ID: 920228940

View in Genome Browser
Species Human (GRCh38)
Location 1:204457720-204457742
Sequence CCTAAAATTCAGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 531}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920228940_920228952 0 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228952 1:204457743-204457765 CTGCATGCGGGAGGGGCAGGGGG 0: 1
1: 0
2: 4
3: 48
4: 453
920228940_920228953 1 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228953 1:204457744-204457766 TGCATGCGGGAGGGGCAGGGGGG 0: 1
1: 0
2: 4
3: 55
4: 571
920228940_920228948 -7 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228948 1:204457736-204457758 TTTTAGGCTGCATGCGGGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 103
920228940_920228951 -1 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228951 1:204457742-204457764 GCTGCATGCGGGAGGGGCAGGGG 0: 1
1: 0
2: 4
3: 40
4: 409
920228940_920228950 -2 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228950 1:204457741-204457763 GGCTGCATGCGGGAGGGGCAGGG 0: 1
1: 0
2: 2
3: 53
4: 394
920228940_920228954 8 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228954 1:204457751-204457773 GGGAGGGGCAGGGGGGCAGCTGG 0: 1
1: 1
2: 35
3: 318
4: 2560
920228940_920228955 21 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228955 1:204457764-204457786 GGGCAGCTGGTTGAGAGCACTGG 0: 1
1: 1
2: 1
3: 22
4: 279
920228940_920228949 -3 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228949 1:204457740-204457762 AGGCTGCATGCGGGAGGGGCAGG 0: 1
1: 0
2: 8
3: 53
4: 438
920228940_920228946 -9 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228946 1:204457734-204457756 AATTTTAGGCTGCATGCGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
920228940_920228947 -8 Left 920228940 1:204457720-204457742 CCCTTTACCTTCTGAATTTTAGG 0: 1
1: 0
2: 4
3: 42
4: 531
Right 920228947 1:204457735-204457757 ATTTTAGGCTGCATGCGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920228940 Original CRISPR CCTAAAATTCAGAAGGTAAA GGG (reversed) Exonic
901767388 1:11511852-11511874 CCTACATTTCAGAAGATATATGG - Intronic
902084502 1:13848668-13848690 CCTATATTTCAGAGGGTATATGG + Intergenic
902164389 1:14558283-14558305 AGCAAAATTTAGAAGGTAAATGG + Intergenic
902971544 1:20056039-20056061 CCTAAATTCCAGAGGCTAAAAGG + Intronic
903429187 1:23279185-23279207 ACTAAAATACAGAAGTCAAATGG - Intergenic
903572012 1:24313022-24313044 TCTAAAGTACAGAATGTAAAAGG + Intergenic
904427327 1:30437439-30437461 CCTAGATTTCAGAAGATACATGG + Intergenic
904570081 1:31457075-31457097 AAGAAAATTCAGAAGGAAAATGG - Intergenic
904958285 1:34307090-34307112 CATAGAATTCAGAATGTAAATGG + Intergenic
906574450 1:46875336-46875358 CCAATAACTCAGAAGATAAATGG + Intergenic
906597521 1:47092568-47092590 CCAATAACTCAGAAGATAAATGG - Intronic
906838586 1:49110859-49110881 CATAAAAATCAGAAAATAAATGG - Intronic
909057956 1:70845138-70845160 CCTAGATTTCAGAAGATATATGG + Intergenic
910600419 1:89025749-89025771 ACTAAAATTGAGAAGGAAACAGG + Intergenic
910675302 1:89810189-89810211 GCTAAAATCCAGAGGGCAAATGG - Intronic
