic
1137809199 16:51336597-51336619 AAGAAAATGGAGATGGTGATGGG - Intergenic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1138156702 16:54712325-54712347 AGGAAAAAGGAGTCGGAGCCTGG + Intergenic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1138686934 16:58734109-58734131 AGGGAAACGGAGATGGAGCCAGG - Intronic
1139108916 16:63864641-63864663 ACAAAAAAGGAGATGCAGGCCGG + Intergenic
1139122130 16:64033299-64033321 AATAAAAAGGAGATGGACATGGG + Intergenic
1139267064 16:65649812-65649834 AAGTAAAGAGAGATGCAGCCTGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1140351972 16:74271111-74271133 CAGAAAGAGGAGCTGGACCCTGG + Intergenic
1140789733 16:78379942-78379964 AAGAAAACGGAGATTGAATCTGG + Intronic
1140858836 16:79001649-79001671 AAAAAAAAGGAGCTGGTGGCAGG + Intronic
1140943412 16:79745214-79745236 ACTAAATAGGAGATGGTGCCTGG - Intergenic
1141019305 16:80479975-80479997 AAGAAAAAGAAGAGGGAGATTGG + Intergenic
1141108788 16:81255076-81255098 AAGAAACAGGACCTGGGGCCAGG - Intronic
1141193813 16:81844287-81844309 AAGAAAAATGAAAAGGTGCCCGG - Intronic
1141198943 16:81882627-81882649 AAGAAAGAGGAGTAGGAGCGAGG - Intronic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1203113464 16_KI270728v1_random:1467053-1467075 AAGAAATAGTAAATGGAGCTGGG + Intergenic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142757912 17:2026216-2026238 AAGAAAAAGCGGATGGACCAAGG + Intergenic
1142871464 17:2823826-2823848 AAGAAACAGCACATGGGGCCGGG + Intronic
1142995320 17:3756698-3756720 AACAAAAAGTAGCTGGGGCCAGG - Intronic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143211048 17:5187873-5187895 AAAAAAAAGGAAATCCAGCCTGG - Intronic
1143280485 17:5750656-5750678 AAGAAGAAGTCAATGGAGCCAGG - Intergenic
1143297758 17:5883880-5883902 AAGCAGGAGGAGATGGAGGCGGG - Intronic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1143686888 17:8524485-8524507 AAAAAAAAGGATATGGAGAGGGG + Intronic
1143924786 17:10359970-10359992 AAGAAGAAGGAGACACAGCCAGG - Exonic
1143997560 17:11020717-11020739 AGGAAGATTGAGATGGAGCCTGG + Intergenic
1144003612 17:11078793-11078815 AAGTAAAAGGATAAGGAGCATGG + Intergenic
1144300959 17:13922784-13922806 ATGAGAAAAGAGATGGAGTCTGG - Intergenic
1144411066 17:15002297-15002319 AAGAAAGAGGTGAAGGAGCAGGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144991824 17:19238163-19238185 AACAAAAGGCAGCTGGAGCCTGG - Intronic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1146588265 17:34102012-34102034 AAAAAAAAGTAGATACAGCCAGG + Intronic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147163367 17:38580230-38580252 AGGAAAGAGGAGATTCAGCCAGG + Intronic
1147189612 17:38730858-38730880 CAGAAACAGGAAATGGAGCTAGG + Intronic
1147193570 17:38750282-38750304 AAGAATAAGTGGATGGACCCCGG - Exonic
1147606500 17:41776709-41776731 AACAAAAAGGTGAGGGGGCCAGG + Intronic
1147866312 17:43555077-43555099 AAGAGAGAGGAGTCGGAGCCTGG - Intronic
1147879254 17:43643392-43643414 AAGAAAAAGGAGAAGGTCCAGGG + Intronic
1148433200 17:47659744-47659766 AAGAAACAGGATATATAGCCAGG + Intronic
1148567932 17:48644806-48644828 AAAAAAAAGAAGTTGGAGGCAGG + Intergenic
1148611740 17:48969220-48969242 AAGAAAAAAGAAAGGGGGCCGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149024381 17:52009297-52009319 AACAAAAATTAGATGGATCCTGG - Intronic
1149239196 17:54629217-54629239 AAGAAAAAAAAGAGGGAGCAGGG - Intergenic
1149444226 17:56701130-56701152 AAGAAATCGGAGGCGGAGCCAGG + Intergenic
1149465964 17:56879331-56879353 AAGAAAAAAGAGAGTGAGGCTGG + Intergenic
1149493607 17:57102623-57102645 AAAAAAAAAGAGAGAGAGCCGGG - Intronic
1149627578 17:58090658-58090680 AGGACATAGGAGATGGAGCAGGG + Exonic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1150059240 17:62050061-62050083 AAGGAAAGGGAGAGGAAGCCAGG + Intronic
1150151028 17:62808766-62808788 AAGAAATAAGCGATGAAGCCAGG + Intergenic
1150186968 17:63192229-63192251 AAGAAAAAGTAGATTTAGCAAGG + Intronic
1150513024 17:65776229-65776251 AAAAAAAAGGGGATGGGGGCGGG - Intronic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1151160126 17:72158314-72158336 AAGAAAGAGATGATGGAGGCTGG - Intergenic
1151430162 17:74056823-74056845 AAGAGAGAGGAGAGGGAGCCAGG - Intergenic
1151545136 17:74788258-74788280 AAGAAAAAAGGGATGGATTCCGG + Intronic
1152229749 17:79108537-79108559 ACGGCAAAGGAAATGGAGCCAGG + Intronic
1152435508 17:80273914-80273936 AAGAAAAGGAAGGTGGAGGCCGG - Intronic
1153298964 18:3576248-3576270 AAAAAAAAGGAGTTGGAGGGTGG - Intronic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153816046 18:8791133-8791155 AGGGAACAGGAGATGGGGCCTGG + Intronic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1156088321 18:33436172-33436194 AAGAGAAAGGAGTTGCAACCTGG + Intronic
1156216459 18:35003330-35003352 AAGAGAAAGGAGATAGATACTGG + Intronic
1156286835 18:35705038-35705060 ACGAAGAAGGAGAGAGAGCCAGG - Intronic
1156414346 18:36872045-36872067 AAGATAGAGGAGAAGGACCCAGG - Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1157100636 18:44725808-44725830 AAGAAAACGGAGTTGGAGGGGGG - Intronic
1157332554 18:46714316-46714338 AAGAAAAGGGAGTTGGAGTCGGG - Intronic
1157589879 18:48829935-48829957 ATCAAGAAGGAGCTGGAGCCTGG - Intronic
1157912571 18:51631315-51631337 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1157957576 18:52115300-52115322 AAGAAATAGGACATGGAGAGTGG + Intergenic
1157960045 18:52143328-52143350 AAAAAAACGGAGATGGAGATAGG - Intergenic
1158048564 18:53187415-53187437 TAAAAAAAGGAAATAGAGCCAGG - Intronic
1158302281 18:56065456-56065478 AAAAAAAAGGAGCTGGGGTCGGG - Intergenic
1158332328 18:56376258-56376280 AGGAAAAAGGAGAGGGAGAAAGG + Intergenic
1158353026 18:56583570-56583592 AGAAAAAAGGAGGTGGGGCCAGG + Intergenic
1158681344 18:59569924-59569946 AAGAAAAGGGAGCTGAGGCCGGG - Intronic
1158782772 18:60670624-60670646 AACAAAAAGGAAGTGGAACCAGG + Intergenic
1158920031 18:62181706-62181728 AATAAAAAGGAGAAGGCGACTGG - Intronic
1159612988 18:70546931-70546953 AAGAAAAAGCAGGAAGAGCCTGG - Intergenic
1159678738 18:71320304-71320326 AATAAAAAGGAAATGGAACTGGG - Intergenic
1159885583 18:73901263-73901285 AAGAAAAAGCAAAAGGAGCTTGG - Intergenic
