ID: 920225415

View in Genome Browser
Species Human (GRCh38)
Location 1:204434936-204434958
Sequence TCTTAAGGTCCCCTCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920225415_920225420 13 Left 920225415 1:204434936-204434958 CCCAGACTGAGGGGACCTTAAGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 920225420 1:204434972-204434994 ACATTTACAACTTCCCCAACTGG 0: 1
1: 0
2: 0
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920225415 Original CRISPR TCTTAAGGTCCCCTCAGTCT GGG (reversed) Intronic
900009839 1:96128-96150 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
900025951 1:272712-272734 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
900035735 1:406569-406591 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
900057357 1:642319-642341 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
900183574 1:1322891-1322913 TCTCAAGGTCACCTCAGCCAAGG - Exonic
901747606 1:11384847-11384869 TCTTAGATTCCCCTCAGCCTCGG - Intergenic
905151227 1:35929941-35929963 TCTTCAGTTCCCCTCACTGTGGG - Intergenic
912985780 1:114428945-114428967 TCTTAAGATCCCTTGAGCCTGGG - Intronic
914884762 1:151575826-151575848 CCTTCAGGGCCCCTCAGTCTTGG + Intronic
916533852 1:165684473-165684495 TCTTAGGGTACCCTCTTTCTAGG - Intronic
920225415 1:204434936-204434958 TCTTAAGGTCCCCTCAGTCTGGG - Intronic
920734865 1:208524219-208524241 TCTTAAGACCCCATCAATCTTGG + Intergenic
922258270 1:223912135-223912157 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
924339466 1:243014899-243014921 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
924584955 1:245354058-245354080 TCTGAGGGTCTCCTCAGCCTGGG + Intronic
1063275452 10:4562384-4562406 TTTCAATGTCCCCTCTGTCTTGG + Intergenic
1073758206 10:106603569-106603591 TCTTTAGGGCACCTCTGTCTAGG + Intronic
1074127988 10:110545199-110545221 TCTTGAGCTGCCCACAGTCTAGG - Intergenic
1075638305 10:124045681-124045703 TCTTAAGGTCTTCTAAGTCTGGG + Exonic
1078005243 11:7527559-7527581 TCTTAAGTTCCATTCAGTCAGGG - Intronic
1079477115 11:20842492-20842514 TCTCATGATGCCCTCAGTCTAGG - Intronic
1080167970 11:29262856-29262878 TCTAAAAGTACCCTCACTCTTGG - Intergenic
1083192442 11:61061963-61061985 TCTCAAGGTGCCCACAGTCCAGG + Intergenic
1083694193 11:64431726-64431748 TCTTAAGGACCTTCCAGTCTTGG + Intergenic
1083792345 11:64994180-64994202 TCCTAAGGTGTCCGCAGTCTAGG - Intronic
1090924415 11:131236852-131236874 TCTAAAGGTCCTCCCAGTCGAGG - Intergenic
1093181386 12:15971405-15971427 TCTGAAGGTCCATGCAGTCTTGG + Intronic
1093985627 12:25529080-25529102 TCTTCATGTCTCCTCAGTATTGG + Intronic
1095618552 12:44222202-44222224 CCTTCAGGTCCCCACAGTCCAGG + Intronic
1096776532 12:53967682-53967704 TTCTTATGTCCCCTCAGTCTGGG + Intergenic
1097185907 12:57196244-57196266 TCTTGAGGTCCTCACAGTCCTGG - Exonic
1104974413 12:132546058-132546080 TCTTCCGGTCCCCTCAGCCCTGG + Intronic
1107313779 13:39108990-39109012 CCTTGAGGACCCCTCAGTCAAGG + Intergenic
1110473870 13:75890384-75890406 ACTTGAGGCCCCCTGAGTCTGGG + Intergenic
1110494389 13:76149192-76149214 TCTAAAAATCCCCTCAGTCATGG - Intergenic
1119378255 14:74212237-74212259 TCTTGAGGAGCCCCCAGTCTGGG - Intergenic
1119923758 14:78472147-78472169 GCCTAAGTTCCCCTCAGTGTTGG + Intronic