910744923 1:90562977-90562999 CATAAAATTCAAAAGGCAGAAGG - Intergenic
911242119 1:95478372-95478394 CCTAGATTTCAGAAGATATATGG + Intergenic
911829913 1:102537200-102537222 CCTAAATTTCAGAGGATATATGG - Intergenic
913401266 1:118436622-118436644 CATAAAATTCAGAGAGGAAAGGG - Intergenic
916585543 1:166146684-166146706 GCTCAAATTCAGAAGGCAGAGGG + Intronic
917583483 1:176400041-176400063 CCTAAAAAACTGAAGATAAAAGG - Intergenic
917806067 1:178614901-178614923 ACTAAAATTCAGAATGAAACTGG + Intergenic
918531157 1:185524075-185524097 CCTAGATTTCAGAGGGTATATGG - Intergenic
918638180 1:186805005-186805027 CATAAAAAGCAGAATGTAAAGGG - Intergenic
918847801 1:189641334-189641356 CCTAAAATTAGCAAGGTAATTGG - Intergenic
918877971 1:190074621-190074643 CCTAAAATCCAGAATCTATAAGG + Intergenic
918943342 1:191028664-191028686 CCTAAAATGCAGAAGAGAATGGG + Intergenic
919066019 1:192693589-192693611 CCTAGATTTCAGAAGATATATGG - Intergenic
920221452 1:204405647-204405669 CCCAAAATTCAGAAGTTAATGGG - Exonic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
920258013 1:204669576-204669598 GGTAAAATTCTGAAGGTACAGGG + Intronic
920560733 1:206936699-206936721 CCTCACATTCAGATGGAAAAAGG - Intronic
921000586 1:211039274-211039296 CCTAGATTTCAGAAGATACATGG + Intronic
921724365 1:218507755-218507777 CCTAAATTTCAGAGGATATATGG + Intergenic
922819735 1:228476005-228476027 ACAAAACTTCAGAAGATAAAGGG + Intergenic
924929880 1:248721115-248721137 ACTAATATTCAGAATATAAAAGG + Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064277139 10:13916387-13916409 CCCAAAATCCAGAAGGGGAATGG - Intronic
1065226074 10:23545176-23545198 CCTAGAATTCAGAATATATATGG + Intergenic
1065246488 10:23764069-23764091 CCTAATATCCAGAATTTAAAAGG + Intronic
1065347742 10:24764964-24764986 CCTAGATTTCAGAAGATATATGG - Intergenic
1065893734 10:30142975-30142997 TCTAAAATTCGGCAGGAAAAAGG - Intergenic
1066203481 10:33164222-33164244 CATTTAATTCAGAAGGGAAATGG + Intergenic
1067872295 10:49972268-49972290 CCTAAAGTGCCGAATGTAAAGGG - Intronic
1067911456 10:50350760-50350782 CCTAAATTTCAGAAGATGTATGG + Intronic
1068533487 10:58214389-58214411 GCTAAAAGTCAGAAGGAAAGAGG + Intronic
1069268211 10:66490187-66490209 TATAAAATTAAGAAGTTAAATGG - Intronic
1070013439 10:72499569-72499591 AATAAGATTAAGAAGGTAAAAGG - Intronic
1070090045 10:73275718-73275740 CCTCAACTTCAAAAGGTAAAGGG + Intronic
1070148385 10:73790881-73790903 CCCAAAATACAGAAGATAGAGGG - Intronic
1072391853 10:94995190-94995212 AAAAAAATTCAGAAGGAAAAAGG - Intergenic
1072403687 10:95130023-95130045 CCTAAATTTCAGAAGATGTATGG + Intergenic
1073846980 10:107567970-107567992 CCTAGATTTCAGAAGATATATGG - Intergenic
1074704842 10:116121444-116121466 CCTAAAATGGAAAAGGAAAAAGG + Intronic
1077596626 11:3537578-3537600 CCTAGACTTCAGAAGGTGAATGG - Intergenic
1077770420 11:5212252-5212274 CCTAATATTCAGAATCTATAAGG - Intergenic
1078373653 11:10774221-10774243 CAAAAGATTCAGAAGGTAAAAGG - Intronic
1078911077 11:15732840-15732862 CATAAAAATTAGAAGGTAAGTGG - Intergenic
1079019125 11:16894637-16894659 CCCAAAATGAAGAAGGTGAATGG + Intronic
1079525013 11:21375926-21375948 CCTAATATTCAGAATATATAAGG - Intronic