1159998872 18:74996465-74996487 TAGAAAAAGGAAATGAAGTCAGG + Intronic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160848328 19:1176929-1176951 AAAAAAAAGGAGATTTGGCCGGG - Intergenic
1161098348 19:2407093-2407115 AAGATAAATGATATCGAGCCGGG - Intronic
1161274130 19:3405896-3405918 AAGAAAAAGAAAAAGGGGCCGGG - Intronic
1161285261 19:3465101-3465123 AGGAACAGGGAGATAGAGCCAGG - Intronic
1161359537 19:3839759-3839781 AAGAAAAAGGAATAGGATCCAGG - Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161402105 19:4070993-4071015 TAAAAAATGGAGATGGGGCCAGG - Intergenic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161757753 19:6146799-6146821 AAAAAAAATAAGATGGGGCCAGG + Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161943012 19:7417709-7417731 ATGAAAAAGAAGATGGGGACAGG + Intronic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162055006 19:8057313-8057335 AATAATAATGAGCTGGAGCCAGG - Intronic
1162510186 19:11113274-11113296 AAGAGGTAGGCGATGGAGCCTGG - Exonic
1162849261 19:13417977-13417999 AAGGAAAAGAACATGGGGCCGGG - Intronic
1162922040 19:13908914-13908936 AAAGAAAGAGAGATGGAGCCGGG - Intronic
1162923023 19:13914627-13914649 AAAAAAAAGGCGATGAGGCCTGG - Intronic
1162992339 19:14311750-14311772 TAGAAATAGGAGTTGGAGCCAGG + Intergenic
1163578681 19:18125120-18125142 AAGAAAGGGCAGATGAAGCCAGG + Intronic
1163673249 19:18641612-18641634 AAGAAAAAAGAAAAAGAGCCGGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1164953331 19:32358143-32358165 AGAAAAAAGCAAATGGAGCCAGG - Intronic
1164970157 19:32525063-32525085 AAGAAACAAGAGATTGAGGCTGG + Intergenic
1165029012 19:32983920-32983942 AAGAAACAGTAAATGGAGCTGGG - Intronic
1165047830 19:33119704-33119726 AAAAAAAAGGGGCTGCAGCCAGG + Intronic
1165459056 19:35933553-35933575 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165459132 19:35934011-35934033 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165573722 19:36796576-36796598 AAAATAAAGGAAATGGGGCCGGG - Intergenic
1165632911 19:37316960-37316982 AAATAAAAGGAAATGGGGCCGGG - Intronic
1165632945 19:37317133-37317155 AAAATAAAGGAAATGTAGCCGGG - Intronic
1165685261 19:37814101-37814123 AGTAAAAATGAGTTGGAGCCAGG - Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166064989 19:40352481-40352503 AAGAGAGAGGAAATGGAGCAAGG - Intronic
1166073094 19:40397924-40397946 AAGAAGAAGAAGATGGTGCCTGG - Exonic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166094022 19:40528630-40528652 ACGAGAAAAGAGATGGAGCAAGG - Intronic
1166269955 19:41707741-41707763 AAGGAAGTGGAGGTGGAGCCTGG + Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166834381 19:45658264-45658286 AAAAAAAAGGAGAGAGAGACAGG - Intergenic
1166929573 19:46293870-46293892 AAAAAAAAAGAGATAGAGGCCGG + Intergenic
1167040031 19:47018704-47018726 AAGAAAAAGAAAATGGAGCAGGG - Intergenic
1167040094 19:47019014-47019036 AAGAAAATGGAGCTGGGGCCGGG - Intergenic
1167062117 19:47155735-47155757 AAAAAAAAGGGTATGGGGCCGGG - Intronic
1167100239 19:47400167-47400189 AAGAAAAAGAGGCTGGGGCCGGG + Intergenic
1167162121 19:47774909-47774931 AAAAAAATAGAGATGGAGCCAGG - Intergenic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167475385 19:49697607-49697629 AAGAAAAAGGAGGTGAGGCCGGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167752888 19:51391096-51391118 AAGAAGGAGGGGCTGGAGCCTGG - Intergenic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167922413 19:52792704-52792726 AATAAAAAGAGGATTGAGCCGGG - Intronic
1167981989 19:53283058-53283080 AAGAAAAAGAAGCTGGAAACTGG - Intergenic
1168281476 19:55308318-55308340 AAGAAAAATAAGTTGGAGCCAGG - Intronic
925378645 2:3407810-3407832 AAGAAAAAGAAAATGGAGGAGGG + Intronic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925850302 2:8075291-8075313 AAGAAAAGGAAGATGAGGCCGGG + Intergenic
926569648 2:14515697-14515719 AACAAAAATAACATGGAGCCAGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
926961116 2:18359486-18359508 AAGACAAGGGAGATGGAGTTTGG - Intronic
927387347 2:22550228-22550250 AAGGAAAAGGAGAGGGAGATAGG + Intergenic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
927537044 2:23871532-23871554 AAGAAAAAGGAGACAGAGTCAGG - Intronic
927553764 2:24018726-24018748 AAAAAAAAGGAGTTTGAGCATGG + Intronic
927671489 2:25072257-25072279 AAGAAATAAGGGCTGGAGCCAGG - Intronic
928580882 2:32706556-32706578 AACAAAAAGGCGAGGGAGCAGGG - Intronic
928628769 2:33169040-33169062 AATAAAAAGGAGTTGTAGTCGGG + Intronic
928689546 2:33785057-33785079 AAGCAAGAGGTGATGAAGCCTGG - Intergenic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
929950543 2:46406551-46406573 AGGATAAAGGAGATGGACCCAGG - Intergenic
930261987 2:49157683-49157705 AAGAAAAGGAAGTTGGAGTCAGG - Intergenic
930511111 2:52346616-52346638 GAGAAAACGGGGAGGGAGCCAGG - Intergenic
930804447 2:55476299-55476321 AAGAAAAAGACAATGTAGCCAGG - Intergenic
931067008 2:58598604-58598626 AAAAAAAAGGAAATGGAGATAGG - Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931415677 2:62078256-62078278 AAAAAAAAAAAGGTGGAGCCGGG + Intronic
931539462 2:63314170-63314192 AAAAAAAAGAAGATGGGGCCAGG - Intronic
932174571 2:69587906-69587928 AAGAAAAAAGAAATGAGGCCTGG - Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932452787 2:71826082-71826104 AATGATAAGGAGATGGGGCCAGG + Intergenic
932742905 2:74305696-74305718 AAGAAAAGGGAGTTGGAGGGAGG - Intronic
933291420 2:80442500-80442522 AACAAAAGCAAGATGGAGCCAGG - Intronic
933633600 2:84682940-84682962 AATGAAAGGGAGAGGGAGCCCGG - Intronic
933929947 2:87139913-87139935 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934001280 2:87715698-87715720 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934183596 2:89650602-89650624 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
934293879 2:91724774-91724796 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
934517697 2:94998972-94998994 AAGAAAAAGAAAATGGACCCTGG - Intergenic
934855843 2:97729376-97729398 AAGAGATAGGAGGGGGAGCCAGG - Intronic
935234386 2:101126175-101126197 GAGAGAGAGGAGATGGTGCCAGG + Intronic
935887588 2:107639582-107639604 AAGAAAAAGGTAATGGAGAGTGG - Intergenic
936362992 2:111823502-111823524 AAAAAAAAAGAGATGGAGAAAGG + Intronic
936395903 2:112129776-112129798 AAGAAAAAGAAAAAAGAGCCGGG + Intergenic
