ID: 920225416

View in Genome Browser
Species Human (GRCh38)
Location 1:204434937-204434959
Sequence CTCTTAAGGTCCCCTCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920225416_920225420 12 Left 920225416 1:204434937-204434959 CCAGACTGAGGGGACCTTAAGAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 920225420 1:204434972-204434994 ACATTTACAACTTCCCCAACTGG 0: 1
1: 0
2: 0
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920225416 Original CRISPR CTCTTAAGGTCCCCTCAGTC TGG (reversed) Intronic
901218673 1:7569901-7569923 ATCGTCAGGTCCCCTTAGTCAGG + Intronic
902693514 1:18125351-18125373 CTCTTCATGTCCCCTGAGTCTGG + Intronic
904294264 1:29507542-29507564 CACTTGACGTCCCCTCTGTCAGG + Intergenic
905110839 1:35593379-35593401 CTTTTGAGGGCCCCACAGTCTGG + Intronic
913544112 1:119850071-119850093 CTCCTGTGGTCCCCTCTGTCTGG - Intergenic
919822883 1:201484044-201484066 GTCTTAAGGACCCCAAAGTCAGG - Exonic
920008563 1:202851271-202851293 TGCTTAAAGTCCCCTCAGCCAGG - Intergenic
920225416 1:204434937-204434959 CTCTTAAGGTCCCCTCAGTCTGG - Intronic
920615407 1:207487497-207487519 CTCTTAAGCTCCGTCCAGTCAGG - Intronic
921589400 1:216986006-216986028 ATCTTTAGGTCCCCTCACTACGG + Intronic
922268199 1:224008024-224008046 CTCTTTAGTTCCCCTGAGTTTGG - Intergenic
924584954 1:245354057-245354079 CTCTGAGGGTCTCCTCAGCCTGG + Intronic
1073839616 10:107483323-107483345 CATTCAAGGTCCCCTGAGTCTGG + Intergenic
1075638304 10:124045680-124045702 TTCTTAAGGTCTTCTAAGTCTGG + Exonic
1078005244 11:7527560-7527582 TTCTTAAGTTCCATTCAGTCAGG - Intronic
1078696001 11:13632439-13632461 CCCTTAAAATCCACTCAGTCAGG - Intergenic
1080735223 11:35007365-35007387 CTCCTCAGGTCCCCTCAATTAGG - Intronic
1086974642 11:93118045-93118067 CTCTTACTGCCCCCTCTGTCTGG + Intergenic
1087080949 11:94170644-94170666 CTGTTAGGGTCCTCTCATTCAGG + Intronic
1089507729 11:118975318-118975340 CTCTTAAACCCCCTTCAGTCAGG - Intronic
1101949867 12:109166390-109166412 CTCTTAAGGTGCTTTCAGTTGGG + Intronic
1102355481 12:112231271-112231293 CTATAAATGTCCCCTCAGCCAGG + Intronic
1104974537 12:132546502-132546524 CTCCTAGGGTCCCCCCGGTCTGG - Intronic
1104974553 12:132546548-132546570 CTCCTAGGGTCCCCCCGGTCTGG - Intronic
1106048687 13:26169436-26169458 CCATTAAGGTCCCCTCAGCTTGG + Intronic
1107439535 13:40413005-40413027 CTATAAAGGTCCCCACAGTCTGG + Intergenic
1110473869 13:75890383-75890405 CACTTGAGGCCCCCTGAGTCTGG + Intergenic
1113931010 13:113968916-113968938 CTCTGAAGGGCCCCACAGCCTGG + Intergenic
1119378256 14:74212238-74212260 CTCTTGAGGAGCCCCCAGTCTGG - Intergenic
1122468698 14:101951312-101951334 CTCTAAACCTCCCCTCATTCAGG - Intergenic