1079657833 11:23003925-23003947 CCTAAATTTCAGAAGATGTATGG - Intergenic
1079713689 11:23718171-23718193 CCTAAAGTTCAGAGGATATATGG + Intergenic
1079724150 11:23859051-23859073 CCTAATATTCAGAATCTACAAGG + Intergenic
1080153377 11:29078748-29078770 CCTAGATTTCAGAAGATATATGG + Intergenic
1080838453 11:35962407-35962429 CCCAAAATTCAGGAAGAAAAAGG - Intronic
1081779446 11:45699805-45699827 CCTCAAATTCAGAACCCAAATGG + Intergenic
1083528059 11:63390054-63390076 CCTAATATCCAGAATGTACAAGG - Intronic
1085968673 11:81560366-81560388 CCTAAAATTTAGAACTGAAATGG - Intergenic
1086312982 11:85556636-85556658 CCTAAAATCCAAAAGCTTAAGGG + Intronic
1086444304 11:86857992-86858014 CCTAATATCCAGAAGGCAAGAGG + Intronic
1086509360 11:87540246-87540268 CCTCAAGTTAAAAAGGTAAATGG - Intergenic
1086995734 11:93353616-93353638 CCTAGATTTCAGAAGATATACGG - Intronic
1087439829 11:98169296-98169318 TCTAATATTCAGAATCTAAAAGG + Intergenic
1087550207 11:99639059-99639081 CCTAGATTTCAGAAGATATATGG - Intronic
1088992608 11:114967048-114967070 CCTGCAGATCAGAAGGTAAAGGG + Intergenic
1091345305 11:134848744-134848766 TCTGAAATTCGAAAGGTAAAAGG + Intergenic
1092422796 12:8346351-8346373 CCTAGACTTCAGAAGGTGTATGG - Intergenic
1093855560 12:24098038-24098060 ACTAAAATTCATAAAGTAAAAGG - Intergenic
1094018485 12:25889083-25889105 GCGAAACTTCAGAGGGTAAAGGG - Intergenic
1095239389 12:39838933-39838955 CCTAAATTTCAGAAAATCAATGG + Intronic
1095511150 12:42952953-42952975 CCTAGATTTCAGAAGATATATGG + Intergenic
1096162312 12:49389026-49389048 CTTAAAAATCAGAAGAAAAAAGG - Intronic
1096528595 12:52229513-52229535 CATAAAGTTCAGCAGGTACATGG + Intergenic
1097356072 12:58603429-58603451 TATAAAATTCTGAAGGAAAATGG + Intronic
1098293605 12:68981957-68981979 CCTTAAATTCAAAAGGAAAAGGG - Intergenic
1098761856 12:74434953-74434975 CCTAGATTTCAGAGGATAAATGG + Intergenic
1099287245 12:80729395-80729417 ACAAAATTTCAGAAGGTAGATGG - Intergenic
1099580447 12:84440067-84440089 CTCAAAATCCAGAAGGGAAAGGG - Intergenic
1099663484 12:85596550-85596572 CCTAAAATTCAGAGGATGTATGG - Intergenic
1099780081 12:87183168-87183190 CCTAGATTTCAGAAGATATATGG + Intergenic
1100962261 12:99975695-99975717 CCTAATATCCAGAAGCTATAGGG - Intronic
1101117819 12:101549248-101549270 CCTAGATTTCAGAAGATATACGG - Intergenic
1101251512 12:102940347-102940369 CATAAAATTCAGAATCTAGATGG + Intronic
1102801280 12:115736682-115736704 CCTAAAATTAAAAAGGGAAATGG + Intergenic
1103588437 12:121973299-121973321 CCTAGATTTCAGAAGGTGTATGG + Intronic
1106262304 13:28078308-28078330 CCTAGATTTCAGAAGATATATGG - Intronic
1106541357 13:30693048-30693070 ACTAATATTCAGAAGCTACAAGG - Intergenic
1108150656 13:47530594-47530616 CATAAAATACAGGAGGAAAATGG + Intergenic
1108749046 13:53427652-53427674 TCTAATATCCAGAAGCTAAAAGG - Intergenic
1109591996 13:64497273-64497295 CTTAAAATTCAGATATTAAAAGG + Intergenic
1109810716 13:67509424-67509446 CCTAGATTTCAGAAGGTGTATGG + Intergenic
1110083383 13:71345771-71345793 CCTAGATTTCAGAAGATATATGG - Intergenic