936401762 2:112169943-112169965 AAGAAAAGGAAGAAGGGGCCAGG + Intronic
936477392 2:112851246-112851268 AAGAAAATGGAGAAGGTGCCAGG + Intergenic
936597480 2:113862723-113862745 AAGAAAAAGTAAATAGGGCCAGG + Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
937677344 2:124606719-124606741 AAGAAAAAAGAGCTGGTGCAGGG + Intronic
938243034 2:129757742-129757764 AAAAAAAAGGAGGTTGAGCCGGG - Intergenic
938321850 2:130371291-130371313 AAGAATCCGGGGATGGAGCCGGG - Intronic
938573561 2:132584190-132584212 AAGAAAAGGGATGTGGATCCAGG + Intronic
938807183 2:134817263-134817285 AAAAAAAAGGAGTTGGGGCCGGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940413080 2:153388899-153388921 AAAAAAACTGAGATGGAGCCTGG + Intergenic
940505537 2:154548004-154548026 AAGAAAAAAGAGGTTTAGCCAGG - Intergenic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
941547533 2:166871161-166871183 AAGAAAGGGGAGATGGTGCCAGG - Intergenic
941759663 2:169227927-169227949 CAGTAATAGGAGATGGACCCTGG + Intronic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
942140123 2:172968920-172968942 AGCAAAAAGGGGATGGACCCAGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942516715 2:176761651-176761673 AGGAAAAAGGAGGTAGAGTCTGG - Intergenic
942588383 2:177511842-177511864 AATGAAAAGGAGATGGAGAAAGG - Intronic
943020420 2:182565943-182565965 AAGAAAAAGAAGAAAGAGACAGG + Intergenic
943262069 2:185678756-185678778 AAGAAAATGGAGAAGGCGCCAGG - Intergenic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943556237 2:189407801-189407823 AAAACAAAGGAAATGGAGCCTGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943583150 2:189708026-189708048 AATAGAAAGGAGAGGGACCCGGG + Intronic
943733973 2:191333524-191333546 AAGAAAAGGAAGAGAGAGCCTGG - Intronic
944097327 2:195983472-195983494 AAGAGAAAGGAGGGGGTGCCAGG + Intronic
944746061 2:202657777-202657799 AACAAAAAGCAGAAGGGGCCAGG - Intronic
944747396 2:202672206-202672228 AACAAAAAGGAGGGGGAGGCAGG - Intronic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
945169902 2:206984919-206984941 AAGATTGAGGAGATGGTGCCAGG - Intergenic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946801003 2:223415971-223415993 AAAAAAAAGAATATGGAACCTGG + Intergenic
946934815 2:224709040-224709062 AAGAAAAAGAAAAAGAAGCCAGG - Intergenic
946943817 2:224798623-224798645 AAAAAAAAAAAGATTGAGCCAGG - Intronic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948173016 2:235921001-235921023 AACTAAAAGAAGATGGAACCTGG - Intronic
948292896 2:236840616-236840638 AAGAAAGTGGAGTTGGAGCCTGG + Intergenic
948318813 2:237052687-237052709 AACAGAGAGGAGATGCAGCCTGG + Intergenic
1168841832 20:914691-914713 AAGGAAAGGGAGAGGGACCCAGG - Intronic
1168918130 20:1508333-1508355 AAGACAAAGGAGATGAATTCTGG + Intergenic
1168974644 20:1954943-1954965 AAAAAAAAGAAGAAGGGGCCAGG - Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169495755 20:6113369-6113391 AAGGAAAGGGAGAGGGAGCAAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169949618 20:11029021-11029043 AAGAAAAAGGAGAAAGGGCTGGG - Intronic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170577894 20:17678401-17678423 AAGAAAAAGGAGTGGGAGGGGGG - Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170767656 20:19304543-19304565 ATGTACAAGGAGGTGGAGCCAGG - Intronic
1170868100 20:20178179-20178201 AAACAAAAGGAGAGGGAACCTGG - Intronic
1171108814 20:22461738-22461760 AACAAATAGAAGTTGGAGCCTGG - Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1171990388 20:31691725-31691747 AATCAAAAGGAAATGGAGCAAGG + Intronic
1172129117 20:32644150-32644172 TAGAAAAAGGAGTTGTAGCCAGG + Intergenic
1172246033 20:33445513-33445535 AAGAAAAAAAAGAGGGGGCCAGG + Intergenic
1172329974 20:34068757-34068779 AATGAAAAGGAGGTAGAGCCAGG - Intronic
1172481966 20:35276706-35276728 AATGAACAGGAGATGGAGGCAGG + Exonic
1172488670 20:35316630-35316652 AAGAAAAAGGAAATGGACTCAGG - Intronic
1172546725 20:35767674-35767696 AAAAAAAAGGAGGGGGGGCCAGG - Intergenic
1172764433 20:37343805-37343827 AAGAACAAGGCGAGGTAGCCAGG + Intergenic
1172782081 20:37442861-37442883 AGGAAAAAGGACATGGGTCCTGG - Intergenic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1173198648 20:40937771-40937793 AAGAAAAGGAAGAAGGGGCCAGG + Intergenic
1173246773 20:41342560-41342582 AAGAACAAGGAGGTAGAGCTGGG + Intronic
1173390463 20:42627565-42627587 TAGAAACAGGACATGGGGCCAGG - Intronic
1173464517 20:43270398-43270420 AAGACAGAGGTGATGGAGACTGG - Intergenic
1173660373 20:44729199-44729221 AACAAAAAGTAGATGGAGGTGGG + Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173840178 20:46151962-46151984 ACGAAAAAGGAGCTTCAGCCTGG + Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174519247 20:51117015-51117037 AACATAAAGAAGGTGGAGCCTGG + Intergenic
1174541616 20:51293853-51293875 AGGATCAAGGACATGGAGCCTGG + Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174717719 20:52777685-52777707 TAGAAAATGGAGATAGAGCCAGG - Intergenic
1174832373 20:53824733-53824755 AAAAAAAAAGAGCTGGATCCAGG + Intergenic
1174930917 20:54813771-54813793 AAGAAAAAGGAAAACTAGCCAGG - Intergenic
1175004409 20:55666981-55667003 AAGAAAAAGTAGATAGAGCAAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1175316923 20:58055048-58055070 AAGGAAAAGGCGGGGGAGCCTGG - Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175733420 20:61369831-61369853 ACGAAAGAGGAGAAGGTGCCTGG + Intronic
1175925644 20:62470039-62470061 AAGAAAAACGAAATGCAGCCGGG - Intronic
1176443065 21:6794265-6794287 AAGAAAAAGAAAATTTAGCCAGG - Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176821230 21:13659307-13659329 AAGAAAAAGAAAATTTAGCCAGG - Intergenic
1176880879 21:14191661-14191683 AAGAGAAATGAGATGGATTCAGG - Intronic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177173215 21:17676642-17676664 AAGAGAAAAGAGCTGGACCCGGG + Intergenic
1177558440 21:22719939-22719961 AACAAACAGAAGATGGTGCCTGG + Intergenic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1178743186 21:35222675-35222697 CAGAAACAGGAAATGCAGCCAGG - Intronic
1178979041 21:37245441-37245463 AAGAACAAGCAGGTGGAGCAAGG - Intronic
1179538971 21:42071834-42071856 AAAAAAAAGGAGACCTAGCCTGG + Intronic
1179540187 21:42078880-42078902 AAGAAAGTGGAAATGGGGCCAGG - Intronic
