ID: 920226640

View in Genome Browser
Species Human (GRCh38)
Location 1:204443814-204443836
Sequence AAGGAGAAACAAGATGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 713}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920226640_920226644 -2 Left 920226640 1:204443814-204443836 CCCTCTGCATCTTGTTTCTCCTT 0: 1
1: 0
2: 6
3: 64
4: 713
Right 920226644 1:204443835-204443857 TTTCTATTTCTGCCATGTGTGGG 0: 2
1: 0
2: 2
3: 43
4: 479
920226640_920226645 4 Left 920226640 1:204443814-204443836 CCCTCTGCATCTTGTTTCTCCTT 0: 1
1: 0
2: 6
3: 64
4: 713
Right 920226645 1:204443841-204443863 TTTCTGCCATGTGTGGGTAGAGG 0: 2
1: 0
2: 0
3: 24
4: 253
920226640_920226643 -3 Left 920226640 1:204443814-204443836 CCCTCTGCATCTTGTTTCTCCTT 0: 1
1: 0
2: 6
3: 64
4: 713
Right 920226643 1:204443834-204443856 CTTTCTATTTCTGCCATGTGTGG 0: 2
1: 1
2: 47
3: 254
4: 1042
920226640_920226647 13 Left 920226640 1:204443814-204443836 CCCTCTGCATCTTGTTTCTCCTT 0: 1
1: 0
2: 6
3: 64
4: 713
Right 920226647 1:204443850-204443872 TGTGTGGGTAGAGGAGAGACAGG 0: 2
1: 0
2: 3
3: 63
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920226640 Original CRISPR AAGGAGAAACAAGATGCAGA GGG (reversed) Intronic
900317712 1:2067675-2067697 ATGGAGAAACAAGCGGGAGAGGG - Intronic
900835400 1:4999491-4999513 AAGGCGTAAAAAGATTCAGAAGG - Intergenic
901767184 1:11510227-11510249 AAGGGGAAACAAGAAGCATATGG - Intronic
902976808 1:20094451-20094473 AAGAACAAACAAGAAACAGATGG - Intergenic
903489246 1:23715384-23715406 AAGGACAAACTGAATGCAGAGGG - Intergenic
903770195 1:25758936-25758958 AAGGAGAGACAAGATTCTGCCGG + Intronic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905116903 1:35649427-35649449 AAGGAGATACTAGAAGCAAAAGG + Intergenic
905218320 1:36426138-36426160 AAGGAGAAAGAAAATTTAGAGGG + Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906180829 1:43817438-43817460 AAGAAGAAAGAAGAAGGAGAAGG - Intronic
906810280 1:48819687-48819709 GAGGAAAAACAAGCTCCAGAAGG + Intronic
907451620 1:54549146-54549168 CAGGGGAGACAAGATGCACAGGG - Intronic
908324469 1:63010043-63010065 AAAGAGAGAGAAGATGCAAAAGG - Intergenic
908558762 1:65284286-65284308 ATGGAGAAAGGAGATGCTGAGGG - Intronic
909088567 1:71197071-71197093 ATGGATAAAAAAGCTGCAGATGG - Intergenic
909296694 1:73958359-73958381 AAGGAGAAATATCATGCATATGG + Intergenic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909994500 1:82262368-82262390 AAGGAGAAAGATGAGGCAGAAGG - Intergenic
910163294 1:84297551-84297573 AAGGAGAAGGAAAAGGCAGATGG - Intergenic
910254795 1:85237241-85237263 AAGGAGAAAGAAGCCCCAGAGGG + Intergenic
910294194 1:85628134-85628156 AGGGAGAAAGAAGACGAAGAAGG + Intergenic
911445451 1:97986320-97986342 AAAGAGAGACAAAATGCTGAGGG - Intergenic
912189379 1:107319596-107319618 AAGGATAAGCCAGATGCAAATGG + Intronic
913359805 1:117967695-117967717 AAGAAGAAACCTGATACAGAAGG + Intronic
913415230 1:118598048-118598070 CAGGAGAAAGAAGATGAAAAGGG + Intergenic
914850190 1:151308446-151308468 AAGGAGAAAGAAAAAGCAGATGG + Intronic
915418814 1:155763437-155763459 GAGGAGGAAGAAGAAGCAGAAGG - Exonic
915623647 1:157101185-157101207 AAGATGAAACAATATGCAAAGGG + Intergenic
915985112 1:160456809-160456831 AAGGAAAAAGAAGATAGAGATGG - Intergenic
916040113 1:160954453-160954475 AAGGAAAAACAAGATGCACAAGG + Intronic
916060872 1:161098012-161098034 AAGGAGAAGCAAAAGTCAGAGGG - Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916478042 1:165188069-165188091 GAGGACAAACCAGAGGCAGAAGG - Intergenic
916616259 1:166444180-166444202 AAGGAGAAAGGAGAAGAAGAGGG + Intergenic
917191649 1:172424760-172424782 AAGAAAAAAAAAGAGGCAGAAGG - Intronic
917255711 1:173114097-173114119 AAGGAGATTGAAGATGAAGATGG - Intergenic
917410961 1:174759747-174759769 GAGGAGAAGCAAGATACAGAAGG + Intronic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917653146 1:177098606-177098628 AAGGAGAAACACTAAGCATATGG + Intronic
917996830 1:180448485-180448507 AAGGAAAAAGAAGAACCAGAGGG - Intronic
918528615 1:185492166-185492188 GAGGAAAAAAAAGATTCAGAGGG - Intergenic
918556272 1:185803015-185803037 AAAGAGAAAAAATATGCAGTAGG - Intronic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918990909 1:191696130-191696152 AGGTAGAAGCAAGATGGAGATGG - Intergenic
919514041 1:198499502-198499524 AGGGGGAAATAAGATGCAAAAGG + Intergenic
920057321 1:203202073-203202095 ATGGAGAGAAAAGTTGCAGAGGG + Intergenic
920226640 1:204443814-204443836 AAGGAGAAACAAGATGCAGAGGG - Intronic
920716335 1:208343806-208343828 AAGGAGGCACAGGATGGAGATGG - Intergenic
920932276 1:210400275-210400297 ACAGACAAACAAGATTCAGAGGG - Intronic
921003393 1:211067755-211067777 AAGAAGAAACAACGTCCAGAAGG + Intronic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
921760068 1:218902947-218902969 AAGAGGAAATAAGACGCAGAAGG - Intergenic
921946680 1:220890715-220890737 CAGGAGCATCAAGATGAAGAAGG - Intergenic
922011556 1:221594145-221594167 AAGGAAAAAGAAGATGCCGAGGG + Intergenic
922707969 1:227800370-227800392 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
922899700 1:229126791-229126813 GATGAGAAACAAAATGCATAAGG + Intergenic
922979881 1:229816740-229816762 GTGGACAAAGAAGATGCAGATGG + Intergenic
923042760 1:230331590-230331612 AAGAAGAAAGGAGATGAAGAAGG - Intronic
923714241 1:236411506-236411528 AAGAAGAAAGAAGAAGGAGAGGG - Intronic
923948707 1:238922804-238922826 AAGGAAAAGCAAAATACAGAGGG - Intergenic
924302132 1:242650547-242650569 AGGCAGTAACAATATGCAGATGG - Intergenic
924432884 1:244012168-244012190 AAGTAGAAAGAAGATGAATATGG - Intergenic
924600517 1:245484700-245484722 AAGAAGAAAGAAGAAGGAGAAGG - Intronic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1064001290 10:11665613-11665635 AAGAAGAAAGAAGAAGCAGAAGG - Intergenic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1065390824 10:25178894-25178916 TAGGATAAACCAGAGGCAGAAGG - Intronic
1066088443 10:31994123-31994145 AAGCAGGAACAAGAGGCTGAGGG + Intergenic
1066336116 10:34480219-34480241 AAGGAGAAGCAAGGTGCAGTAGG - Intronic
1066471598 10:35703013-35703035 AAGAAGGAAGAAAATGCAGATGG - Intergenic
1066514823 10:36146441-36146463 AGGGAGAAAAAATAAGCAGAAGG + Intergenic
1066553413 10:36584525-36584547 AAGGAGAAAGAAGAAAAAGAAGG - Intergenic
1068048003 10:51912262-51912284 AAGCAGGACCAAGTTGCAGAGGG + Intronic
1068453069 10:57218276-57218298 AAGAAGAAAGAAGAGGAAGAAGG + Intergenic
1069277893 10:66615460-66615482 AAGGAGACACAGGAAGGAGAAGG + Intronic
1069577219 10:69539420-69539442 AAGAAGAAAGAAGAAGAAGAAGG + Intergenic
1069582592 10:69575846-69575868 AAGGAGAAAGAAGAAGAAGGAGG - Intergenic
1070181856 10:74021868-74021890 AAGAAGAAAAAAGATGTAAAAGG - Intronic
1070523150 10:77271944-77271966 AAGGAGAAATAACCTGGAGAAGG - Intronic
1071903851 10:90151085-90151107 AAGGAAGAAAAAGAAGCAGAAGG + Intergenic
1072054963 10:91745735-91745757 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