1110511445 13:76355883-76355905 CCTAAATTTCAGAGGATATATGG + Intergenic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1110835913 13:80082646-80082668 CCTAAAATTCAGCAAGCACAAGG - Intergenic
1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG + Intronic
1113195188 13:107795572-107795594 CTCAAAATTCAGAAGGTAGAAGG + Intronic
1113264325 13:108600594-108600616 ACTAAAAAACAAAAGGTAAATGG + Intronic
1113280530 13:108782885-108782907 CCTAGATTTCAGAAGGTGTATGG + Intronic
1116389618 14:44376998-44377020 CCTAGATTTCAGAAGATATATGG - Intergenic
1116517821 14:45821074-45821096 CCTAATATCCAGAGGGTAAGAGG + Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1116854189 14:49937539-49937561 CCTAGATTTCAGAAGATATATGG + Intergenic
1116984184 14:51202690-51202712 CATAGAATTCAGAAGCTAGATGG - Intergenic
1117207083 14:53454344-53454366 CCTAAAATTCAGAAGTAACTGGG + Intergenic
1117301246 14:54430545-54430567 TTTAAAATTAAGATGGTAAAAGG - Intronic
1118092119 14:62493591-62493613 ACTAAAATTGAGAAGGAAAGTGG - Intergenic
1118226479 14:63904693-63904715 CCTAATATTCAGAATCTATAAGG - Intronic
1118513951 14:66507171-66507193 TTTAAAATTCAGAAGTTGAAAGG + Intergenic
1118879242 14:69811941-69811963 ACTGAAATTGAGAAGGTGAACGG + Intergenic
1121524969 14:94613325-94613347 CCTAGAATTCAGAAGAGAAAAGG - Exonic
1121699555 14:95942285-95942307 CCTAGATTTCAGAGGGTATATGG + Intergenic
1123883825 15:24702776-24702798 TCTAATATTCAGAATGTATAAGG - Intergenic
1124343022 15:28902061-28902083 CATAAAAACCCGAAGGTAAAGGG + Intronic
1124478011 15:30052496-30052518 ACTAATATTCAGAATGTACAAGG - Intergenic
1125119953 15:36144360-36144382 CCTACAATTAAGAAGTAAAAAGG + Intergenic
1125304219 15:38291564-38291586 CCTACATTTCAGAAGATATATGG - Intronic
1129566448 15:76628159-76628181 CCTAATATCCAGAATCTAAAAGG - Intronic
1130263367 15:82377064-82377086 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130277936 15:82492602-82492624 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130470266 15:84219787-84219809 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130477754 15:84334354-84334376 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130494011 15:84453776-84453798 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130592555 15:85224415-85224437 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130642431 15:85691223-85691245 CCTACCATTCACAAGGTAAGAGG - Intronic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132440178 15:101854835-101854857 CTTAAAATTCAGAACTCAAATGG + Intergenic
1133124699 16:3638990-3639012 CATATATTTAAGAAGGTAAAGGG - Intronic
1133902416 16:9989651-9989673 GCTAATATTCAGAAGCTATAAGG + Intronic
1137352944 16:47730084-47730106 GGTATAATTCAGATGGTAAATGG - Intergenic
1137970105 16:52976060-52976082 ACTAAAATGCAGAAGAAAAAAGG + Intergenic
1138889594 16:61126401-61126423 CATAACCTTCAGTAGGTAAATGG - Intergenic
1139124627 16:64063148-64063170 TCCAAAATTCAGCAGGTGAAAGG + Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1140019532 16:71224894-71224916 CTAAAATTTCAGAAGGGAAATGG + Intronic
1140384921 16:74527644-74527666 CCTAAATTCTTGAAGGTAAAAGG - Intronic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1140623249 16:76762301-76762323 CAGAAAACTCAGAAGGTAAAGGG - Intergenic