1179547745 21:42124081-42124103 AAGAAGCAGGACCTGGAGCCAGG - Intronic
1179780507 21:43697219-43697241 AAGAAATAAAAGATGGGGCCGGG + Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180685239 22:17661071-17661093 AAGAAAAAAGAAATGGAGCCAGG - Intronic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181582853 22:23837529-23837551 AGGAAGATGGGGATGGAGCCAGG + Intronic
1182202282 22:28585983-28586005 AAAAAAAAGAAGAAGAAGCCGGG + Intronic
1182809775 22:33105875-33105897 ATGACAAAGGGGAAGGAGCCTGG + Intergenic
1182924667 22:34110990-34111012 AAAAAAAAGGAAATGGAGGAGGG + Intergenic
1182942007 22:34285876-34285898 AGGAAAAAGGAGAGGAAACCAGG - Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183224322 22:36538903-36538925 AATAAAAAGGAGATGGCTTCAGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183396138 22:37571894-37571916 AAGAACATGGACATGAAGCCGGG - Exonic
1183559634 22:38561351-38561373 AGGAAAAAAGAGATGGAGTCAGG - Intronic
1183573853 22:38674518-38674540 AAAAAAAAGTAACTGGAGCCTGG + Intergenic
1183772148 22:39936110-39936132 AAGTAAAAGAAAATGAAGCCTGG + Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184001157 22:41674620-41674642 AGGAGAAAGCTGATGGAGCCAGG - Exonic
1184113061 22:42406436-42406458 AAGTGGAAGGAGATGCAGCCAGG - Intronic
1184354634 22:43970869-43970891 AAGAAAGAAAAGATGGTGCCAGG + Intronic
1184472944 22:44706093-44706115 AAGAGAAAGGGGAGGGAGCCTGG - Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184777364 22:46630005-46630027 AAGAAAAAGAAAATGTGGCCTGG - Intronic
1184892181 22:47386923-47386945 AAGAAAAACGGGACAGAGCCAGG + Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949120220 3:375197-375219 ATGAAAAATGAAATGGAGCATGG + Intronic
949546839 3:5080053-5080075 AACAAAATGGGGATGGAGGCTGG - Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950078715 3:10206087-10206109 AAGAAAATGCAGAGGGAGCTGGG + Intronic
950197226 3:11017569-11017591 AAGAAACAAGAAATGGGGCCTGG - Intronic
950582625 3:13872501-13872523 AGGAAATAGGAGCTGGAGCCAGG - Intronic
950647278 3:14384606-14384628 AAGAAAAAGGAAGTGGAGAAAGG - Intergenic
950908209 3:16558360-16558382 AAGAAAAATAAAATGGAGCCAGG + Intergenic
951846307 3:27088381-27088403 AAGGAAAATGATATGGAGGCTGG + Intergenic
952043559 3:29289602-29289624 AATAAAAAGTAAATGGAACCCGG + Intronic
952113134 3:30147836-30147858 AAGAAAAAGGGGTTTGAGCTAGG + Intergenic
952478015 3:33731329-33731351 CAGGAAAAGGAGATACAGCCTGG + Intergenic
953035496 3:39207038-39207060 AAGAAAAGAGGGATGAAGCCAGG + Intergenic
953582750 3:44172070-44172092 ACGTGAAGGGAGATGGAGCCAGG - Intergenic
953804848 3:46059650-46059672 AAAAAAGAGGAAATGGTGCCTGG + Intergenic
953814505 3:46143541-46143563 AAGAAAGAAAAAATGGAGCCAGG - Intergenic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954165685 3:48755766-48755788 AAAAAAAAGGAAATGGGGGCTGG - Intronic
954198458 3:49010015-49010037 AAAAAAATAGAGATGGGGCCTGG - Intronic
954319642 3:49822990-49823012 AAAAAAAAGGAGGGGGAGCCAGG + Intergenic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955238084 3:57157380-57157402 AAGACAAAGGAGTAGGGGCCTGG - Intronic
955239878 3:57169012-57169034 TAAAAAGAGGAGATGGAGACTGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955446852 3:59021007-59021029 AAGCAAAAGAAGAGAGAGCCTGG - Intronic
955837251 3:63069788-63069810 AAAAAAAAAGATTTGGAGCCTGG + Intergenic
956093340 3:65691005-65691027 AAGAAAAAAGAGGTTCAGCCTGG + Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956665086 3:71634371-71634393 AAGAAAAAAAAAATAGAGCCTGG - Intergenic
957222388 3:77400798-77400820 AGGAAAACTGAGATAGAGCCTGG + Intronic
957268373 3:77997166-77997188 AAGAAAAAGGAAAGTGAGCTAGG - Intergenic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957751656 3:84426582-84426604 AAGAAAAATAGGATGGAGGCTGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
959197371 3:103201626-103201648 AAAAGAAAGGAAATGGAACCAGG - Intergenic
959393909 3:105811996-105812018 AAAAAAAAGGAAATGGGGCCAGG - Intronic
959610417 3:108288005-108288027 AAGAAAAAAGAAAAAGAGCCAGG - Intergenic
959688349 3:109171911-109171933 AAAAAAAAAGAGCTGGAGTCGGG - Intergenic
959791580 3:110368092-110368114 AAGAAAAAGATGATGGAGGTGGG - Intergenic
959972818 3:112426404-112426426 AAGAAAGAGGAGGAGGTGCCAGG + Intergenic
960125184 3:113990803-113990825 AAAAAAAAGGAAATGCAGGCTGG + Intronic
960203864 3:114871192-114871214 AAGAAAGGGGAGATGGGGCAGGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960813337 3:121647380-121647402 AGGAAGAAAGAGATGGAGTCAGG - Exonic
960942029 3:122941183-122941205 AAGGAAAATGAGCTGGAGACAGG + Intronic
961047156 3:123717229-123717251 AAGACAAAGGAGGTGGCTCCAGG + Intronic
961270791 3:125686389-125686411 AAGACAAAGGAGGTGGCTCCAGG - Intergenic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962390469 3:134967302-134967324 AAGGAAAAGGAAATAGAACCTGG + Intronic
962412668 3:135154860-135154882 AAGAAAAGGGAAATGGTGCCTGG + Intronic
962563951 3:136638116-136638138 AAAAAAAAGAAAATGCAGCCTGG - Intronic
962579587 3:136785736-136785758 AAGAAAAAAGAAATTGAGACAGG - Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962963443 3:140332316-140332338 AGGAAAAAAGAGATGAAGCTGGG + Intronic
963157039 3:142110206-142110228 AAGAAAAAAAAAATGCAGCCAGG + Intronic
963594751 3:147311865-147311887 TAGACAAAGCAAATGGAGCCTGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964724803 3:159803745-159803767 AAGAAAACAGAGAAGTAGCCAGG - Intronic
964813734 3:160694358-160694380 AAGGAATAGGAGATGGAGTGAGG + Intergenic
964856564 3:161151926-161151948 AAGAGCAAGAACATGGAGCCTGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
964953115 3:162322069-162322091 ATGAAAGAGGAGAGGGAGACAGG + Intergenic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965850738 3:173019997-173020019 AAAAAAAAGGAACTGGAGGCTGG + Intronic
965874958 3:173305606-173305628 AAAAAAATGAAGGTGGAGCCAGG - Intergenic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966454362 3:180098554-180098576 AAGAAGAAGGAAATGATGCCAGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966853157 3:184176780-184176802 AATAAACAGGAACTGGAGCCTGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966976279 3:185086178-185086200 AAAAAAAAAGAGATGGAGTGAGG - Intronic