1072066239 10:91874212-91874234 AAGAAAATAGAAGATGCAGATGG + Intergenic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072902161 10:99418223-99418245 CAGGAGAAACTAGATTAAGAGGG + Intronic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073409372 10:103327327-103327349 AAGAAAAAACAAGATGGAGAAGG + Intronic
1073689159 10:105788121-105788143 AAGGAGATAGAAGAAGGAGAAGG - Intergenic
1073808769 10:107129521-107129543 AGGGAGAAACCAGGTGGAGACGG + Intronic
1074577576 10:114684829-114684851 AAGGAAAAAGAGGAGGCAGAAGG - Intronic
1075273084 10:121069901-121069923 AAGGAGAATGAAGGTGCTGAGGG + Intergenic
1075327140 10:121542997-121543019 AAGCAGAATAAACATGCAGAAGG + Intronic
1075990708 10:126836407-126836429 AAGGAGCAAGGAGATGCTGATGG + Intergenic
1076004816 10:126940024-126940046 GAGGAGAAGCAAGAAGGAGAAGG + Intronic
1076211422 10:128648824-128648846 AAGAAGAAAGAAGAAGGAGAAGG - Intergenic
1076497919 10:130910362-130910384 GAAGAGCAACAGGATGCAGAAGG - Intergenic
1077759357 11:5074945-5074967 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1078453203 11:11455522-11455544 AAGAAGAACCAGGATGCAGGAGG + Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078508854 11:11970557-11970579 AAGGGGAAATTAGAGGCAGAGGG + Intronic
1078586087 11:12590488-12590510 AAGAAGAAACTAGATGCACTTGG + Intergenic
1078593351 11:12665127-12665149 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1078729084 11:13959679-13959701 AAGGAGAAAGAAGAAGGAGGAGG + Intergenic
1078887445 11:15518478-15518500 AAGGTGAAAGAAGACGAAGATGG + Intergenic
1079124120 11:17706780-17706802 AAGGGGAAAAAAGATACGGAGGG + Intergenic
1079430405 11:20384311-20384333 AAGGCAAAGGAAGATGCAGAAGG + Intergenic
1079484954 11:20926059-20926081 AAGGATAAACATGATTGAGAAGG + Intronic
1080016201 11:27509325-27509347 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1081559350 11:44198621-44198643 AATGAGAAACCAAATGCAGGTGG - Intronic
1082182433 11:49135847-49135869 CAGGAAAAAAAATATGCAGAAGG + Intergenic
1082232289 11:49782144-49782166 AAGGAGGGAAAAGATGCAGCTGG + Intergenic
1083525185 11:63357652-63357674 AAGAATAAACAAGATTCATAGGG - Intronic
1083735866 11:64680580-64680602 TGAGAAAAACAAGATGCAGAAGG - Intronic
1083738113 11:64693359-64693381 AACGAGAAAAACGATTCAGATGG + Intronic
1084297564 11:68222734-68222756 AAGGAAACACAGGAGGCAGAAGG - Intergenic
1084362517 11:68677941-68677963 TTGGAGAAAGAAGATGCAGGTGG + Intergenic
1084363094 11:68681825-68681847 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1085276059 11:75301195-75301217 AAGGACACACAAGGTGCAGAAGG + Intronic
1085820032 11:79782499-79782521 TAGGAAAAACAGGCTGCAGAGGG + Intergenic
1085959998 11:81450503-81450525 CAGGAGGAACAAGAGGGAGAGGG + Intergenic
1086427974 11:86705609-86705631 GAGGAGAAACATGTTGCAGAGGG - Intergenic
1086475729 11:87171078-87171100 TAGGAGAAACAATATGAAAAGGG + Intronic
1086618340 11:88851805-88851827 AAGGAGGGAAAAGATGCAGCTGG - Intronic
1086725220 11:90173965-90173987 TTGGAGAAACAAGAGGCAGAGGG - Intronic
1087003947 11:93450352-93450374 AAGGAAAAACAAAATGCCAAAGG + Intergenic
1087594734 11:100238429-100238451 AAGGAGAAAGAAGAAGGAGAAGG + Intronic
1088006728 11:104950043-104950065 AAGGAGATAGAAGATTGAGATGG - Intronic
1088030274 11:105240257-105240279 AAAGAGAAACAAGATGAGAAGGG + Intergenic
1088047606 11:105472763-105472785 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
1088219978 11:107559464-107559486 AACCAGAAACAAGCTTCAGAGGG + Intronic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088591692 11:111408903-111408925 AAGGAGACACAAGGTGCTGTGGG + Intronic
1089028710 11:115299707-115299729 AAGCAGAAGCAAGACGGAGATGG + Intronic
1089459056 11:118642133-118642155 AAGAAGAAAGAAGAGGAAGAAGG - Intronic
1089897960 11:121951043-121951065 AAGGAGAAAGAAGAGAAAGAAGG - Intergenic
1090096412 11:123746106-123746128 AAGTAGACACAAGTTGCAGTAGG + Intergenic
1090355501 11:126137831-126137853 GAGGTGAAACAGGATGCAGAGGG + Intergenic
1090464627 11:126923287-126923309 AAGGAGAAGGAAGAAGGAGAAGG - Intronic
1090464632 11:126923319-126923341 AAGGAGAAGGAAGAAGAAGAAGG - Intronic
1090464634 11:126923338-126923360 AAGGAGAAGGAAGAAGGAGAAGG - Intronic
1091039992 11:132268452-132268474 AAAATAAAACAAGATGCAGAAGG - Intronic
1091748500 12:3008299-3008321 GAGGAGAAACAGGAAGCACAAGG + Intronic
1092734130 12:11563742-11563764 AGGGAGAAACATGTTGCAAATGG - Intergenic
1092992774 12:13919246-13919268 AAGTATAAACTAGATTCAGAAGG - Intronic
1093145993 12:15567519-15567541 AAGTAAAAGCAAGAAGCAGAGGG - Intronic
1093622744 12:21311929-21311951 AAGAAGAAAGAAGAAGGAGAGGG + Intronic
1093630832 12:21407353-21407375 AAAGAGGAACAAGATGCAGTTGG + Intronic
1093632512 12:21426095-21426117 AAAGAGAGACAAGATGCAGCAGG - Intergenic
1094178603 12:27567232-27567254 AAAAAGAAAAAAGATGAAGAAGG + Intronic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095311180 12:40698896-40698918 AAGAGGAAACAAGATGCATTAGG - Intronic
1095714152 12:45323419-45323441 GAGAAGAAGCAAGATGCAGGTGG + Intronic
1096405132 12:51338499-51338521 AAGGAGAAAAGACATTCAGAGGG - Intronic
1096555101 12:52398967-52398989 AAGGACAAATAAGATTCAAAGGG - Intronic
1097340695 12:58434448-58434470 GAGTAGAAACAAGATGAAGTTGG + Intergenic
1097562792 12:61229074-61229096 TAGGAGAAATTACATGCAGAGGG + Intergenic
1097935702 12:65248490-65248512 AAGGAAAAATAAAATGCTGAGGG - Intergenic
1097987255 12:65797147-65797169 AAGGGAAAAAAACATGCAGATGG - Intergenic
1098287258 12:68920074-68920096 AAGCAGAAACAAGAGAAAGAGGG - Intronic
1098495896 12:71135350-71135372 GAGGAGAAAGAAGAAGAAGAAGG + Intronic
1098617863 12:72552623-72552645 ATGGAGTAACAAGGTGGAGAAGG + Intronic
1099305415 12:80948586-80948608 AAGGAGAAACAAGAGGTAGAAGG + Intronic
1099585190 12:84505857-84505879 CAGGAAAAAAAAGATGCAAAAGG - Intergenic
1099914913 12:88880888-88880910 GAGGAGAAGGAAGAGGCAGATGG + Intergenic
1100067398 12:90665698-90665720 AGGGAGAAAGAAGAAGCAGTAGG - Intergenic
1100153358 12:91768653-91768675 AAGGAGAAACAAGATAGACAGGG + Intergenic
1100169829 12:91961474-91961496 AAGGAGAAATCAAATGCACAAGG + Intergenic
1100633798 12:96414850-96414872 AAGCAGGAACAAGATGCGGTAGG + Intergenic
1100774278 12:97957210-97957232 AATGAGAAATCAGATGGAGAGGG + Intergenic
1101234323 12:102773311-102773333 AAGAAGGAACAAGATGGGGAAGG - Intergenic
1101408901 12:104453248-104453270 AAGGGAAGACAAGATGAAGAGGG - Intergenic
1101574909 12:105988296-105988318 AAGGAGAGACAAGAGACATAGGG - Intergenic
1102366358 12:112339444-112339466 AAAGAAAAACAAAATTCAGAAGG + Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103235148 12:119366483-119366505 AAGGAGGAGCAAGGTGGAGATGG + Intronic
1103282518 12:119771689-119771711 AAGGAGAAGCTGGAGGCAGATGG + Intronic
1103829569 12:123768086-123768108 ACGGAGAAGAAAGATACAGAGGG - Intronic
1103973912 12:124689636-124689658 AAGCAGCACCAAGATACAGAAGG - Intergenic
1104425636 12:128675195-128675217 AAGGAAAAAGCAGATGAAGAAGG + Intronic
1104802810 12:131566102-131566124 AAGAATAAACAAAATGTAGATGG + Intergenic