1141743257 16:85908548-85908570 CCTAAAATTTAGCATGAAAAGGG - Intronic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143002640 17:3804638-3804660 CCTAAGAGTCAGAAGGCAAGTGG - Intergenic
1145199619 17:20931472-20931494 CCTAAAATTAGCAAGGTAATTGG - Intergenic
1146107838 17:30058460-30058482 ACTGGAATTGAGAAGGTAAAGGG - Intronic
1146339757 17:32008245-32008267 CCTAAACTTTAGAGGGGAAATGG + Intronic
1147520027 17:41162194-41162216 CATAATATTCCTAAGGTAAAGGG - Intergenic
1148518466 17:48245020-48245042 GCCAAAATTCTGAAAGTAAAGGG - Intronic
1149348468 17:55762953-55762975 CCTACAATTCAAATAGTAAAAGG - Intronic
1149894306 17:60417309-60417331 CCAAAAATACAGAACATAAAAGG - Intronic
1150163203 17:62916557-62916579 CCGAGAGTTCAGAGGGTAAAAGG - Intergenic
1151118400 17:71765040-71765062 CCTTAAATTTAAAATGTAAATGG + Intergenic
1152311345 17:79551990-79552012 CCTAAAATTCAGTAGGCATAGGG + Intergenic
1153000073 18:446856-446878 CTTTAAATTCTGAAGATAAATGG - Intronic
1153181902 18:2444727-2444749 CCTATGCTTCAGAAGGGAAAGGG + Intergenic
1154049767 18:10943047-10943069 CCTAGATTTCAGAAGATACATGG + Intronic
1154225103 18:12496341-12496363 TCTAAAATTATGAATGTAAATGG + Intronic
1155391473 18:25342018-25342040 CCTAGAGTACAGAGGGTAAATGG + Intronic
1155763142 18:29591006-29591028 TCTAATATTCAGAATGTACAAGG + Intergenic
1155823955 18:30415514-30415536 ACGAAACTTCAGAAGGTAAAGGG - Intergenic
1155958746 18:31976214-31976236 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1156357667 18:36356476-36356498 AATAAAAATCAGAAGGAAAAAGG - Intronic
1156926831 18:42591809-42591831 CCTAATATTCAGAATCTATAAGG - Intergenic
1157795689 18:50572704-50572726 GAGAAAATTCAGCAGGTAAATGG - Intronic
1157963265 18:52180489-52180511 GCTAAAATCCAGAAGGAGAAAGG + Intergenic
1158875048 18:61725520-61725542 CCTAAAATTCAGGAGGCAAATGG - Intergenic
1159168105 18:64727046-64727068 ACTACAATTTAGCAGGTAAAAGG + Intergenic
1159641205 18:70864847-70864869 CCTAAATTTCAGAAGTTGTATGG + Intergenic
1160250018 18:77194670-77194692 CCTAATATCCAGAATGTATAAGG - Intergenic
1163076788 19:14899789-14899811 CCTAAACTTCATAAGGTAAGTGG - Intergenic
1164044167 19:21520277-21520299 CCTAAAATTCAGATGTCCAAGGG + Intronic
1165560862 19:36678504-36678526 GCTAATATTCAAAATGTAAAAGG + Intergenic
1166237684 19:41468382-41468404 CCTAATATTCAGAAAGGGAAAGG - Intergenic
1166243955 19:41512622-41512644 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166244715 19:41517209-41517231 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1167876123 19:52414182-52414204 ACTGAAATTCACAAGGTGAATGG - Intronic
925027050 2:618298-618320 CCTAAAATGCTGAAAGCAAAGGG + Intergenic
926157334 2:10463872-10463894 CCTATAATTCAGTAACTAAAGGG + Intergenic
926375206 2:12220278-12220300 CCCATGATCCAGAAGGTAAAAGG + Intergenic
928012087 2:27618732-27618754 TTTAAAGTTCAGAAGGTCAAGGG + Intronic
928680134 2:33693035-33693057 CCTAGATTTCAGAAGATATATGG - Intergenic
928808077 2:35186141-35186163 CTTAAAATAGATAAGGTAAAAGG - Intergenic
928892647 2:36222065-36222087 ACCATAATTCTGAAGGTAAATGG + Intergenic