1120149800 14:81020503-81020525 TCTTAAGGAACACGCAGTCTAGG - Intronic
1121045728 14:90786173-90786195 CCTTAAGGTTCCCTCGGTCCAGG + Exonic
1122814809 14:104307190-104307212 GCTCATGGTCCCTTCAGTCTGGG + Intergenic
1122865561 14:104602463-104602485 GCTTGAGGTCCCTTTAGTCTGGG - Intronic
1124945472 15:34261609-34261631 TCTTAAAGTCACCTAAGTTTAGG + Intronic
1130682808 15:86011119-86011141 TCTTAGGGACACCTCAATCTTGG - Intergenic
1134610372 16:15603720-15603742 TCTTAAGATTCTCTCAATCTTGG + Intronic
1134847170 16:17449753-17449775 CCTTAAGGTGCCATCAGTATGGG + Intronic
1138409119 16:56823910-56823932 TCTTAAGTTGTCCTCAGGCTAGG + Intronic
1139806673 16:69571621-69571643 ACTTAAATTCCCCTCACTCTGGG - Intronic
1142454490 16:90210777-90210799 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
1148402347 17:47376793-47376815 TCTTTAGTCCCCTTCAGTCTGGG + Intronic
1148822575 17:50368110-50368132 TTTGAAGGTGCCCTCAGGCTTGG + Exonic
1157237332 18:45977140-45977162 TCTTCAGATCCCCTGAGTCACGG + Intergenic
1162174830 19:8823171-8823193 TCCACAGGTCCCCTCAGCCTTGG + Intronic
1162411734 19:10510324-10510346 ACTTGGGGTCCCCCCAGTCTGGG + Intergenic
1165282218 19:34807222-34807244 TGTTCAGGTCACTTCAGTCTAGG - Intergenic
1165430035 19:35767244-35767266 TCTTCTGGGCCCCACAGTCTGGG + Intronic
1168147431 19:54427764-54427786 ACTTAAGGACGGCTCAGTCTTGG - Intronic
928076134 2:28266383-28266405 TCTTAACCTCCCCTCCATCTTGG + Intronic
939639995 2:144628664-144628686 TCTTCAGGTCCCCTAAGTGCAGG - Intergenic
947760440 2:232600080-232600102 TGTTAAGCTCCCCCCAGTCTCGG - Intergenic
948661901 2:239512489-239512511 TGTCAAGGTCACCTCAGGCTGGG - Intergenic
949085949 2:242155431-242155453 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171250126 20:23640298-23640320 TGATCAGGTCCTCTCAGTCTGGG - Intergenic
1175905322 20:62376719-62376741 TCTGCAGGTCCCCACAGCCTGGG - Intergenic
1176368156 21:6045972-6045994 TCTTCAGGTCCCCCCTGCCTCGG + Intergenic
1177707892 21:24733175-24733197 TCTCACGGCCCCCTTAGTCTTGG - Intergenic
1179755363 21:43492570-43492592 TCTTCAGGTCCCCCCTGCCTCGG - Intergenic
1180750616 22:18121848-18121870 CCTTGGGGTCCCCACAGTCTCGG + Intronic
1180801954 22:18636121-18636143 TCTTAAGGGGCACACAGTCTTGG - Intergenic
1180853189 22:19031662-19031684 TCTTAAGGGGCACGCAGTCTTGG - Intergenic
1181219766 22:21359140-21359162 TCTTAAGGGGCACGCAGTCTTGG + Intergenic
1182349731 22:29692571-29692593 TCTCAAGGCCCCCACAGCCTGGG + Intronic
1183958558 22:41397185-41397207 GCCTAGGGTCCCCTCAGTCTTGG + Exonic
950328990 3:12140989-12141011 TCTAAAGTTTTCCTCAGTCTGGG - Intronic
951816555 3:26761529-26761551 TCTTAAGGTCGGCTCCGGCTGGG + Intergenic
953960707 3:47263708-47263730 TCTGAAGGTCTCCTCCCTCTGGG + Intronic
955302247 3:57792513-57792535 TCTTTAGATCTCCTCAGTATTGG + Intronic
956226099 3:66960666-66960688 TCTTCAGTTTCCTTCAGTCTGGG + Intergenic
958734800 3:97996021-97996043 TCTTAAGAACCCTTTAGTCTGGG + Intronic
959295420 3:104529434-104529456 TCTTAATCTCTCCTCAGTCTAGG - Intergenic
966258726 3:177950038-177950060 CCTTCAGGTCCCCTCACTGTTGG + Intergenic
969964932 4:10984386-10984408 TATTTAGTTCCCCTCAGCCTTGG - Intergenic
971980750 4:33747111-33747133 TCTGAAGCTCCCATCAGCCTGGG - Intergenic