1122865562 14:104602464-104602486 CGCTTGAGGTCCCTTTAGTCTGG - Intronic
1124038093 15:26075079-26075101 CTCTTAAGGTTCCCTGAGGGAGG - Intergenic
1126833727 15:52637043-52637065 CTCTTAAGTTTCCCTTAGTAAGG - Intronic
1127106310 15:55620328-55620350 CTCATCAGGTCCCCACAGACAGG + Intronic
1129596515 15:76968555-76968577 CTCTGAAGGTGCCATCAGTGAGG + Intergenic
1133782752 16:8952553-8952575 CTTCTCAGGTCCCCTCACTCTGG + Intronic
1136589912 16:31212132-31212154 CACTTACGGTCCCCTCTGCCTGG - Intergenic
1141663761 16:85455223-85455245 CTCTGAAGCTCCACTCAGCCTGG + Intergenic
1149695628 17:58614036-58614058 CTCTCAAGGTCTCATCAGTTAGG - Intronic
1166001988 19:39883075-39883097 CTCTGAGGGTCCCCACAGCCTGG + Intronic
1166004772 19:39899326-39899348 CTCTGAGGGTCCCCACAGCCTGG + Intronic
934547249 2:95228081-95228103 CTCTTTAGTTTCCTTCAGTCTGG + Intronic
937623988 2:124023785-124023807 CTCCTTAGGTCACCTCAGCCTGG + Intergenic
939932099 2:148248156-148248178 TACTTAAGGTCCCGTCAGTACGG + Intronic
940071780 2:149696392-149696414 CTCTTGAGGTCCCAGCAGCCTGG + Intergenic
942037787 2:172027917-172027939 TTCTTTAGGTCTCTTCAGTCTGG - Intronic
946105094 2:217362214-217362236 CTCTTACTGTCCCATCAGCCTGG + Intronic
946219137 2:218211439-218211461 CTTTTGAGGTCGCCTCAGGCTGG - Intergenic
947738644 2:232474407-232474429 CTCTAAAGTTCCCCACAGTTTGG - Intergenic
948661902 2:239512490-239512512 CTGTCAAGGTCACCTCAGGCTGG - Intergenic
948754397 2:240150629-240150651 CTCTGGAGGTCCCCCCAGTTAGG + Intergenic
1169811371 20:9612268-9612290 CTCTTAATGTCGTCTCCGTCTGG + Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1171198702 20:23223991-23224013 CTCTTGGTGTCCCCTCAGCCTGG - Intergenic
1171250127 20:23640299-23640321 CTGATCAGGTCCTCTCAGTCTGG - Intergenic
1174371231 20:50089504-50089526 CTCTGAAGGTTCCACCAGTCAGG - Intronic
1175478048 20:59290795-59290817 CACTTAAGGTCCTCCCAATCAGG + Intergenic
1175905323 20:62376720-62376742 CTCTGCAGGTCCCCACAGCCTGG - Intergenic
1182290100 22:29269967-29269989 CTCTGAAGGCCCCCCCAGCCAGG - Intronic
1182349730 22:29692570-29692592 CTCTCAAGGCCCCCACAGCCTGG + Intronic
1184475354 22:44717675-44717697 CTCTTGAGGTCCGCTCAGGGAGG + Intronic
1184669595 22:46005742-46005764 CTCTTCAGTTTCCCTCAGTTAGG + Intergenic
949981048 3:9501851-9501873 CTCCCCAGGCCCCCTCAGTCTGG - Exonic
950328991 3:12140990-12141012 CTCTAAAGTTTTCCTCAGTCTGG - Intronic
952831822 3:37571475-37571497 CTCTTGTGGTCCCATCATTCAGG + Intronic
953960706 3:47263707-47263729 CTCTGAAGGTCTCCTCCCTCTGG + Intronic
954800892 3:53186392-53186414 CTCCTCAGCCCCCCTCAGTCAGG + Intronic
956226098 3:66960665-66960687 CTCTTCAGTTTCCTTCAGTCTGG + Intergenic