929591423 2:43149613-43149635 TCTGAAACTCAGAAGGGAAAGGG + Intergenic
930633410 2:53779264-53779286 ATTAAAATTCAGAATATAAAAGG - Intronic
931334594 2:61326752-61326774 CCTAGCATGCAGAAGGTCAATGG + Intronic
931823906 2:65979580-65979602 CCAAAAATACAAAATGTAAATGG - Intergenic
932912277 2:75818330-75818352 CCTAGATTTCAGAAGATATATGG - Intergenic
933047590 2:77558268-77558290 CCTAGATTTCAGAAGATATATGG + Intronic
933064175 2:77773051-77773073 CCTAGATTTCAGAAGATGAATGG - Intergenic
933118613 2:78505979-78506001 TCTAATATTCAGAATCTAAAAGG + Intergenic
933165890 2:79074270-79074292 ACTATAATTGAGAAGTTAAATGG - Intergenic
934039511 2:88116296-88116318 CCTCCAGTTCAGAAGGGAAAGGG - Intergenic
935302893 2:101708924-101708946 CCTAAAATTCAGCAATAAAAAGG - Intronic
935373601 2:102373225-102373247 TTTAAAATTCAACAGGTAAAAGG - Intronic
937166268 2:119821066-119821088 GATAGAATTCAAAAGGTAAATGG - Intronic
937988784 2:127650842-127650864 GATAAAATCCAGAAGGTAGAAGG - Exonic
938211947 2:129474462-129474484 ACTAAGATTCAACAGGTAAATGG - Intergenic
938889788 2:135692628-135692650 CCTAAAATTCAGATGCTCTATGG - Intronic
939075170 2:137592435-137592457 GCTAAAATACAGAAATTAAAGGG - Intronic
940381344 2:153018167-153018189 CCTAGATTTCAGAAGGTGTATGG - Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
941267664 2:163383138-163383160 TCTAATATTCAGAATCTAAAAGG - Intergenic
941318254 2:164022027-164022049 GCTAAAGTTCATAAAGTAAAAGG + Intergenic
941505200 2:166335508-166335530 TCCAAAATTTAGAAGGTCAACGG - Intronic
941711401 2:168718036-168718058 AGTAAAATTCAAAAGGAAAATGG - Intronic
941741894 2:169044278-169044300 CCTAGATTTCAGAAGATATATGG + Intergenic
942051836 2:172147362-172147384 GCAAAACTTCAGAGGGTAAAGGG - Intergenic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
943029052 2:182665330-182665352 CCTAATATTCAGAAGCTACAAGG + Intergenic
943092939 2:183395764-183395786 CCTAGATTTCAGAAGATATATGG + Intergenic
943159044 2:184222748-184222770 CTAAAAATTCAGAAAATAAAAGG - Intergenic
943409111 2:187523417-187523439 CCTATAAGTCTAAAGGTAAAAGG - Intronic
943458801 2:188143386-188143408 GCTAAAATACAGAAAGCAAAGGG - Intergenic
943514499 2:188867526-188867548 GCTAATATTCAGAATCTAAAAGG + Intergenic
943615859 2:190091713-190091735 CCTAAAATTCTGTAGTTGAAAGG - Intronic
943703360 2:191010900-191010922 CCTAAAATTCATTAGGAAAACGG + Intronic
944573470 2:201068548-201068570 CGTAAAATTCTGAAGGGAAGTGG + Intronic
944860709 2:203813398-203813420 CATAAAATACAAAATGTAAAGGG - Intergenic
945404416 2:209426882-209426904 TCTAAACATCAGAAGGGAAAAGG + Intronic
945433789 2:209795796-209795818 CCTATATTTCAGAAGATATATGG + Intronic
945483551 2:210368844-210368866 AAGAAAATTCAGAAGGAAAATGG - Intergenic
946560088 2:220902986-220903008 CCAGAAATTCAGTTGGTAAAAGG + Intergenic
946580977 2:221128064-221128086 CCTAAATTTCAGAGGGTGTATGG + Intergenic
946663194 2:222022661-222022683 CCTAATATTCAGAACCTATAGGG + Intergenic
946868633 2:224065673-224065695 GCAAAGATTCAGAAGGCAAAAGG + Intergenic
946904753 2:224405596-224405618 CCTAAAAGTCAGTATGAAAAGGG + Intergenic
946996474 2:225398047-225398069 ACAAAAATTCAAAAAGTAAAAGG - Intergenic