967237750 3:187403556-187403578 AAGAACTAGGAGATGGTGTCAGG + Intergenic
967390724 3:188951460-188951482 AAGAAGAAGAACATGGAGACTGG + Intronic
968282827 3:197490058-197490080 CAGAAAAAGTAGAGGGAGCTGGG - Intergenic
968784706 4:2611567-2611589 AAGAAAATGCAGATTAAGCCGGG - Intronic
969240996 4:5897514-5897536 CAGAAAAAGGCAATGGAGCTAGG - Intergenic
969414632 4:7050439-7050461 GAGAAAAAGGAGCTGGTGCTGGG + Intronic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
970599004 4:17626242-17626264 AAGAAAAAGGAGATGTTGAATGG + Exonic
970674921 4:18438223-18438245 AAAAAAAAAAAGAAGGAGCCTGG - Intergenic
970781990 4:19748605-19748627 AAAAAGAAGGAGATGAAGCAAGG - Intergenic
971444128 4:26724195-26724217 TAGAAAAGGTAGATGGAGCTAGG + Intronic
971564731 4:28123366-28123388 AAAGAACAGGAAATGGAGCCTGG - Intergenic
971584256 4:28384875-28384897 AAGAACTAGGAAATGTAGCCAGG - Intronic
972346810 4:38199277-38199299 AAGAGAAAGGAAATGATGCCAGG + Intergenic
972634697 4:40872788-40872810 AAAAAAAAAAAGATGGCGCCGGG + Intronic
973641628 4:52908638-52908660 AAGAAAAGCAAGATGAAGCCAGG - Intronic
974687024 4:65243578-65243600 AATAAAAAGGCCATGGAGTCTGG - Intergenic
975619723 4:76284111-76284133 AAGAGAGAGGAGGAGGAGCCAGG - Intronic
975929731 4:79505285-79505307 AAAGAAAAGAAAATGGAGCCTGG + Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976210356 4:82662562-82662584 AAAAAAAAAAAGATGGGGCCGGG + Intronic
976418945 4:84815137-84815159 AAGTGAAAGGAGATGGAGATCGG + Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977063437 4:92284389-92284411 AAGAAAAAGAAAATGCAGCTAGG - Intergenic
977150922 4:93510317-93510339 AAGACAAAGAAGATGGAGATGGG + Intronic
977291635 4:95171132-95171154 AAGCAAAAGCAAATGGTGCCTGG + Intronic
978157786 4:105509372-105509394 AAGGAAAAGGAGAGGAAGACAGG + Intergenic
978206740 4:106089203-106089225 GAGAGAGAGGAGGTGGAGCCAGG + Intronic
978336179 4:107672063-107672085 AATAAAAATGAGATGGAGGTGGG + Intronic
978488480 4:109284127-109284149 AATAAAAAGGAAATGGGACCAGG + Intronic
978587448 4:110289146-110289168 AAGAAAAAAGGGATGGAACAGGG + Intergenic
979376026 4:119947895-119947917 AATGAAAAGGAGATAGAGACAGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979831557 4:125311673-125311695 AAAAAAAAGGAGAGGGAGAGAGG + Intergenic
979857588 4:125652339-125652361 AGGAATAGGGAGATGGAGACAGG - Intergenic
980474323 4:133291991-133292013 TAGAACAGGGAGATAGAGCCTGG + Intergenic
980652139 4:135731770-135731792 AGGAAAAAGCAAAAGGAGCCTGG - Intergenic
981001063 4:139829467-139829489 AAGGGGAAGGAGATGAAGCCAGG + Intronic
981034792 4:140158152-140158174 ATGAGAAATGAGATGGAGGCTGG + Intergenic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
981766000 4:148250922-148250944 AAGAAAAAGGTGATGGAGACTGG - Intronic
982155391 4:152515228-152515250 AAAAAAGAGGAGATGGAGACAGG - Intronic
982361880 4:154527370-154527392 AAGAAAAAGAAAATTAAGCCAGG + Intergenic
982495672 4:156088891-156088913 AAGAGAGAGGAGAAGGTGCCAGG - Intergenic
982495976 4:156092441-156092463 GAGAAAAAGGATATGGTGTCAGG + Intergenic
982934274 4:161451421-161451443 AGGAAAAATGAGAGGAAGCCAGG + Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983555308 4:169054269-169054291 AAAAATATGGAGATGTAGCCGGG - Intergenic
983622664 4:169776372-169776394 AAGAAAATGAAGTTGGGGCCAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985061251 4:186081697-186081719 AAGTACCAGGAGATGGATCCTGG + Intronic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
986541663 5:8851021-8851043 AAGAAAAATAAGAAGCAGCCCGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987229489 5:15878720-15878742 GAGAAAATGGAGACGCAGCCAGG + Intronic
988073938 5:26327552-26327574 AAGAGAGAGAATATGGAGCCAGG - Intergenic
988626403 5:32879881-32879903 AAAAAAAAAGAGACGGAGTCTGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988780984 5:34521745-34521767 ACGAGAGAGGAAATGGAGCCCGG + Intergenic
989244402 5:39237903-39237925 AAGAGAAAGGAGATTGAAACAGG - Intronic
989270755 5:39530116-39530138 TGGAAAAATAAGATGGAGCCAGG - Intergenic
989387637 5:40869124-40869146 AAAAAAAAGGAAATTTAGCCTGG - Intergenic
989433352 5:41381486-41381508 GAGAAAAAGGAGACAGAGACTGG + Intronic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
990362473 5:55034716-55034738 AAGAAAGAGAAGATGAAGGCCGG + Intergenic
991048779 5:62250475-62250497 AAGGAAAAGGATATTGAGACTGG + Intergenic
991325222 5:65424101-65424123 AAGAAAAAGTAGTCGCAGCCTGG - Intronic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
991399816 5:66240733-66240755 ATGACATAGGACATGGAGCCTGG + Intergenic
991522508 5:67516353-67516375 AAGAAAAAGGAAATGGTTCAGGG + Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
992381587 5:76242735-76242757 AAGAAAACGAAGATGATGCCAGG + Intronic
992495239 5:77286377-77286399 AGGAACCAGAAGATGGAGCCTGG - Intronic
992800913 5:80295194-80295216 AAGAAAGAAAAGATGGAGACTGG + Intergenic
993040972 5:82814379-82814401 GAGAAAATGGAGCTGGAGCTTGG - Intergenic
993072351 5:83181103-83181125 AAAAAAAAGGAAATGGAACAAGG - Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
993631726 5:90293936-90293958 AAGAAAAAGAAGTTTGAGGCTGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994111282 5:96007608-96007630 AAGAAGAGGAAGATGGGGCCGGG + Intergenic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994627107 5:102233553-102233575 AAAAAAAAGCTGAAGGAGCCTGG + Intergenic
995611004 5:113910269-113910291 AATTAAAAGGAGATTGAGGCTGG - Intergenic
995982050 5:118116171-118116193 AAGAAAAGAGAGATGGAGCGTGG + Intergenic
996737668 5:126772914-126772936 AAGAAAAAGAAAATGGGGGCCGG - Intergenic
996737760 5:126773534-126773556 AGGAAAATGGAAATGGAGCCGGG - Intergenic
997348928 5:133216284-133216306 AAGAACAGGAAGATGGAGCAGGG - Intronic
997650409 5:135513436-135513458 AAGAAAAAGGATATAGTGGCTGG - Intergenic
997940596 5:138153969-138153991 AAGAAAATGGTGATGGGGTCGGG - Intronic
998105026 5:139462933-139462955 AAGAGAATGGGGATGGGGCCAGG - Intergenic
998125284 5:139615489-139615511 AAAAAAAAGAAGATGGACACTGG + Intronic
998209051 5:140179957-140179979 AAGAAAAAAGAGAGTGAGGCTGG - Intronic
998858597 5:146420782-146420804 AATAAAAAAGAGACGGAGGCTGG + Intergenic
999145455 5:149390258-149390280 ACGGACAAAGAGATGGAGCCAGG - Intronic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