1105883824 13:24625647-24625669 AAACAGAAACAGGAAGCAGAAGG - Intergenic
1105896333 13:24719643-24719665 AAAGAGGAAGAAGAAGCAGAAGG + Intergenic
1106158335 13:27178053-27178075 AAAGAGAAAAGAGATGCAGTGGG + Intergenic
1106341977 13:28838564-28838586 ATGCAGGAATAAGATGCAGAGGG - Intronic
1106458743 13:29949684-29949706 ACAGAGAAACAAGAAACAGAGGG - Intergenic
1106508007 13:30388305-30388327 AAGAAGAAAGAAGAAGAAGAAGG + Intergenic
1107288033 13:38818540-38818562 AAGGAGAAAGGAGAGGTAGATGG + Intronic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108538629 13:51413921-51413943 AAGGAGAGACTAGATGTGGACGG - Intronic
1108609045 13:52066072-52066094 AAGCAAAAACCATATGCAGAAGG - Intronic
1108703570 13:52964724-52964746 ATGGATAATCAAGATCCAGAAGG - Intergenic
1108709194 13:53016379-53016401 AAGGGGAATTAAGTTGCAGATGG + Intergenic
1110251554 13:73386075-73386097 AAGGAGAAACAAAAAACAGTAGG + Intergenic
1110482119 13:75990937-75990959 AAGGAGAAAGGAGAAGGAGAAGG - Intergenic
1110761246 13:79232838-79232860 AGGGAGTAACTGGATGCAGATGG - Intergenic
1111219610 13:85187300-85187322 AAGTAAAAATAAGATGCAGCTGG + Intergenic
1111577581 13:90176503-90176525 AAGGATAAATTAGATACAGAAGG + Intergenic
1111653083 13:91117029-91117051 AAGATGAACCAAGATGGAGAAGG + Intergenic
1111804773 13:93026071-93026093 AAGGAGAAACAATATTCAAAAGG + Intergenic
1111856232 13:93640878-93640900 AAGCAGAAAAAAGATAAAGAGGG - Intronic
1112110297 13:96290071-96290093 AACAGGAAACAAGATACAGAGGG - Intronic
1112194694 13:97213644-97213666 AAAGATAAGCAAGATGTAGATGG - Intergenic
1112404350 13:99105102-99105124 AAGAAGAAGGAAGATGAAGAGGG - Intergenic
1112433120 13:99370476-99370498 AGGGAAAAACAACAGGCAGAGGG - Intronic
1112743676 13:102503726-102503748 AGGGAAAAACAAGATGAAGTTGG - Intergenic
1113215375 13:108034556-108034578 ATGGATAAAGAAGTTGCAGAAGG - Intergenic
1113672431 13:112184137-112184159 AAGAAGAAAGAAGAAGAAGAAGG + Intergenic
1113704934 13:112424059-112424081 CAGGAGAAGCAAGATGCAGGAGG + Intronic
1113819450 13:113202722-113202744 AAGGAAATACAGGATGGAGAAGG + Intronic
1114754249 14:25241026-25241048 AAGGAGAAACAAGAGCCATGAGG + Intergenic
1114882949 14:26809452-26809474 TAGAAAAAACAAGATGCAAATGG - Intergenic
1114931113 14:27467828-27467850 AAGGAGAAGAAACAGGCAGAGGG + Intergenic
1115009319 14:28524866-28524888 AAGAAGAAATAAGAAGAAGAAGG + Intergenic
1115146789 14:30236102-30236124 AAGTAGAAGCAAGAAACAGAGGG + Intergenic
1115235517 14:31206443-31206465 AAGGAGAAACAATTTGGAGGGGG - Intronic
1115573784 14:34691710-34691732 GAGAAGAAACGAAATGCAGATGG - Intergenic
1116361605 14:44005199-44005221 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
1116371431 14:44138273-44138295 AAGAAGAAACAAGAACAAGAGGG - Intergenic
1116621302 14:47207290-47207312 TAGGAGAAAAAATAAGCAGAGGG + Intronic
1117106583 14:52403497-52403519 AAGGAGAATTAAGCTGCAGGTGG + Intergenic
1118092610 14:62498700-62498722 AAGGAGAAGCAAGGAGGAGAGGG + Intergenic
1118133730 14:62998099-62998121 AAGAAAAGACCAGATGCAGATGG - Intronic
1118764355 14:68899978-68900000 AAGGACAAAGAGGAAGCAGAAGG + Intronic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1118979093 14:70701676-70701698 AAGGAGGAACAAGAGGAAGAGGG + Intergenic
1119252980 14:73173082-73173104 AATGAGAAACAAGGGGAAGATGG + Intronic
1119367321 14:74104418-74104440 AAGGGGAAATAAAATGCAGGTGG - Intronic
1119768116 14:77203538-77203560 CAGGAAAAGCAAGATGCAGACGG - Intronic
1120050648 14:79861768-79861790 CAGGAGGATCAAGATGCAGAGGG - Exonic
1120591694 14:86381951-86381973 AAGGAAAAACAACATGTAGCAGG + Intergenic
1121578721 14:95010389-95010411 AAGGAAAAAAAAGAAACAGAGGG + Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121737970 14:96231883-96231905 GAGGAGATAGGAGATGCAGAGGG + Intronic
1121883159 14:97518242-97518264 AAGGAGAAAGCAGTTGCTGAAGG - Intergenic
1122038158 14:98963273-98963295 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
1122038162 14:98963304-98963326 AAGGAGAAAGAAGAAGGAGAAGG + Intergenic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1122585494 14:102803285-102803307 AAAGAAAAACAAGAAGCTGAGGG - Intronic
1124039910 15:26091960-26091982 AGGGAAAAACAAGAGACAGATGG - Intergenic
1124552118 15:30691246-30691268 AAGGAGAAAGAATAGGGAGAAGG - Intronic
1124679123 15:31714420-31714442 AAGGAGAAAGAATAGGGAGAAGG + Intronic
1124699315 15:31898090-31898112 AAAGAGAAACAATATTCAAAGGG + Intergenic
1125377585 15:39047623-39047645 AAAGAGAAAAAGGATGCAGGAGG + Intergenic
1126833098 15:52629913-52629935 AAGTAGAAACAATATACAGCAGG + Intronic
1126961749 15:54004135-54004157 AGGTAGAAGGAAGATGCAGATGG - Intergenic
1127522061 15:59752958-59752980 AAGGGGAAACAAGAACCAGGAGG - Intergenic
1127546854 15:60000424-60000446 AAGGAGATGCAAAAAGCAGAAGG + Intergenic
1127834094 15:62776052-62776074 AAGTAGCAGCAAGATGCAGGGGG - Intronic
1128027500 15:64450723-64450745 TAGGAGAAACAAGATACAAGAGG - Intronic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128709453 15:69860823-69860845 CATGAGAAAGAAGATGCAGCTGG - Intergenic
1129651807 15:77496433-77496455 AAGGAGAAACTGGATGGAGGAGG - Intergenic
1130032084 15:80325075-80325097 AAGGAGAAACAAGACCAAGATGG + Intergenic
1130064880 15:80595146-80595168 AAGGAAACACAAGAGGCCGAAGG - Exonic
1131018252 15:89075566-89075588 GAGGCGAAAAAAGATGCTGAAGG + Intergenic
1131513462 15:93062668-93062690 AAGGGGACACTAGATGGAGAAGG + Intronic
1131578153 15:93613014-93613036 TAGAAGAAATAAGATGCACAAGG - Intergenic
1131622755 15:94084463-94084485 AAGGAGAAACTGGATAAAGATGG - Intergenic
1131672284 15:94632421-94632443 GAAGAGAAACAAGCTTCAGAAGG - Intergenic
1131689413 15:94810395-94810417 AAGGAGTTTCAAGATGCTGAAGG + Intergenic
1132097093 15:98995019-98995041 AAGGACAAACAAGATCCACACGG - Intronic
1132121683 15:99181396-99181418 AAGGAGAGAAAAGCGGCAGATGG + Intronic
1132164242 15:99569308-99569330 AAGAAGAAACAAAAGCCAGAAGG - Intronic
1132276497 15:100569518-100569540 AAGGAGATTCAGGATGCAGCTGG - Exonic
1132628883 16:906741-906763 AAGAAGAATAAAGATGCAGGAGG - Intronic
1133392749 16:5422753-5422775 AAAGAGGAAGAAGATGGAGAGGG + Intergenic
1133736896 16:8622482-8622504 AAGGAGACCCAGGTTGCAGATGG - Intronic
1134505348 16:14801394-14801416 AAGAAGAAACAAGATGCTCAAGG - Intronic
1134575230 16:15327516-15327538 AAGAAGAAACAAGATGCTCAAGG + Intergenic
1134727216 16:16428976-16428998 AAGAAGAAACAAGATGCTCAAGG - Intergenic
1134903378 16:17958823-17958845 TGGGAGAATCATGATGCAGAAGG + Intergenic
1134940221 16:18282879-18282901 AAGAAGAAACAAGATGCTCAAGG + Intergenic
1135205779 16:20482777-20482799 AAGGAGAAAGAAGATACAGGGGG - Intronic
1135213136 16:20541032-20541054 GAGGAGAAAGAAGATACAGGGGG + Intronic
1135281708 16:21158666-21158688 GAGGAGGAACAAGAGGAAGAAGG - Exonic
1135348074 16:21706211-21706233 AAGGAGGAAGAAGAGGAAGATGG - Intronic
1135357802 16:21784420-21784442 AAGGAGGAACAAAACACAGATGG - Intergenic
1135456306 16:22600538-22600560 AAGGAGGAACAAAACACAGATGG - Intergenic