1169312096 20:4551849-4551871 CATAGAATTCAGAAGTTAAATGG + Intergenic
1170505253 20:17018985-17019007 CCTAAAAGTCAAAATCTAAAAGG - Intergenic
1170547738 20:17449352-17449374 CCTAAAACCCAAAAGGGAAATGG - Intronic
1170930017 20:20761273-20761295 ACTAAAATGCAGTTGGTAAAGGG + Intergenic
1171453102 20:25249644-25249666 TCTAAAATGGAGATGGTAAAAGG + Intronic
1171492319 20:25529881-25529903 GGTAAAATTCAGAATGTGAAAGG + Intronic
1173139713 20:40471157-40471179 CTTATAATTCAGCAGGGAAAAGG + Intergenic
1174085118 20:48002163-48002185 CCTAAAAATCAGTAAGAAAAAGG - Intergenic
1174236181 20:49094174-49094196 CCTGAAATTCAGAAGGTATCTGG + Exonic
1174375148 20:50121684-50121706 CCCAGAATTCAGAAGTGAAATGG + Intronic
1177358352 21:20037642-20037664 CCTAGATTTCAGAAGATACATGG + Intergenic
1177418369 21:20824372-20824394 GCAAAAATTCAGGAGGTAAAAGG - Intergenic
1177664720 21:24140149-24140171 CCTAATATTCAGAATCTATAGGG + Intergenic
1179333498 21:40428088-40428110 CCTAAATTTCAGAAACTTAAAGG - Intronic
1179420297 21:41230484-41230506 TCAAAAATTGAGAAGGCAAAAGG - Intronic
1179936678 21:44610491-44610513 CCTAGATTTCAGAAGATATATGG + Intronic
1180857145 22:19055661-19055683 CCTAAAATTCACATAGAAAAGGG + Intronic
1183001624 22:34864363-34864385 CGTGAACTTCAGAAGGTAAGAGG - Intergenic
1183215899 22:36479764-36479786 GCTAAAATTCAGAAGGCCAGAGG + Intronic
1184328974 22:43813571-43813593 CCTATAATAAAGAAGGCAAATGG - Intergenic
1184623504 22:45702453-45702475 CATAGAACTCAGAAGGCAAAAGG - Intronic
1184713256 22:46265547-46265569 CCTAGATTTCAGAAGATATATGG - Intergenic
1185021094 22:48376433-48376455 CCTAAAACTCAGAAGAAAAAAGG + Intergenic
949373457 3:3361109-3361131 TCTCAAATTTAGAAGCTAAAAGG - Intergenic
949504722 3:4716471-4716493 ACTACTATTCAGAAGGGAAATGG - Intronic
951146098 3:19229379-19229401 CCTAGATTTCAGAAGGTATACGG - Intronic
951351819 3:21615559-21615581 AATAAAATACAGAAGTTAAATGG - Intronic
952987487 3:38799082-38799104 CCTGATATTAAGAAGGCAAAAGG - Intergenic
953833597 3:46324207-46324229 CCTATGATTCAGAAGGCAGACGG - Intergenic
954939538 3:54358801-54358823 ACTAAAAGTCAAAAGGTAGAGGG + Intronic
955026103 3:55169211-55169233 CCTCAAGGTCATAAGGTAAATGG + Intergenic
956033202 3:65061697-65061719 CCAAAGATTCAGAAGCAAAATGG + Intergenic
956807921 3:72835557-72835579 TCTACATTTCAGAGGGTAAATGG + Intronic
957340037 3:78883879-78883901 CCTGAAATTCAGAGAATAAAAGG + Intronic
957494268 3:80970088-80970110 CTTAAAATTCTGAAAGGAAATGG - Intergenic
957572390 3:81963956-81963978 CTTAAAATTTAGAAAGGAAAAGG - Intergenic
957870312 3:86083154-86083176 CCTAGATTTCAGAAGATAGATGG - Intergenic
957873114 3:86112738-86112760 CCTAGATTTCAGAAGGTGTATGG + Intergenic
957909510 3:86603702-86603724 CCTAGATTTCAGAAGATATATGG + Intergenic
958687676 3:97420927-97420949 CTTAACATTCAGCAGATAAAAGG + Intronic
958688054 3:97425338-97425360 CCTATATTTCAGAGGGTATATGG - Intronic
958837207 3:99159255-99159277 CCTAAATTTCAGAGGATATATGG - Intergenic
959161326 3:102728494-102728516 CTTAGAATTCACAAGGTATACGG + Intergenic
959267267 3:104158200-104158222 CCTCAAACTCAGAAGATTAAAGG + Intergenic