999821321 5:155231909-155231931 AAGCAAAAGGATATTGAGCTTGG - Intergenic
1000143857 5:158433742-158433764 AAGAGAAAGGAGAGGGAGAAAGG - Intergenic
1000231139 5:159316409-159316431 AAGAAAAGAGAGAGGTAGCCAGG - Intronic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001111187 5:168897618-168897640 AAGAGAAAGAGGATGGAGACAGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002201603 5:177531750-177531772 CAGAAAAACAAGTTGGAGCCCGG + Intronic
1002286015 5:178163211-178163233 AAGAAAAAGAAGAGTGAGCCTGG + Intergenic
1002470744 5:179434091-179434113 AAGAAATAGCACATGCAGCCGGG - Intergenic
1002510550 5:179713619-179713641 AAGAAAAAGTAAATGGAGCCAGG + Intronic
1003227083 6:4215725-4215747 AAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003423074 6:5975342-5975364 AAGAAAAAGCAGATTGAGCTGGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1003778313 6:9394604-9394626 GAGAAACAGGAGAGGGAGCATGG + Intergenic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1003926825 6:10884139-10884161 AAGTAAAAGGACAGGGAGCGTGG - Intronic
1004175026 6:13332233-13332255 AAGGAAATGGAGATGGAGTGAGG + Intergenic
1004685225 6:17936885-17936907 AAGGAAAAGGAGATTGGGCATGG + Intronic
1005207016 6:23416115-23416137 AAGAGAAAGATGATGGAGACTGG + Intergenic
1005352962 6:24954442-24954464 AAAAAAAAGGAGAGAGAGACTGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005670930 6:28105367-28105389 AAGATAAAGGACATGGAAGCGGG - Intergenic
1005679755 6:28194751-28194773 AAAAAAAAGTAAATGGGGCCAGG - Intergenic
1005741852 6:28799251-28799273 AAGAAAGAAGAGAGGGAGGCAGG + Intergenic
1005954335 6:30653200-30653222 AAGGAAAAGGAGCTGGTGTCAGG + Exonic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006113823 6:31764576-31764598 AAGAAACAGAAAAAGGAGCCTGG - Exonic
1006216420 6:32447265-32447287 AAGGATGAGTAGATGGAGCCTGG - Intergenic
1007308902 6:40929453-40929475 AAAAAAAAAGAGATGGAGTTTGG - Intergenic
1007627131 6:43252994-43253016 AGGGAAAAGGGGATGGAGCCAGG + Intronic
1007835996 6:44674192-44674214 AAGAAGGAGTAGATGGAGGCTGG + Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008202444 6:48607688-48607710 GAGAAAACTGAGATGGAGCAAGG + Intergenic
1008982002 6:57494691-57494713 AATAAAAAGGAGATGGAAAAAGG + Intronic
1009170069 6:60387533-60387555 AATAAAAAGGAGATGGAAAAAGG + Intergenic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009807116 6:68614158-68614180 AAGAAAAAGGGTGGGGAGCCTGG + Intergenic
1009890206 6:69671749-69671771 AAGACAAAGGGGCTGGGGCCAGG + Intergenic
1010028527 6:71246976-71246998 AAGAAAGAGAAGATGAAGCCAGG - Intergenic
1010272112 6:73926425-73926447 AGGAAAAAAGAGATGTGGCCGGG - Intergenic
1010435132 6:75820669-75820691 AAGCAAAAGGATATGGAGATTGG - Intronic
1011428201 6:87253636-87253658 ACTAAAAAGGAAAAGGAGCCTGG - Intronic
1011773445 6:90701304-90701326 AAGGAAACAGAGAGGGAGCCAGG + Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012061041 6:94481491-94481513 AAGAAAAAGGAGAGGAAGAAAGG - Intergenic
1013194684 6:107834648-107834670 AAGAAAAAGAATTTGGAGCCAGG + Intergenic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1014105118 6:117552539-117552561 AAGAAAAAGGTGGTAGAGCTAGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015121552 6:129706589-129706611 ATAAAAAAGGACATGGAGCCGGG + Intronic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015441370 6:133250664-133250686 AGGAAGAAGAATATGGAGCCAGG + Intronic
1015591597 6:134827967-134827989 AAGAATAAAGAGATGAATCCCGG + Intergenic
1015821172 6:137261756-137261778 ACTAAAAAGGATATAGAGCCAGG + Intergenic
1015944049 6:138482151-138482173 TAAAAAAAGAAGATGAAGCCGGG + Intronic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016702857 6:147073057-147073079 GGGAAAAAAGAGATGGAGACGGG + Intergenic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1016944397 6:149515156-149515178 AAGAAAAAAAAAATGGAGACCGG + Intronic
1017073277 6:150595681-150595703 TGGAAAAAGGAAATGTAGCCAGG - Intergenic
1017201428 6:151758776-151758798 AAGAAGAAGGAGAGGAAGCTGGG + Intronic
1017491808 6:154951878-154951900 AAGGAAAAGGAGAAGGACCACGG - Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018218936 6:161559589-161559611 AAGAAAAAGACTAGGGAGCCAGG - Intronic
1018461690 6:164004773-164004795 AAGAAAAAGAAGAGGGAGGGAGG + Intergenic
1018478469 6:164166874-164166896 AAGCAAAAGCAAAGGGAGCCGGG - Intergenic
1018666954 6:166147537-166147559 AAGAAACAGAAGATTGGGCCAGG - Intergenic
1019680579 7:2346450-2346472 AAAAAAAAGGTGAGGCAGCCAGG + Intronic
1019963783 7:4482914-4482936 AAAAAAAAGGAAATAGAGACAGG - Intergenic
1020005047 7:4778491-4778513 AAGAAACAGGACATGGAGTCTGG + Intronic
1020373257 7:7457633-7457655 TAGAAAAAAGAGATGGTCCCAGG + Intronic
1021167176 7:17355582-17355604 AAGAAAAAATAGAATGAGCCTGG + Intergenic
1021179359 7:17487990-17488012 AAGAAAGAGAAGATGGAATCTGG + Intergenic
1021225822 7:18025099-18025121 AAGAAAAAGAAGGTGGAGCAGGG - Intergenic
1021274146 7:18628254-18628276 AGGTAAAAGGAGATGAAGCCAGG - Intronic
1021939520 7:25665873-25665895 AAGCAAGAGGAGAATGAGCCAGG + Intergenic
1021986864 7:26105861-26105883 AAAAAAAAGAAGTTGGAGACTGG - Intergenic
1022432890 7:30344215-30344237 AAGAAACAAGAGCTGGGGCCGGG - Intronic
1022472735 7:30691693-30691715 AAGTTATAGGAGATGAAGCCAGG - Intronic
1022806685 7:33829572-33829594 AGGAAAAAGGAGAAGGAAACAGG - Intergenic
1022867798 7:34440690-34440712 AATAGAAGGGAGAGGGAGCCGGG + Intergenic
1023382388 7:39622557-39622579 AACAGAAAGGAGATGCAGCACGG - Intergenic
1023778483 7:43633832-43633854 AAGAAAGAGGAGAGGGAGGGTGG - Intronic
1023934192 7:44727526-44727548 AAGTAATAGGAGATGAAGGCAGG + Intergenic
1024263170 7:47587042-47587064 AGGGAACAGGAGAGGGAGCCTGG + Intergenic
1025157379 7:56620569-56620591 TGGGAAAAGGAGGTGGAGCCAGG + Intergenic
1025767354 7:64468035-64468057 ATTAAAAAGGAGATGGGGGCTGG + Intergenic
1025940693 7:66074678-66074700 AAGAAAAAAGAAACGCAGCCGGG - Intergenic
1026027951 7:66762292-66762314 TAGAAATAGGACATGGAGGCTGG + Intronic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026054492 7:66972668-66972690 AAGAAAAAGAATATGGGACCCGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026268187 7:68813553-68813575 AAAAAAAAAAAGGTGGAGCCGGG - Intergenic