1135743731 16:24998301-24998323 AAGAAGAAACAGGCAGCAGATGG + Intronic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136407807 16:30058903-30058925 CAGCAGAAACAAGATGGAGAAGG + Intronic
1136502743 16:30681170-30681192 AAGAAGAAAGAAGAAGAAGAAGG + Intergenic
1136502754 16:30681240-30681262 AAGAAGAGACAAGATCCAAAAGG + Intergenic
1136909237 16:34133082-34133104 AATGGGAAACAAGGTGCACAGGG - Intergenic
1137662365 16:50219806-50219828 AAGGAAAAAAAGGAAGCAGAAGG - Intronic
1137805654 16:51302960-51302982 AAGGAGAAACAATTTGCTGATGG + Intergenic
1138250019 16:55494861-55494883 AAGGAGAAGCAAGAATCTGATGG + Intronic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139497043 16:67327185-67327207 AAGGAGAAACAAGGTTAACAGGG + Intronic
1139813606 16:69646341-69646363 TAGGAGAATCAAGATGAAAAAGG - Intronic
1140559609 16:75963158-75963180 AGAGAGAAACAAGATACATAAGG - Intergenic
1140720758 16:77769687-77769709 TAGGAGGAACAAGATGGAGTGGG + Intergenic
1140856756 16:78984838-78984860 AAGGAGAAAGACGAGGAAGAAGG + Intronic
1140995770 16:80258343-80258365 AAGGAGAAACCACTTGTAGATGG - Intergenic
1141011626 16:80405762-80405784 AGGTAGAAATAAGATGCTGAGGG + Intergenic
1141099520 16:81186782-81186804 AAGGAGAATGAATATTCAGAGGG + Intergenic
1143078242 17:4363966-4363988 AAAAAAAAAAAAGATGCAGACGG + Intronic
1143433214 17:6902245-6902267 AGGGAAAAAGAAGAGGCAGAGGG + Intronic
1143847584 17:9784695-9784717 AAGAAGTATCAAGATACAGAAGG + Intronic
1144042657 17:11426888-11426910 GTGGAAAAACAAGATGGAGAAGG - Intronic
1144899267 17:18568943-18568965 AAGGGGACACTAGATGGAGAAGG - Intergenic
1146412269 17:32596645-32596667 AAAGAAGAACAAGAAGCAGATGG + Intronic
1146644198 17:34565907-34565929 GAGGAGAAACAAGATAAGGAAGG + Intergenic
1147242379 17:39099015-39099037 AAGGAGGAACAGGAGACAGAGGG + Intronic
1148579795 17:48735633-48735655 AAGGAAAAACAAAGTGGAGATGG - Intergenic
1148861715 17:50608015-50608037 AAGGAGTAAGGAGAAGCAGATGG + Exonic
1149027720 17:52049112-52049134 AGGAAGAATCAAGATCCAGAAGG + Intronic
1149038059 17:52157456-52157478 GATGAGAAAGAAGAGGCAGATGG - Intronic
1149893171 17:60408299-60408321 AAGAAGAAAAAAGAACCAGATGG + Intronic
1150089462 17:62310088-62310110 AAAGAGAAAGAAGAAGAAGAAGG - Intergenic
1151389248 17:73774681-73774703 AAGGGGAAATGAGATTCAGATGG - Intergenic
1152200554 17:78943416-78943438 AAGGAGAGGCCAGCTGCAGAGGG - Intergenic
1152265184 17:79290027-79290049 GAGGAGAAGCAAGATGCCCAGGG + Intronic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1153468954 18:5421381-5421403 AAGGAGAAACAAGAGTCAATAGG + Intronic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153955253 18:10090645-10090667 AAGGAGAAGGAAGAAGAAGAGGG - Intergenic
1154941618 18:21118651-21118673 AGGGAGAAAAAAGATGAAAAGGG - Intergenic
1155333589 18:24742556-24742578 TAGGAGAAACAACATGCATCAGG + Intergenic
1156345629 18:36254672-36254694 AAGGAAATACAAGTTGCAGAAGG - Intronic
1156712653 18:39965615-39965637 GAGGAGAAAGAAGATGTAAAGGG + Intergenic
1156767606 18:40677108-40677130 AAGAAGAAATGAGATACAGAAGG - Intergenic
1156893332 18:42215360-42215382 AAGGAGAATCAAGTGGTAGATGG + Intergenic
1156955224 18:42954525-42954547 AAGGAGGAACATGCTTCAGAAGG - Intronic
1157214685 18:45773125-45773147 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1157484187 18:48075395-48075417 AAGGAGAAGCCAGATGGAAATGG + Intronic
1158009000 18:52706966-52706988 CAGGAGAGAAATGATGCAGAGGG + Intronic
1158342665 18:56483704-56483726 AAGGCGAGACAAGATGCTGGAGG + Intergenic
1158424497 18:57327023-57327045 ACGGAGGAACAAGTTGCAGTAGG - Intergenic
1158446192 18:57523706-57523728 CAGGAGCAGCAAGAGGCAGATGG + Intergenic
1158674687 18:59507480-59507502 AAGGAAGAACATGAGGCAGAAGG - Intronic
1158796080 18:60848218-60848240 CAGGAGAAAGAACAAGCAGATGG - Intergenic
1159203126 18:65214589-65214611 AATGAGAGACAAGATGTAAATGG + Intergenic
1159390282 18:67784125-67784147 AAGGAGAGAGAAGATGCAAGAGG + Intergenic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1159926502 18:74274500-74274522 AAGGAGAAAGAAAATGCTGTGGG + Intronic
1159933079 18:74334292-74334314 AAGGGGAAAGAACAAGCAGAAGG + Intronic
1160025685 18:75213572-75213594 AAGGACAAACAAAATGCTGAGGG + Intronic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160695243 19:480779-480801 ATGGAGAATGATGATGCAGAAGG + Intergenic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1161559209 19:4962231-4962253 CAGGAGAAACATGAGGCAGGTGG + Intergenic
1161720296 19:5898517-5898539 TAGGAGAAACCAGATCCACAAGG - Intronic
1162376023 19:10305745-10305767 ATGGGGAAGCAAGATGGAGAAGG + Intronic
1163387244 19:17007398-17007420 AAGGAGGAAGAAGAAGCAGGAGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164611278 19:29633873-29633895 AATGAGCAAAAAGATGCAAATGG + Intergenic
1166195623 19:41203808-41203830 AAGGAGAAGAAAGATGCAGGGGG - Intronic
1166400288 19:42473787-42473809 AAGGAGAAAGAACAGGCAGGAGG + Intergenic
1166652188 19:44582885-44582907 AAGAAGAAAAAAGAAGAAGAAGG + Intergenic
1166853545 19:45771401-45771423 AAGGAGAAGAAAGAGGCATAGGG + Intronic
1167980542 19:53271410-53271432 AAGGACAAACAGGATGCCAACGG + Intergenic
1167985633 19:53312806-53312828 AAGGACAAACAGGATGCCAACGG - Intergenic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
925132128 2:1501671-1501693 AAGCAGAGACAAGACACAGACGG + Intronic
926001115 2:9333561-9333583 GAGAAGAAACAGAATGCAGAGGG + Intronic
926376553 2:12234476-12234498 AGGGGAAAACAAGATGAAGAAGG + Intergenic
926396600 2:12449195-12449217 AAAGAAGAAAAAGATGCAGAGGG - Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927928471 2:27028791-27028813 AAAGAAAAAAAAGTTGCAGATGG + Intergenic
928688474 2:33775007-33775029 GAGGAGAAACAGAATGCAAAAGG - Intergenic
928835327 2:35537425-35537447 CAGGAGAAGCGATATGCAGATGG + Intergenic
929479261 2:42287906-42287928 AAGGAAGCATAAGATGCAGAAGG + Intronic
929561821 2:42960919-42960941 AACGAGAGCCAAGAAGCAGAGGG - Intergenic
930142560 2:47967522-47967544 GAAGAGAACCAAGAAGCAGAAGG - Intergenic
930571720 2:53094515-53094537 AAGGAGAAAAGAGATGGAGAAGG + Intergenic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
932214271 2:69956422-69956444 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
933197861 2:79412786-79412808 AAGGAGAAACTGGATGGTGAAGG + Intronic
934581993 2:95450135-95450157 AAGAAGTAAAAAGAGGCAGAAGG + Intergenic
934597457 2:95626579-95626601 AAGAAGTAAAAAGAGGCAGAAGG - Intergenic
934842432 2:97636415-97636437 AAGAAGTAAAAAGAGGCAGAAGG + Intergenic
935084849 2:99835144-99835166 AAGGAGAAGCAAGAGGGAGTGGG - Intronic
936854947 2:116946287-116946309 AAAAAGAAACAAGATTCTGACGG + Intergenic
937019297 2:118635532-118635554 ATGGAGAGACTAGATGCAGGAGG - Intergenic
937327124 2:120996717-120996739 AAGAAGAAAGAAGAAGGAGAAGG - Intergenic
937363703 2:121245973-121245995 AATGTGAAACAAGAGGAAGATGG + Intronic
938041968 2:128083439-128083461 AGGCAGAAAGAATATGCAGATGG - Intergenic
938571439 2:132565255-132565277 ACTGAGAAAGAAGAAGCAGAAGG + Intronic