979237655 4:118420330-118420352 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
980531089 4:134055473-134055495 TCTTAAGGGCACCTAAATCTTGG + Intergenic
981899649 4:149847952-149847974 TGCTAAGATCCCCTCATTCTAGG + Intergenic
982740254 4:159050454-159050476 TCTTAAGGCTCTCTGAGTCTGGG - Intergenic
985478153 5:91435-91457 TCATAAGGTCCACTCCGTCCAGG - Intergenic
987025271 5:13920779-13920801 TTGGAAGGTCCCATCAGTCTGGG - Intronic
992206027 5:74430867-74430889 TCTTAAAGAGCTCTCAGTCTGGG - Intergenic
993658762 5:90604007-90604029 TCCTAATGTCTCCTCAGACTAGG - Intronic
995884712 5:116881380-116881402 ACTTAAGGTACCTTCAGCCTTGG + Intergenic
1000229291 5:159299925-159299947 TGTTTAGGTTCCCTCTGTCTAGG + Intergenic
1002738086 5:181412295-181412317 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
1005491563 6:26352228-26352250 TCTTTTGGTCCCCTAAGTCAGGG - Intergenic
1005875211 6:30006260-30006282 TCTCAATGTTCCCTGAGTCTTGG - Intergenic
1007632409 6:43279954-43279976 TGCTAGGGTCCCCTCAGCCTGGG - Intronic
1007716562 6:43859509-43859531 TCTCAAGGTCCCCTCTGGCAAGG + Intergenic
1007750453 6:44067851-44067873 TCTTAGGGTGCCCTCAGCCATGG - Intergenic
1012075857 6:94685013-94685035 ACTTTAGGCCCCATCAGTCTTGG + Intergenic
1012405805 6:98896457-98896479 TCTTATTGTCTCCTCATTCTTGG - Intronic
1013159625 6:107529496-107529518 TCGGAATTTCCCCTCAGTCTTGG + Intronic
1014678302 6:124396079-124396101 TCTCCAGGTGCCCTCAGTCCAGG + Intronic
1019243187 6:170687854-170687876 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
1021056033 7:16047504-16047526 TCTTATGGTCACCTCAGTAAAGG - Intergenic
1021420474 7:20440650-20440672 TGATAAGGACCCCTCAGTCATGG - Intergenic
1021519576 7:21525955-21525977 TCTTAAGTTGACCTCAGTCAAGG + Intergenic
1024756782 7:52542559-52542581 TCTGTCTGTCCCCTCAGTCTGGG + Intergenic
1029795232 7:102887617-102887639 TCTTCAGGAAACCTCAGTCTTGG + Intronic
1029850633 7:103457767-103457789 TCTTGAAGTCCCCTCAATTTTGG + Intergenic
1034932510 7:155173751-155173773 TGTTAAGTTCTCATCAGTCTAGG - Intergenic
1035504935 8:120309-120331 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic
1036057653 8:5276107-5276129 CCTTAAGGTTTTCTCAGTCTTGG + Intergenic
1043402018 8:79892864-79892886 TCTCAAGAGCTCCTCAGTCTCGG + Intergenic
1044266305 8:90185767-90185789 TCTTTATGTCCCCTCTGCCTAGG + Intergenic
1045850932 8:106697307-106697329 TCTTAAGCTCCCTTCTGTCAGGG - Intronic
1049463978 8:142742762-142742784 TCTTAAGGGTCCCCCAGGCTGGG - Intergenic
1057310085 9:93937299-93937321 TCTTCAGGCACCCTCAGTCCTGG - Intergenic
1059693159 9:116705916-116705938 CTTTAATGTCCCCTCATTCTGGG - Intronic
1203603376 Un_KI270748v1:37078-37100 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
1193736150 X:85159320-85159342 TGTTAATGCCCCCTCAGTATGGG - Intergenic
1199236305 X:145498259-145498281 ACTCAAGTTCCCCTCTGTCTAGG - Intergenic
1200986450 Y:9306616-9306638 TCCTAGGGACCCCCCAGTCTGGG - Intergenic
1202124129 Y:21554286-21554308 TCCTAGGGACCCCCCAGTCTGGG + Intergenic
1202154879 Y:21875094-21875116 TCCTAGGGACCCCCCAGTCTGGG - Intergenic
1202385442 Y:24322133-24322155 ACTGTGGGTCCCCTCAGTCTTGG - Intergenic
1202485344 Y:25347995-25348017 ACTGTGGGTCCCCTCAGTCTTGG + Intergenic