1026523637 7:71136481-71136503 AAAAAAAAGAAGAGGAAGCCAGG - Intronic
1026524473 7:71142350-71142372 AGGAAGAAGGAAATGGAGTCTGG - Intronic
1026589827 7:71684958-71684980 AAAAAAAAGCAGGTGGTGCCAGG - Intronic
1026763134 7:73141589-73141611 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1027039599 7:74951371-74951393 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027084043 7:75251013-75251035 CAGAAAAAGGAAATTGGGCCAGG - Intergenic
1027342341 7:77222758-77222780 GAGAAACTGGAAATGGAGCCTGG - Intronic
1027424885 7:78052340-78052362 AAGAAAGAGGAGGGGGTGCCAGG - Intronic
1027575138 7:79922135-79922157 AACAAGCAGGAGAGGGAGCCTGG + Intergenic
1027634034 7:80646485-80646507 AAGAAAAGGGAGACGGACCGAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027904816 7:84165975-84165997 AAGAAAGATGAGATAGAGCCAGG + Intronic
1028101213 7:86823322-86823344 AAAAAAAAGGAGATGAATCTGGG - Intronic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029391616 7:100278779-100278801 CAGAAAAAGGAAATTGGGCCGGG - Intergenic
1029526124 7:101095077-101095099 AAAAAAAATGAGACTGAGCCAGG + Intergenic
1029658148 7:101941034-101941056 AAGGAAAAGGGCAGGGAGCCGGG + Intronic
1029736559 7:102468739-102468761 AAGAAAAAGGCCATGGGGCAGGG - Intronic
1030303697 7:107999749-107999771 AAAAAAAAGCAACTGGAGCCAGG - Intronic
1030788869 7:113698126-113698148 AAGAAAAAGAAGAAAGACCCAGG + Intergenic
1030900713 7:115120176-115120198 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1030921717 7:115397696-115397718 GAGAAAAAGGAGATTGAGGTTGG - Intergenic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031159440 7:118148710-118148732 AAGCAATAGGAGATGGAAGCTGG - Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031541961 7:123005665-123005687 AAGACAAATGAGAGGGAGCTGGG + Intergenic
1031589664 7:123574184-123574206 AAAAAAAAGGAGATGGAACCTGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032315510 7:130834918-130834940 ACAAAAAGTGAGATGGAGCCTGG - Intergenic
1032409621 7:131684924-131684946 AAAAAAAAAGAAATGGTGCCTGG + Intergenic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1032616703 7:133480364-133480386 AAGCAAAAAGAGATGAGGCCAGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033638337 7:143234765-143234787 AAGAAAAAGAGGTTTGAGCCGGG + Intergenic
1033662918 7:143415191-143415213 AAGAAAAAGGTAAGAGAGCCGGG + Intergenic
1034101261 7:148452476-148452498 AAGAAACAGGAGTTGGGGCAGGG - Intergenic
1034123618 7:148651210-148651232 AAGAAAAAGAAAAAGGAACCAGG + Intergenic
1034214837 7:149397535-149397557 AAGAGAGAGGAGGGGGAGCCTGG - Intergenic
1034345061 7:150380951-150380973 AAGCAAAGTGAGATGGAGCAGGG - Intronic
1034457330 7:151177950-151177972 ATGAAAAATAAGAAGGAGCCGGG + Intronic
1034632273 7:152539832-152539854 AAGAAAATGGAAATGGGGCTGGG + Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035174012 7:157037706-157037728 AGGAGAAAGGGGAGGGAGCCTGG + Intergenic
1035380791 7:158439438-158439460 AGGAAAAATGAGATGGAGACAGG + Intronic
1036562811 8:9911775-9911797 AAAAAAAAGGAGATGGAAAAAGG + Intergenic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037401686 8:18500503-18500525 AAGAAAGAGGTCATGGTGCCAGG - Intergenic
1037593749 8:20336231-20336253 AAAAAAAATGAGATCCAGCCGGG + Intergenic
1037800460 8:22031833-22031855 AAGAAAAAAGAAATGAAGACAGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1038277524 8:26134338-26134360 AAGAAAGAGGAGAGGGTGCAGGG - Intergenic
1038384312 8:27127501-27127523 ATTATAAAGCAGATGGAGCCGGG - Intergenic
1038559324 8:28557584-28557606 AAGAAAAAGGAAATGGATAAAGG - Intronic
1039444931 8:37623399-37623421 AATAAAAAGAAGAGGTAGCCAGG + Intergenic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041461347 8:58115181-58115203 AAGAAAAGGAAAATTGAGCCAGG - Intronic
1041514394 8:58684550-58684572 AAGACAAAGTAGATCCAGCCTGG + Intergenic
1042101256 8:65277976-65277998 AATAAAAAGCAGACCGAGCCAGG + Intergenic
1043827367 8:84945785-84945807 AAAAAAAAGTAGTTGGAGCCTGG - Intergenic
1044570436 8:93711928-93711950 AAGCAACAGGAGATGGAGTAAGG + Intronic
1045074012 8:98542502-98542524 AAAAAAAGAGAGATGGAGCAAGG + Intronic
1045179351 8:99763188-99763210 AAGAAAAAGTTAATGGAGCTAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045899572 8:107261408-107261430 AAGGAAAAGAACATGAAGCCGGG + Intronic
1045951073 8:107852351-107852373 CAGAAAAAGTATATGGAGCGAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046095966 8:109560887-109560909 AAGAAGAAGAAGATGCAGCCTGG + Exonic
1046547375 8:115668743-115668765 AAGAGAAAGGAAATAGAGCAAGG + Exonic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047035911 8:120938165-120938187 TTCAAAAAGGAGAAGGAGCCTGG + Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1047263076 8:123279775-123279797 AAAAAAAAGGAGGTGGAATCAGG - Intergenic
1047492731 8:125387816-125387838 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1048013526 8:130477734-130477756 AAGAAAAAAGAAATGTGGCCGGG - Intergenic
1048167350 8:132075209-132075231 ATGAAAAAGGAGACGGGGCAGGG + Intronic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1049034171 8:140061632-140061654 AAGGAAAAGGAGGTGTAGACAGG + Intronic
1049133054 8:140866329-140866351 AAGAGAATGGATGTGGAGCCAGG - Intronic
1049350675 8:142162877-142162899 AAGAGAGAGGAGATGGAGGATGG + Intergenic
1049539220 8:143199804-143199826 AAAAAAAAGGAATTTGAGCCAGG - Intergenic
1049788109 8:144460932-144460954 AGGAAAAAGGAGCTGGAGAGTGG + Intronic
1049810438 8:144566267-144566289 AAAATAAAGGAGCTAGAGCCAGG + Intronic
1049915284 9:311545-311567 AACAAAAAGGAGACTGGGCCAGG - Intronic
1050318434 9:4426714-4426736 AGCAAGAAAGAGATGGAGCCAGG - Intergenic
1050533686 9:6612435-6612457 AAAGAAAAGTAGATGGAGGCTGG + Intronic
1050574342 9:6977569-6977591 AAGTAAAATAAGATGGAGGCAGG - Intronic
1050843194 9:10179209-10179231 AAGAAAAAGAACTTTGAGCCAGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051233562 9:14976782-14976804 AAGAAAATGAAGCTGGGGCCAGG - Intergenic
1051660633 9:19423044-19423066 AAAAAAAAGTAAATGGAGCCAGG + Intronic
1051927484 9:22346698-22346720 AAGAAACTGGAGATAGAGCCTGG + Intergenic
1052323612 9:27194106-27194128 AAACAAAAGGATATGGAGCCTGG - Intronic
1052685692 9:31752678-31752700 AAAAAAAAAAAGATGGAGGCTGG - Intergenic