938726891 2:134116818-134116840 AAGAAGAAAGAAGAAGAAGACGG + Intergenic
938754903 2:134370761-134370783 GAGGAGAAATAAAATGCAAAGGG + Intronic
938948649 2:136237175-136237197 AAGTAAAACCAAGAGGCAGAGGG + Intergenic
939035293 2:137123318-137123340 AATGAGAAACAAGATTCAGGAGG + Intronic
939241210 2:139562176-139562198 AATGAGAAAAATGATACAGAAGG + Intergenic
939619443 2:144400136-144400158 AATGAGAAACAATATCAAGACGG - Exonic
939814904 2:146882005-146882027 CAGAAGAAATAAGATTCAGATGG - Intergenic
940261157 2:151780938-151780960 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
940758916 2:157716148-157716170 AAGGAGACAGAAGAGTCAGAGGG - Intergenic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
941576506 2:167239347-167239369 AAGGAGAATTAAGTTGCAGATGG + Intronic
942305238 2:174600758-174600780 CAGCAGAAACAAGATGGACAAGG - Intronic
943014544 2:182495158-182495180 AAGGAGAAAGAAGATCCAATGGG - Intronic
943197851 2:184778488-184778510 AGGGATATACAAGATACAGATGG + Intronic
943366209 2:186969859-186969881 AAGGAGAAACAAGCTGAAGAAGG + Intergenic
943377021 2:187090217-187090239 AAGGAGAAAAAATATTCAGCTGG + Intergenic
943398829 2:187378074-187378096 AAGAAGAAACAAGAAAGAGAAGG + Intronic
943548879 2:189313827-189313849 AAGATCAAACAAGATGAAGAAGG + Intergenic
944280995 2:197897191-197897213 AAGAAGAAAGAAGAAGGAGAAGG - Intronic
944378224 2:199074077-199074099 AAGGAGAACCCAGATTCATAAGG + Intergenic
944573860 2:201072132-201072154 AAGGAGAGACTAAATGGAGAAGG + Intronic
944588451 2:201194544-201194566 AATGAGAAATAAAAAGCAGAAGG + Intronic
944808524 2:203306044-203306066 AAAGAGAAAAAAGATATAGAAGG - Intergenic
944837066 2:203590278-203590300 CAGGATAATCAAGATGCATATGG - Intergenic
944985315 2:205169612-205169634 AGGAAGAAACAAGATAAAGATGG - Intronic
945420037 2:209624104-209624126 TTGGAAAGACAAGATGCAGATGG - Intronic
946051630 2:216867603-216867625 AAGGAGAAGGAAGAGGAAGAGGG - Intergenic
946382232 2:219356806-219356828 ATGGAGAAACAAGATACAATGGG + Intergenic
946528529 2:220546554-220546576 AAGGAGGAAGAAGAAGAAGAAGG - Intergenic
946528532 2:220546579-220546601 AAGAAGAAAGAAGAAGGAGAAGG - Intergenic
946743228 2:222820428-222820450 AAGGAGAGGCAAGATGAAAAAGG - Intergenic
946767754 2:223055819-223055841 AATGGAAAACAAGCTGCAGATGG + Intronic
946773881 2:223117524-223117546 AAGGAAAAACACCATGGAGATGG + Intronic
947811707 2:233008789-233008811 AAAAAAAAAAAAGATGCAGATGG - Intronic
947940447 2:234049873-234049895 AAGGAGAACCAAAATATAGAGGG - Intergenic
948031166 2:234818749-234818771 GAGGAGAAACATGAGGGAGAAGG + Intergenic
948205763 2:236162101-236162123 AAACAGAAACAAGAGGGAGAGGG + Intergenic
948365357 2:237451081-237451103 AAGGAGAAAACATTTGCAGATGG - Intergenic
948488305 2:238295278-238295300 AAGGAGAAAGAAGAAGAAGAAGG - Intergenic
1169059341 20:2650040-2650062 CAGGGTAGACAAGATGCAGATGG + Intergenic
1169448992 20:5695434-5695456 AAGGAGAAAAAAGAAGAAGGAGG - Intergenic
1169665700 20:8033269-8033291 AAGAAGAAACATGAGGCAAAAGG + Intergenic
1169687873 20:8296584-8296606 AAGGAAAAAGAAGGAGCAGAGGG + Intronic
1169913884 20:10668992-10669014 AAGGAGAAAGAAAACACAGAAGG + Intronic
1170712705 20:18806769-18806791 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1171351321 20:24505302-24505324 AAGGAGAAGGAAGATGCCCAGGG + Intronic
1171440755 20:25160604-25160626 AGGAAGAAAGAAGTTGCAGAAGG + Intergenic
1172481424 20:35274104-35274126 ATGGAGTAAGAAGCTGCAGAGGG - Intronic
1173432745 20:43005284-43005306 AAGAAGCAACAAGATGCGGTTGG - Intronic
1174001024 20:47374811-47374833 AAGGATAAAGAAGAAGAAGAAGG + Intergenic
1174478983 20:50817747-50817769 GAGGAAAAGCAAGCTGCAGACGG - Intronic
1175482217 20:59319768-59319790 AAGAAAAAAGAAAATGCAGAGGG + Intronic
1176256484 20:64155749-64155771 AAGGAGACAAAGGATGGAGAGGG - Intronic
1177017142 21:15806005-15806027 AAGCAGAAACAAAAAGCACAAGG - Intronic
1177359666 21:20050988-20051010 AAAAAGAAACAAAAAGCAGAGGG - Intergenic
1177584789 21:23076813-23076835 CAGGAGAAAAAATATGCAAAAGG + Intergenic
1177804270 21:25858422-25858444 AAGGTAAAACAAGAAACAGATGG - Intergenic
1178526059 21:33330342-33330364 AAAGAGAAAAATGAAGCAGAGGG - Intronic
1178756400 21:35354231-35354253 AAGAAGAAGCCAGATGCACAAGG - Intronic
1178880122 21:36442987-36443009 AATAAAAAATAAGATGCAGAGGG - Intergenic
1179488611 21:41726587-41726609 AAGGAGAAAGAAGAAGAAGGGGG - Intergenic
1179558021 21:42193142-42193164 AAGGACACCAAAGATGCAGAGGG + Intergenic
1180338125 22:11597987-11598009 AATGGGAAACAAGGTGCACAGGG - Intergenic
1181320050 22:21997621-21997643 AGTTAGAAACAAGATGAAGATGG + Intergenic
1181321404 22:22009656-22009678 AGGGGTAAACAAGTTGCAGAAGG + Intergenic
1181999229 22:26906648-26906670 CAGGAGACAGCAGATGCAGATGG + Intergenic
1182065793 22:27430850-27430872 AAGGAAATACAAGAAGCAGCGGG + Intergenic
1182703684 22:32261143-32261165 AAGGCTAAACAATATGCACAGGG + Intergenic
1182708520 22:32305758-32305780 GATGAGAAACAAGAGGCACATGG + Intergenic
1183305139 22:37078915-37078937 AAAGAGAAAGAAGAGGAAGAAGG + Intronic
1183334300 22:37237852-37237874 AAGGAGCAGCAAGATGAAGTCGG + Intronic
1183771436 22:39929540-39929562 AAGGAGGACAAAGATGCAGAAGG - Intronic
1184326573 22:43792081-43792103 AAGGAGAAAGCAGAATCAGAAGG - Intronic
1184345973 22:43913249-43913271 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1184431427 22:44443423-44443445 GAGGAGATACAAGAGGCAGAGGG + Intergenic
1184959334 22:47917788-47917810 AAGGAGAGAGAAGAGGGAGAGGG - Intergenic
1185036131 22:48477934-48477956 GAGGAGAAAAAAGATGCAAATGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
950008805 3:9707813-9707835 AAGGAGAAGCAAGTTGGAGGAGG + Intronic
951005535 3:17611571-17611593 GAGGAAAAGCAAGATGAAGATGG + Intronic
951563674 3:23991503-23991525 AAGAAGAAACAAGTTTCTGAGGG - Intergenic
952504076 3:33991778-33991800 AAGGAGAGAAAAGAAGCAAAGGG - Intergenic
953173843 3:40531431-40531453 AAGGAGAATCAAGAATGAGAAGG - Intronic
953510962 3:43538711-43538733 CAGGAGAGGCTAGATGCAGAGGG + Intronic
953765709 3:45739958-45739980 AAAGAGACACAAGATACAGTAGG + Intronic
954533069 3:51337553-51337575 AAGGAGACACATCAGGCAGATGG + Intronic
955703598 3:61705952-61705974 AATATGAAACAAGAAGCAGATGG - Intronic
956035854 3:65090846-65090868 AAGGAGGAAAAAAATGTAGAGGG - Intergenic
956153352 3:66267149-66267171 AAGTATATACAAGATGCAGGTGG + Intronic
956978349 3:74608869-74608891 AAGGAGAAACAAAATTTAAATGG + Intergenic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
958058257 3:88442045-88442067 AAGGAGATACCAGATTTAGAAGG + Intergenic
958881497 3:99676720-99676742 AAAGAGAAATAAGAGGCATAAGG + Intronic
959444718 3:106424735-106424757 AAAAAAAAACAAGATGCAGATGG + Intergenic
959533846 3:107464123-107464145 AATTAGAATAAAGATGCAGAGGG - Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960464178 3:117975247-117975269 AATGAGAAACAAGCTGCAGATGG - Intergenic
961422315 3:126816103-126816125 AAGGAGGAGGAAGATGCAGAGGG - Intronic