959934364 3:112013909-112013931 CTCTTAAGGACTCCACAGTCCGG + Intergenic
960635570 3:119781462-119781484 CTCTTCAGCTCCCCTCTGGCAGG + Intronic
962854031 3:139328509-139328531 CACTGAAGGCCCCCTCAGTCTGG + Intronic
971980751 4:33747112-33747134 CTCTGAAGCTCCCATCAGCCTGG - Intergenic
979130158 4:117034329-117034351 CCCTTAAGCTTCCCTTAGTCTGG - Intergenic
983094783 4:163549086-163549108 CTCTTCAGGTCCCCAAAGTGTGG + Intronic
984330409 4:178308260-178308282 CTTTCAAGGTCCTCTCAGCCAGG - Intergenic
989651015 5:43690398-43690420 GTCTTAAGTTCTCATCAGTCAGG + Intronic
990041483 5:51383026-51383048 CTCCTGGGGTCCCCGCAGTCCGG - Intergenic
991377745 5:65984162-65984184 CTCTTCGGGCCCCCTCAGTGAGG + Intronic
992206028 5:74430868-74430890 CTCTTAAAGAGCTCTCAGTCTGG - Intergenic
993207047 5:84895167-84895189 CTCTTAGGGTCCCCATATTCAGG - Intergenic
993882783 5:93382351-93382373 TTCTGAAGGTCCCCTGACTCTGG + Intergenic
997431546 5:133844393-133844415 CTCTTAGGGTCCCCTCAGCTGGG + Intergenic
997470355 5:134114046-134114068 CTGTGACGGGCCCCTCAGTCAGG - Intergenic
997698160 5:135877871-135877893 CTCTTCTGGTCCCCTCTGCCTGG - Intronic
1003476476 6:6488350-6488372 CTTTCAAGGTCACCTCAGGCTGG + Intergenic
1005491564 6:26352229-26352251 TTCTTTTGGTCCCCTAAGTCAGG - Intergenic
1006681245 6:35798122-35798144 CTCCTAAGGGCCCTTGAGTCAGG - Intergenic
1007481502 6:42153442-42153464 CTCTTGAGCTCCCCACAGTGAGG + Intergenic
1007940512 6:45776366-45776388 CCCTTAGGCTCCCCTCATTCTGG - Intergenic
1009371174 6:62905418-62905440 CTCTTGAGGTCCCCACATTGAGG + Intergenic
1010954092 6:82070676-82070698 CTCTTAAGTCCACTTCAGTCAGG - Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1026118882 7:67519226-67519248 TTCTTAGGATCCCCTCAGCCAGG - Intergenic
1028178649 7:87688066-87688088 CTCTTAAGGTCACCAGAGTTTGG + Intronic
1032202137 7:129829515-129829537 CTCTTAAGTCCCCTTCAGGCTGG + Intergenic
1039823498 8:41154290-41154312 CTCTTGAGGACCCACCAGTCCGG - Intergenic
1044365747 8:91343054-91343076 ATCTTTAGGTCACATCAGTCAGG - Intronic
1045850933 8:106697308-106697330 CTCTTAAGCTCCCTTCTGTCAGG - Intronic
1056807325 9:89738934-89738956 CTTTTGAGGTTCCCTCAGTGGGG + Intergenic
1060031489 9:120218342-120218364 CTCTGAGGGGCACCTCAGTCTGG + Intergenic
1061290386 9:129647416-129647438 CCCTTGAGGTCCCCTCAACCTGG + Intergenic
1185860035 X:3569248-3569270 CTCCTAAGGTCCAGTAAGTCAGG + Intergenic
1193337372 X:80306709-80306731 CTCTTGGGGTCCCCTGTGTCAGG - Intergenic
1193743256 X:85244038-85244060 CCCTTAAGGTCCTCACATTCGGG - Exonic
1195882946 X:109611630-109611652 CTCTTGAGGTCATCTCAGCCTGG - Intergenic
1198990300 X:142506314-142506336 CCCTTAAGGAGCACTCAGTCTGG + Intergenic