1052741123 9:32394047-32394069 AAGAAACAAGGGATGGAGCAAGG - Intronic
1052806761 9:33020139-33020161 AAAGAAAAGGAGTCGGAGCCAGG - Intronic
1052929375 9:34043787-34043809 AAAAAAAAAAAGTTGGAGCCTGG - Intronic
1053149797 9:35736195-35736217 AGGAAAAAGGAGATGAAGAAGGG - Intronic
1053252268 9:36584626-36584648 AAGAAAATAAAGATGGGGCCGGG - Intronic
1053257538 9:36630947-36630969 AAAAAAAAAGAGCTGGGGCCAGG - Intronic
1053379504 9:37636767-37636789 ATCAAAAAGCAGATGGGGCCCGG - Intronic
1053464536 9:38296096-38296118 AAGAAAAAAGACATGGAGAAGGG + Intergenic
1053545376 9:39017955-39017977 CAGAAAGAGGAGATGCAGCTGGG - Intergenic
1053796408 9:41730839-41730861 AAAATAAAGGAAATGGGGCCGGG - Intergenic
1054148772 9:61583990-61584012 AAAATAAAGGAAATGGGGCCGGG + Intergenic
1054184814 9:61942915-61942937 AAAATAAAGGAAATGGGGCCGGG - Intergenic
1054468535 9:65515119-65515141 AAAATAAAGGAAATGGGGCCGGG + Intergenic
1054653693 9:67645589-67645611 AAAATAAAGGAAATGGGGCCGGG + Intergenic
1054759950 9:68995507-68995529 ATGAAAAAGCAAATGGAGGCCGG + Intronic
1054950704 9:70848295-70848317 AAGATAAATGAGATGCAGCCAGG + Intronic
1055084558 9:72300788-72300810 GAGAAAAAGGACATGGGGCAAGG + Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056407813 9:86292615-86292637 AAAAAAAAAGAGATTGAGCCAGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1057242731 9:93426515-93426537 TAGAAACAGGACATGGAGGCAGG - Intergenic
1057834418 9:98432756-98432778 AGGATAGAGGAGATGGTGCCTGG - Intronic
1057948165 9:99348037-99348059 AAGAAAAAGGATTTGGGGCAGGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058851430 9:109014810-109014832 AAGAAAAAGAAGCTGAAGCTTGG - Intergenic
1059046816 9:110878088-110878110 AAGATAAAGGAGAGGAATCCAGG - Intronic
1059060490 9:111030876-111030898 AAGCAAAAGAAAATGGAGGCAGG + Intronic
1059410086 9:114126440-114126462 AAGAAAGAGGAGAGGGAGGGAGG - Intergenic
1059624000 9:116041194-116041216 AAGAAAAAGGAGACGGGGCAGGG + Intergenic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060347533 9:122829648-122829670 TAGAAAAAGGACATGGGGCCGGG + Intergenic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1062228272 9:135465990-135466012 GGGAGAAAGGAGATGGAGGCAGG + Intergenic
1062259921 9:135656370-135656392 ATGAAAGAGGAGATGGAGTTAGG + Intergenic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1062632630 9:137472288-137472310 AAAGAAAATGAGATGGAGGCTGG + Intronic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1203526137 Un_GL000213v1:90266-90288 AAGAAAAAGAAAATTTAGCCAGG + Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185661636 X:1733203-1733225 GAAAAAAAGGAGAGGGGGCCGGG + Intergenic
1185714486 X:2330225-2330247 AAAAAAAAGTAGAAGGGGCCAGG + Intronic
1186302252 X:8212786-8212808 AAAAAAAAAAAGATAGAGCCTGG + Intergenic
1186386297 X:9113611-9113633 AAGCGAATGGAGAGGGAGCCTGG - Intronic
1186490120 X:9965110-9965132 AAGAAATAGGAGATTGGGTCAGG + Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1186826208 X:13342333-13342355 AAGAAAAAGTAAAAGGATCCTGG - Intergenic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187118478 X:16379707-16379729 TAAAAAAAGCATATGGAGCCAGG + Intergenic
1187261016 X:17685364-17685386 AAGAAAAAGGTGATGATCCCTGG + Intronic
1187505174 X:19873751-19873773 AAGAAAAAAGAAATAGTGCCAGG + Intronic
1188033390 X:25289466-25289488 AAGAAAAATAAAATGGGGCCAGG - Intergenic
1188128778 X:26404189-26404211 ATGATAAAGGAGAAGGAGCAAGG + Intergenic
1188444607 X:30243067-30243089 AAGAAGAGAGAGCTGGAGCCCGG + Exonic
1189067384 X:37824807-37824829 AAGAAATAGGAGAGGGAGATTGG - Intronic
1189110821 X:38286846-38286868 GAGCAAAAGGAGAGGGAGCAGGG - Exonic
1189226307 X:39416190-39416212 AAGAAAAGGGAGATGGGGCAAGG - Intergenic
1189388419 X:40556245-40556267 AAGAAAGAGAAAAGGGAGCCAGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189799140 X:44675868-44675890 AAGACAAAGGTGATGGAGGAGGG - Intergenic
1190218728 X:48497014-48497036 AAGAAAATGGAGGTCCAGCCGGG + Intergenic
1190283720 X:48948400-48948422 AAGAGAAAGGAGCTGGAGTTTGG + Intronic
1190386826 X:49889952-49889974 GAGAAAGAGAAAATGGAGCCAGG + Intergenic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190863699 X:54367156-54367178 AAAAAAAAGGAAATCCAGCCTGG + Intergenic
1191786491 X:64922031-64922053 GAGAAAATAGAAATGGAGCCAGG + Intronic
1191862420 X:65676804-65676826 AAAAAAAAGGAAATGGATCATGG - Intronic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192497387 X:71625102-71625124 AAAAAAAAGGAGAATAAGCCAGG + Intergenic
1192581485 X:72286405-72286427 ATCAATAAGGAGATGGGGCCAGG - Intronic
1193216790 X:78874363-78874385 AAGAAAAAGCACGGGGAGCCAGG + Intergenic
1193319181 X:80099941-80099963 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1193909917 X:87291463-87291485 AAATAAATGGAGATGGAGACTGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194305919 X:92248191-92248213 AATAAACAAGAGATGGAACCAGG + Intronic
1194630911 X:96282359-96282381 AAGATAAAGTAAATGGAGCACGG + Intergenic
1195555995 X:106225025-106225047 AAGAAAAAGAAAAAAGAGCCTGG + Intergenic
1195643511 X:107203539-107203561 TTGAAAAGGGAGATGTAGCCAGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196008385 X:110859537-110859559 AAGCAAAAGATGATGGAGCTGGG + Intergenic
1196262737 X:113603808-113603830 AAGAAGAAGAATCTGGAGCCTGG - Intergenic
1196309646 X:114148586-114148608 AGGCAAAAGGAGATGGTGGCTGG + Intergenic
1196417203 X:115484081-115484103 AAGAAAAAGGAGAGGGGGAAGGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197743407 X:129913683-129913705 ATTAAAAACGAGATGGGGCCGGG + Intronic
1198077924 X:133212352-133212374 AAGAAAAAGAAAATCAAGCCGGG + Intergenic
1198697804 X:139362355-139362377 AGCAAACAGTAGATGGAGCCTGG - Intergenic
1199134530 X:144234810-144234832 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1199357476 X:146878588-146878610 AGAAATAAGGAGATGTAGCCAGG + Intergenic
1199858541 X:151779560-151779582 AGGGAAAAGGAGATGGGGGCAGG + Intergenic
1200150892 X:153950940-153950962 AAGAAGCAGGAGCTGCAGCCAGG - Exonic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201284546 Y:12368051-12368073 AAAAAAAAGAAGTTGGTGCCTGG + Intergenic
1201458890 Y:14201170-14201192 AAGAAAAAGGAAAGGGAGAGGGG + Intergenic