961686672 3:128637621-128637643 AAGGAGAAACAAGACCCCCATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962661148 3:137601284-137601306 AAGGAGAAACAAATAGCAAAAGG + Intergenic
963625438 3:147666175-147666197 AAGTAGAAGCAAGATAAAGAAGG - Intergenic
963957403 3:151270009-151270031 AAGGAGATAAATGATGAAGAAGG + Intronic
964370518 3:155995324-155995346 AAGGACACAGAACATGCAGAGGG + Intergenic
964372460 3:156015043-156015065 AAGGAGAAAGAGGATGCTGTAGG + Intergenic
964561092 3:157997381-157997403 GAGGAGGAAGAAGAGGCAGAAGG - Intergenic
964646692 3:158966038-158966060 GAGGAGAAACCACATGAAGACGG - Intronic
964696861 3:159518118-159518140 AAGAAGAAATAAGTTGCAGACGG + Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964955708 3:162353463-162353485 AAGGAGGCACAAGTTCCAGAAGG + Intergenic
965522909 3:169686268-169686290 AAGCAGAAACAAAATGCACAGGG - Intergenic
965741934 3:171884723-171884745 AAAGAGAAAAAAGCTGAAGATGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
967179356 3:186889931-186889953 GAGGAGGAACAAGAAGAAGAAGG - Intergenic
967337195 3:188357852-188357874 AAGGAGTAAAAGGAGGCAGAAGG - Intronic
967591662 3:191283406-191283428 AAGTAGAAAAAAGATCCAAAAGG - Intronic
967605547 3:191441107-191441129 AAAAAGAAACAATATGTAGAGGG - Intergenic
968181174 3:196596429-196596451 AAGAGGAAAAAAGATACAGAGGG + Intergenic
968227104 3:196979663-196979685 AAGGAGACACAAGGAGCAGAAGG - Intergenic
968681487 4:1923851-1923873 AAGCAGAAACAAATTGCTGAAGG + Intronic
969078496 4:4599715-4599737 CGGGAGAAACAAGATGCAACAGG - Intergenic
969444433 4:7236168-7236190 AAGGAGAAAATAAATACAGAAGG + Intronic
970010626 4:11454922-11454944 AAGGAGAAAGAAGGAGAAGAAGG + Intergenic
970377383 4:15472995-15473017 ATGGAGAAACAACAGGCATATGG - Intronic
970633394 4:17979788-17979810 AGGGGGAAACAGGCTGCAGATGG + Intronic
970918554 4:21365628-21365650 AATAAGAAACAAACTGCAGATGG - Intronic
971234549 4:24829422-24829444 ATGGAGAAAAAAGATGGAGTGGG + Intronic
971810790 4:31424097-31424119 AAGAAGAAACAAGGTGTGGAAGG - Intergenic
971918574 4:32908192-32908214 AAGGAGAAACAACATGGCCAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972299346 4:37770536-37770558 GAGGAGATAAAAGATGTAGAGGG - Intergenic
972590840 4:40485388-40485410 AAGCAGTAAGAATATGCAGATGG + Intronic
972930680 4:44068297-44068319 AAGGATAATCATGATTCAGAAGG + Intergenic
973017223 4:45155640-45155662 AAGCAGAAACAACATTCACATGG + Intergenic
973639986 4:52893171-52893193 AAGAAAAAGCAAGATTCAGAGGG - Intronic
974026682 4:56738941-56738963 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
974850175 4:67394883-67394905 AAGGAAGAAAAAGATCCAGAAGG + Intergenic
975235652 4:71992576-71992598 AAGGAGAAAGCACATGCACATGG + Intergenic
975249037 4:72155822-72155844 AAGCAGAAGAAAGATACAGAAGG + Intergenic
975545410 4:75555678-75555700 AAAGCGAAACAAGAGGGAGAGGG - Intergenic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976777192 4:88719621-88719643 AAGGAGAAGAAAGAAGGAGAAGG - Intergenic
976794178 4:88913567-88913589 AAGAAGAAAAAAGAAGAAGAAGG + Intronic
978399511 4:108315738-108315760 CAAGAGAAACAAGAGGCAAATGG + Intergenic
978464471 4:108993955-108993977 AAAGAGAGAAAAGAGGCAGAGGG + Intronic
978595903 4:110376890-110376912 AAGGAGAAAGAAGGAGGAGAAGG - Intronic
978761432 4:112358706-112358728 AAGGAGGAAGAAGATCCAGCTGG + Intronic
978839126 4:113188748-113188770 AAGGGGAAACTAGATTCTGAAGG - Intronic
979327334 4:119395181-119395203 CAGGAGAAACAAAATACACAGGG - Intergenic
980031001 4:127830313-127830335 AAGGAGAAATAAGGTGAACAAGG - Intronic
981025084 4:140069624-140069646 AAGAAGAAAGAAGAAGAAGAAGG + Intronic
981238646 4:142448618-142448640 AACCAGAAACACGATCCAGATGG + Intronic
981792742 4:148558068-148558090 GAAGAGAAATAAGTTGCAGATGG + Intergenic
982470781 4:155787378-155787400 AAGGAAACAGTAGATGCAGACGG + Intronic
983260822 4:165454259-165454281 AAGGAGAATAAAGAAGCAAATGG - Intronic
983426716 4:167593464-167593486 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
983762587 4:171430560-171430582 GTGGAGAGACATGATGCAGAGGG - Intergenic
984124194 4:175785873-175785895 AATGAGGAACAAGATGGAAATGG + Intronic
985224284 4:187743631-187743653 AAGGAAAAGAAAGAAGCAGAAGG - Intergenic
985388271 4:189467519-189467541 AAAGAGAAAGCAGGTGCAGAGGG + Intergenic
985469635 5:31834-31856 AAAGAAAAAAAAGAAGCAGACGG - Intergenic
985926942 5:3026318-3026340 AGGCACACACAAGATGCAGAGGG - Intergenic
986092167 5:4520440-4520462 AATGAGAAATAATATGCAGGAGG + Intergenic
986391054 5:7288694-7288716 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
986492237 5:8305599-8305621 CAGCAGCAACAAGATGCTGAGGG + Intergenic
987170054 5:15245760-15245782 AAGGAAAAAAAAGATGCAGCAGG + Intergenic
987598665 5:20036402-20036424 AAGAAGAAAAAAGAAGGAGAAGG + Intronic
987619042 5:20315550-20315572 AAGTCGAAAAAGGATGCAGAAGG - Intronic
988089615 5:26519705-26519727 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
988162752 5:27542970-27542992 AAGGAGAAGCACCAAGCAGAAGG - Intergenic
988417924 5:30969658-30969680 AAGGAGAAAGAAAAAGTAGATGG + Intergenic
988542292 5:32121375-32121397 AAGGAAAAACAAGAGAGAGATGG + Intergenic
988788193 5:34583435-34583457 AAACAGTCACAAGATGCAGAAGG + Intergenic
989438947 5:41447462-41447484 AAGGAGGGAAAAGAGGCAGAAGG + Intronic
989480228 5:41922556-41922578 AAGTAAAAACAAAATGGAGAAGG + Intergenic
989989793 5:50748090-50748112 AAGGAGGAACAAAAAACAGAAGG - Intronic
990374334 5:55154213-55154235 TAGGAGAAAGAAGATTCAAAAGG + Intronic
990379247 5:55205895-55205917 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
991342392 5:65625430-65625452 AGGAAGAAACAAGAGACAGAAGG - Intronic
991513071 5:67401547-67401569 AAGGAAAAAAAATATGAAGATGG - Intergenic
991684885 5:69172677-69172699 AAGAAGAAACTAAAAGCAGAAGG - Intronic
991995988 5:72387240-72387262 AATGAGAAACAAAATGAACATGG + Intergenic
992084122 5:73262723-73262745 AAGAAGAAAACAGTTGCAGATGG - Intergenic
992144163 5:73828623-73828645 AAGGAGAAACAAAAGGAAAAAGG - Intronic
992189647 5:74278861-74278883 GAGGAGAAAGAAGATGGAGGTGG - Intergenic
992410572 5:76501618-76501640 AAGGAAAAAGAAAATGCAGCAGG - Intronic
992507375 5:77400511-77400533 AAAGAAAAACAAGATGGGGAGGG - Intronic
992829406 5:80579832-80579854 AAGGAGAAAGCATATGCAGAAGG - Intergenic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993165531 5:84349312-84349334 AAGGAGAAACAAGCTGCTTCAGG - Intronic
993566825 5:89486924-89486946 AAGAAGAAAAAAAATACAGAGGG + Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
993954035 5:94210606-94210628 AAGGAGCAATAAGAAGTAGAAGG + Intronic
994133730 5:96261457-96261479 AAGGCTATACATGATGCAGAAGG + Intergenic
994445121 5:99862622-99862644 AAGCAGAAACAAGTTGTAAACGG - Intergenic
995333521 5:110973061-110973083 AAGCAGAAACAAGAGATAGAGGG + Intergenic
996096657 5:119406404-119406426 AAGAAGAAATCTGATGCAGAGGG + Intergenic
996119909 5:119659761-119659783 AATAAGAAACAATATGAAGAAGG + Intergenic
996397512 5:123027915-123027937 AATGAGAAACAATAAGCTGAAGG + Intronic
996472213 5:123874016-123874038 AAGGAGAATTAAGTTGCAGAAGG - Intergenic
996921362 5:128771266-128771288 AAGCAGAAATTAGATGCTGATGG - Intronic
998083660 5:139297946-139297968 AAGGAGAGAGTAGTTGCAGATGG + Intronic
998181994 5:139952398-139952420 GGGCAGAAACAAGGTGCAGAGGG + Intronic
998331107 5:141327996-141328018 AAGAAGAAACAGGAGGCATATGG - Intergenic
998932157 5:147193446-147193468 AAGGAGAAAGAGCAAGCAGAAGG + Intergenic
999124510 5:149237359-149237381 AAACAAAAACAAGATACAGAAGG - Intronic
1000051615 5:157567948-157567970 AAAGAGACACAAGCTGCAGCAGG + Intronic
1000212926 5:159125293-159125315 AAAGAAAAACAAGAAGCATATGG - Intergenic
1000260021 5:159578756-159578778 GAGGAGAAGCAAGATTGAGAGGG + Intergenic
1000408068 5:160909626-160909648 AAATAGAAACAAGATCCAGTGGG - Intergenic
1000575978 5:162975782-162975804 AAGCAGAAGCAAGGTGGAGAAGG - Intergenic
1001086196 5:168701636-168701658 AAGGAGAAGCAGGAGCCAGAAGG - Intronic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001737803 5:174021083-174021105 AAGAAGAAAGAAGAAGAAGAAGG + Intergenic
1001737808 5:174021120-174021142 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
1001737809 5:174021133-174021155 AAGGAGAAGGAAGAAGCAGAAGG + Intergenic
1001737813 5:174021156-174021178 AAGGAGAAGGAAGAAGGAGAAGG + Intergenic
1001758429 5:174188192-174188214 GGGGAGAAGCAAGAGGCAGATGG - Intronic
1002177186 5:177407786-177407808 AAAAAAAAAAAAGATGCAGATGG + Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002883069 6:1269826-1269848 CAGAAGTAGCAAGATGCAGAGGG - Intergenic
1003529533 6:6926477-6926499 ATAGAGAAACAAGGTTCAGAGGG + Intergenic
1004332628 6:14735620-14735642 AAGGAGAGAGAGGATGCAGGCGG + Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1005349225 6:24918021-24918043 CAGGAGACAGAAGATGGAGATGG - Intronic
1005493911 6:26372147-26372169 CAGAAAAAGCAAGATGCAGAGGG + Intronic
1005567182 6:27107941-27107963 AAGGAGAAACAAGACACAGTGGG - Intergenic
1006560421 6:34906706-34906728 AAGGAGAAACAATATTTATATGG + Intronic
1007042493 6:38736195-38736217 ATGGAGAAACAAGGGTCAGAAGG - Intronic
1007903488 6:45435004-45435026 AAGGGGCAATAAGAAGCAGAAGG + Intronic
1008049369 6:46884292-46884314 AAGGAGAGAGAAGGTGGAGAAGG + Intronic
1008953867 6:57192527-57192549 AAGGAAAAACTACATGAAGAAGG + Intronic
1009323429 6:62319370-62319392 AAGAAGAAAGAAGAGGCAGATGG + Intergenic
1009518718 6:64654542-64654564 AAGTAGGACCAAGTTGCAGAGGG + Intronic
1009861280 6:69336507-69336529 AAGGAAAAATAACATGGAGAAGG + Intronic
1010161916 6:72866558-72866580 AAGGAGGATAAAGATGGAGATGG - Intronic
1010410956 6:75560839-75560861 AAGGAGAAAGAAGAAGAAGGAGG + Intergenic
1010550250 6:77212964-77212986 ATGGAGAAATAAGATCCTGAGGG + Intergenic
1011626709 6:89289117-89289139 AAGGAGCAAGACCATGCAGAGGG + Intronic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012232523 6:96777209-96777231 AAGGAGAAGAAAGAGGGAGAGGG - Intergenic
1012291619 6:97462704-97462726 AAGGAGCAAAAATATGCTGATGG + Intergenic
1012461238 6:99463507-99463529 AAGGAGGAAAAAGAGGGAGAGGG + Intronic
1012548453 6:100447419-100447441 ACGGAGAGACAGGAGGCAGATGG + Intronic
1012995756 6:105971766-105971788 AAGAAGAACAAAGATGGAGAGGG - Intergenic
1013126932 6:107192943-107192965 AGGGAGAAACATGACCCAGAAGG - Intronic
1013252957 6:108352924-108352946 ATGTAGAAACTAGATACAGAGGG + Intronic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1015861803 6:137689264-137689286 AGAGAGAATCAAGATGGAGAAGG - Intergenic
1015917368 6:138231048-138231070 AAGGGGAGACAAGGAGCAGAGGG + Intronic
1016274367 6:142331276-142331298 AAGGAGCCATAAGATTCAGAGGG - Intronic
1016694483 6:146976762-146976784 AAGGAGAAAAGAGAAGAAGAAGG - Intergenic
1016732535 6:147442328-147442350 CAGGACAAACAAGGGGCAGAAGG + Intergenic
1016827898 6:148405096-148405118 AAGCAGAGGCAAGAGGCAGAAGG - Intronic
1016836567 6:148483233-148483255 GAGAAGAAACAAGAGGGAGAGGG + Intronic
1016864372 6:148750602-148750624 AAGGACAGCCAAGATGCAAATGG + Intronic
1017437296 6:154428319-154428341 ATCGAGAAACAAGATCCAAAGGG + Intronic
1017687317 6:156926604-156926626 GAGGTGAAACAAGATGAAGGTGG - Intronic
1017849727 6:158294704-158294726 AAGAAGAAAAAAGAGGAAGAAGG - Intronic
1018147261 6:160903468-160903490 AGGGAGAAACTAGAAGCACAAGG - Intergenic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1018925719 6:168205658-168205680 AAAAAGAAAAAAGATGAAGAAGG - Intergenic
1019351812 7:557558-557580 AGGGAGAAACAGGATGGACATGG + Intronic
1019560992 7:1657174-1657196 ACAGAGAAACAAGATGAAGCGGG + Intergenic
1019797660 7:3063685-3063707 AAGAAGAAAGAAGAAGGAGAAGG - Intergenic
1020468032 7:8503263-8503285 AAGGTGAAACAACTTGCACAAGG + Intronic
1020700477 7:11475828-11475850 AAGCAGAGAATAGATGCAGATGG - Intronic
1020851718 7:13361821-13361843 AAGGTAAAACAAGATGAAGGGGG - Intergenic
1021312087 7:19108224-19108246 AAGGAGAACGAAGAAGCAGGGGG - Intronic
1022094975 7:27133801-27133823 AATAAGAAACAAAATGCACACGG - Intronic
1022118631 7:27285331-27285353 GAGGAGGAAAAAGAAGCAGAAGG - Intergenic
1023214495 7:37847518-37847540 AAGAAGAAAGAAGAAGAAGAAGG + Intronic
1023214497 7:37847537-37847559 AAGGAGAAAGAAGAAGGAGAAGG + Intronic
1023434275 7:40126111-40126133 AGGGAGATACAAGCTTCAGATGG - Exonic
1023986893 7:45102080-45102102 AAGGAGAAAGAAGAGGGAGGTGG + Intronic
1024032261 7:45471431-45471453 GAGGAGAAACAAGAAGGAGGAGG + Intergenic
1024059151 7:45685479-45685501 CAGGAGTAACAAGATGGAGCTGG + Intronic
1024820238 7:53320223-53320245 GAGGAGAAACAAAGTGAAGAAGG - Intergenic
1024944032 7:54791066-54791088 ACTGAGAAACAACAGGCAGAGGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026849703 7:73717187-73717209 AAGGAGAAAGAAGAGGGAGGAGG + Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027514210 7:79121801-79121823 AAGGAGAAACCAGAATCAAAGGG - Intronic
1027848239 7:83413525-83413547 AAAGAGAAACAAAATGCACTTGG + Intronic
1027946471 7:84751758-84751780 AAAGAAAAAAAAGATACAGAAGG + Intergenic
1028070543 7:86444631-86444653 AAGGAAAAAAAAGATTCAGCAGG + Intergenic
1028453306 7:91010708-91010730 AAGGAGAAAAAAGAAACATAAGG - Intronic
1028512605 7:91641751-91641773 GAGGAGAAAGATGATTCAGAAGG - Intergenic
1028761814 7:94505771-94505793 AAGGATAAACAAGGTTTAGAAGG + Intergenic
1030224956 7:107139842-107139864 AAGGGGAAAAAAGATGCAAGTGG - Intronic
1030318226 7:108137988-108138010 TTGGAGTAACTAGATGCAGAGGG + Intergenic
1030741012 7:113110067-113110089 AAGGAGAAGGAAGAAGTAGAAGG + Intergenic
1031005902 7:116471281-116471303 AAGGAGAAGCAAAATACAAATGG - Intronic
1031053966 7:116973747-116973769 TAATAGAAACAAGTTGCAGAAGG - Intronic
1031598238 7:123672215-123672237 AAGGATAAAGAAGACTCAGAGGG - Intergenic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031877789 7:127161736-127161758 AATGACAAACAAGATTCAAAGGG + Intronic
1032378839 7:131454222-131454244 AAGGAGAAAAAATCTGAAGACGG + Intronic
1032997761 7:137466944-137466966 TAGGGGAAAAAAAATGCAGATGG + Intronic
1034181627 7:149143474-149143496 AGGGAAAGTCAAGATGCAGATGG + Intronic
1034215621 7:149403530-149403552 AAGGAGAAACAAAAAAAAGAAGG - Intergenic
1034604180 7:152295676-152295698 AAGCAGAAACATGCTTCAGAGGG + Intronic
1035229611 7:157457028-157457050 AGGCAGAAACAATATGCAAATGG - Intergenic
1036197770 8:6735559-6735581 AAGGAGAAACAAGATGCAAGTGG - Intronic
1036508631 8:9379827-9379849 AAGGAGAAACCAGCAGTAGACGG - Intergenic
1036807560 8:11845879-11845901 AAGGAGAAACAGCTTCCAGAGGG + Intronic
1037222426 8:16540528-16540550 AAGGAGATAAAAAATGTAGAAGG + Intronic
1037809042 8:22075317-22075339 AAGAAGAAAGAAGAAGAAGAAGG - Intronic
1038250821 8:25902815-25902837 AAGGAGTCACAAGTTGGAGAGGG + Intronic
1039097511 8:33902368-33902390 AACTAGAAGCAAGATGGAGAAGG - Intergenic
1039317343 8:36387992-36388014 AAGGAGGAAGAAGAAGGAGAAGG - Intergenic
1039903762 8:41771440-41771462 AAGTATGAACAAAATGCAGATGG - Intronic
1041733212 8:61083756-61083778 AAGAAGAAAAAAGATGGAGATGG + Intronic
1041775219 8:61515439-61515461 AAGGAGAACCAAGAAGGAAATGG - Intronic
1042123394 8:65512168-65512190 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
1042130407 8:65582374-65582396 GAGGAGAAAGAAGAAGAAGAAGG + Intergenic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1043062800 8:75526508-75526530 AAGGAGAAAGGAGAAGGAGAAGG - Intronic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043270414 8:78326390-78326412 AAGGAGGAAAAAGAATCAGATGG - Intergenic
1043432478 8:80208321-80208343 AGGGAGAAACAATGTGCTGAAGG - Intronic
1043551985 8:81384955-81384977 AAGGAGAAATAAAATACTGAGGG - Intergenic
1044185019 8:89240418-89240440 AAGGAGGACCCAGATGAAGAAGG + Intergenic
1044622418 8:94203312-94203334 AAGAACAAAGAAGTTGCAGAAGG + Intronic
1044953154 8:97452921-97452943 AAGAAGAAAGAAGAAGGAGAAGG + Intergenic
1045913488 8:107438251-107438273 AAGGACAAAGAAGAGGTAGAAGG - Intronic
1046304629 8:112348477-112348499 AAGGAGAAACTAGAAGCAAGAGG - Intronic
1046911456 8:119631931-119631953 AAGAAAAATCAAGAAGCAGAAGG + Intronic
1047717792 8:127611619-127611641 AAGGAAACACAAGTTGCAGCTGG - Intergenic
1047850447 8:128851661-128851683 AAAGAGAAATCAAATGCAGATGG + Intergenic
1048397081 8:134024089-134024111 AAGAAGCAACTAGATGGAGAAGG + Intergenic
1048942656 8:139415260-139415282 AAGGAGGAGCAAGAAGCAGAAGG - Intergenic
1049913842 9:297114-297136 AAGGAGAAAGAAGATGTGAAAGG + Intronic
1050180171 9:2913929-2913951 AAGGAAGATCATGATGCAGACGG + Intergenic
1050536235 9:6633273-6633295 AAGGAAATAAAACATGCAGAAGG - Intronic
1050546751 9:6716059-6716081 AAGGCGAAACAAGAGGCCGCCGG + Intergenic
1050714654 9:8509173-8509195 ATTGAGAAGCAAGAGGCAGAGGG + Intronic
1050780642 9:9330149-9330171 AAGGAGAAAAGAGAAGCAGGGGG - Intronic
1051227455 9:14916382-14916404 AAGGAGGATCAAGATCCTGAAGG + Intergenic
1051303574 9:15681425-15681447 AAGAAGAAAGAAGAGGAAGATGG - Intronic
1052040773 9:23736451-23736473 AAGGAGAAAAAAGCAGCAGGGGG + Intronic
1052047778 9:23814392-23814414 AAGGATAAACAAGGGACAGAGGG + Intronic
1052169010 9:25370893-25370915 AAAGAGAAACAATAAGCAGAGGG + Intergenic
1052190334 9:25654101-25654123 AAGGAGAAAGAAGCTGGAGATGG - Intergenic
1052820320 9:33133362-33133384 AGAGAGAAACGAGATGCAGCTGG + Intronic
1052995242 9:34548421-34548443 ATGGAGACACAAGAGACAGAGGG + Intergenic
1053148375 9:35727382-35727404 AAGTAGAAACAAGAGACAGGAGG + Intronic
1053413735 9:37932997-37933019 AAGAAGAAAAAAAATCCAGAGGG + Intronic
1053503857 9:38622849-38622871 ATGGAGAAACAAGCCACAGACGG - Intergenic
1055749897 9:79493585-79493607 AAGGACAAAAAAAATGCTGATGG + Intergenic
1055758193 9:79577757-79577779 TAGGGTAAACAAGATACAGAAGG - Intronic
1056072971 9:83007935-83007957 AAGGAGAAAATAGATGGAGTTGG - Intronic
1056148803 9:83764233-83764255 AAGGTGAAACTAGGTGGAGAGGG + Intronic
1056549392 9:87639088-87639110 AAGGAGATACAGGAAACAGAAGG - Intronic
1057456283 9:95215320-95215342 AAGGAGAAACAAGAAAGTGAGGG + Intronic
1057814280 9:98282878-98282900 CAGCAGCCACAAGATGCAGAGGG - Intergenic
1057925128 9:99139818-99139840 GAGGAGAAAAAAGATGAAGGGGG - Intronic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1059201378 9:112420367-112420389 AATGATAAACAGTATGCAGAGGG + Intronic
1059525052 9:114983763-114983785 AAGGAGAAACAGGGACCAGAGGG - Intergenic
1059571372 9:115440045-115440067 AGTGAGAAACAATATGTAGAAGG - Intergenic
1059732713 9:117072944-117072966 GAGGAAAAACAAGACGAAGAAGG + Intronic
1060308926 9:122441769-122441791 AAGGAGAAACTAGCAGCAGGGGG + Intergenic
1060571174 9:124641874-124641896 ATGGAGAGACAAGAGGCAAAGGG + Intronic
1060731297 9:126038698-126038720 AAGGAGAAATAAGGTGTATAGGG + Intergenic
1061015730 9:127980166-127980188 AAGGCGAAAAAAGGTGGAGAGGG + Exonic
1185825345 X:3243943-3243965 AAAGAAAAACAGGAAGCAGAGGG + Intergenic
1185830195 X:3294297-3294319 AAGGAGAAAGAAGGAGGAGAAGG - Intergenic
1186361441 X:8846105-8846127 AAGGAGAAGGAAGAGGAAGAAGG - Intergenic
1186688852 X:11953513-11953535 AAGGAGAAACATTATTCAAAAGG + Intergenic
1187025800 X:15434188-15434210 AAGGAGAAAGAAGAAGGAGGAGG + Intronic
1187025808 X:15434246-15434268 AAGGAGAAAGAAGAAGGAGGAGG + Intronic
1187167543 X:16818537-16818559 AAGGAGAAAAAAGATGGAGAAGG - Intronic
1187182187 X:16953619-16953641 GAGGAAAAGCAAGTTGCAGAAGG - Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187399245 X:18945031-18945053 AAGCAGTAAAAACATGCAGAAGG + Intronic
1187536582 X:20146617-20146639 AAAAAGAAACAAGATGGAGTTGG - Intergenic
1187693367 X:21894179-21894201 AAGGAGAAATAAGATTTGGATGG + Intergenic
1188776450 X:34225990-34226012 AAAGAAAAAAAAGATGGAGAAGG - Intergenic
1188868993 X:35350845-35350867 AATGAGAAACAACGTGCAGAAGG + Intergenic
1190076353 X:47320126-47320148 AAGGAGACCCAAGCTGCACACGG + Intergenic
1190226187 X:48547320-48547342 AGAGAGAAACAAGAGTCAGAGGG + Intronic
1191821801 X:65318393-65318415 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic
1192924218 X:75738504-75738526 AAGGAGAAAGGAGAAGGAGATGG - Intergenic
1193102999 X:77636890-77636912 AAGAAGAAAGAAGAAGAAGAAGG + Intronic
1193284393 X:79695038-79695060 AAAGATAAAAAAGATGAAGAAGG - Intergenic
1193851808 X:86546404-86546426 AAGAAGAAAGAAGAAGAAGAAGG - Intronic
1194403207 X:93462594-93462616 ATGGAGAAAGAAGGTGAAGAGGG + Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1195461059 X:105124903-105124925 AAGGAGAAAGAAAATGCATTTGG - Intronic
1196028345 X:111067223-111067245 AATGAGAAACAAGATAAAGATGG - Intronic
1196731106 X:118942317-118942339 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1196815088 X:119658918-119658940 AAGTACAAACAAGCTACAGATGG - Intronic
1197313825 X:124939382-124939404 AAGTAGAAACATGAGGGAGAAGG - Intronic
1197620280 X:128740226-128740248 AAGGAGAAAAGAGATACTGATGG + Intergenic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198425214 X:136511780-136511802 AAGGAAGATGAAGATGCAGATGG + Exonic
1199525219 X:148784415-148784437 AAGGAGAGACAAGAGGAAGTTGG + Intronic
1199751591 X:150824491-150824513 AAGAAGAAAGAAGAAGAAGAAGG + Intronic
1200904279 Y:8465425-8465447 AAGAAGAAAGAAGAAGAAGAAGG - Intergenic