959831893 3:110874174-110874196 TCTAAAATTCAGGACATAAAAGG - Intergenic
959901197 3:111663478-111663500 CCTAATATCCAGAATTTAAAGGG + Intronic
960091546 3:113644830-113644852 GATAAAATAGAGAAGGTAAAAGG - Intergenic
960858802 3:122130415-122130437 TCTAATATTCAGAATATAAAAGG + Intergenic
961900227 3:130202907-130202929 CCTAGACTTCAGAAGGTGTATGG - Intergenic
962170788 3:133099100-133099122 CCTAGATTTCAGAAGATGAATGG - Intronic
962290520 3:134132823-134132845 CCTATAATTCATAAAGGAAAAGG + Intronic
962869863 3:139478734-139478756 ACTAAAATTAAAAAGGTAATAGG + Intronic
964186959 3:153957400-153957422 CATAAAACTCATAAGGGAAAGGG - Intergenic
964696429 3:159512976-159512998 CTTAAAATACAGCAGGTGAATGG + Intronic
964810487 3:160658394-160658416 CCTGATATTCAGAATCTAAAAGG - Intergenic
965325237 3:167294807-167294829 GCTAATATTCAGAATCTAAAAGG + Intronic
966138254 3:176725804-176725826 CCTTAAAGTCATATGGTAAAAGG + Intergenic
966569021 3:181419543-181419565 CTTTAAATTTAGAAAGTAAAAGG + Intergenic
966670223 3:182517953-182517975 CATGGAATTCAGAAAGTAAAAGG - Intergenic
966695059 3:182781026-182781048 CCTCAAATTCTGAAACTAAAGGG - Intergenic
967944246 3:194790110-194790132 ACTAAAATTCAGAATATACAAGG - Intergenic
968253573 3:197245670-197245692 AAGAAAACTCAGAAGGTAAATGG - Intronic
969011202 4:4064057-4064079 CCTAGATTTCAGAAGGTGTATGG - Intergenic
969253315 4:5985117-5985139 CCTAAAATTCAGAATCCAATGGG + Intronic
969742870 4:9045841-9045863 CCTAGATTTCAGAAGGTGTATGG + Intergenic
970077113 4:12235399-12235421 CCTAAAATTAATATGGTAACAGG - Intergenic
970518042 4:16853464-16853486 CCAAAAAGTCAAAAGATAAATGG + Intronic
970831961 4:20350559-20350581 CCTAAAATCCAGAAAACAAATGG + Intronic
971721346 4:30248744-30248766 ACTAATATTCAGAACGTACAAGG - Intergenic
973025495 4:45264462-45264484 CGTAAAAATCAGCAGGTATACGG - Intergenic
973222784 4:47747928-47747950 GCTAAATTTCAAAAGGTAACAGG + Intronic
973339258 4:48986851-48986873 TTTAAAATTCAGAAGGAAAGGGG + Intronic
973890617 4:55364052-55364074 CCTACAATTCAGAAGGCAACAGG - Exonic
974037235 4:56827728-56827750 CCTAGATTTCAGAAGATGAATGG + Intergenic
974269607 4:59633425-59633447 CCTAAATTTCAGAAGATGTATGG - Intergenic
974613160 4:64242707-64242729 GCTAAAATCCAGGAGGAAAATGG + Intergenic
974762607 4:66297633-66297655 CCTCAAATTTTGAATGTAAATGG + Intergenic
975864590 4:78713812-78713834 GCAAAACTTCAGAAGGCAAAGGG + Intergenic
976846901 4:89499282-89499304 CCTAAAATGAAGAAAGTAAAGGG - Intergenic
976883831 4:89962489-89962511 CCTGCAATTTAGAAGGTCAAGGG + Intergenic
976985972 4:91298457-91298479 AATAAAATTTTGAAGGTAAAAGG - Intronic
977189138 4:93977896-93977918 CCTAAATTTCAGAAGATGTACGG + Intergenic
977461066 4:97325914-97325936 TCTAAAATTCAGAATTTACAAGG - Intronic
977702508 4:100036146-100036168 CCTAGATTTCAGAAGATATACGG - Intergenic
977983965 4:103360325-103360347 CCTAAATTTCAGAAGATATATGG + Intergenic
978408648 4:108405687-108405709 CCTAAATTTCAGAAGATGCATGG - Intergenic
978479886 4:109176907-109176929 CCTAGAGTTCAGAAGGAACATGG + Intronic
978915696 4:114124027-114124049 CCTAAATTTCAGAAGATTTATGG - Intergenic
979143279 4:117205747-117205769 CCTAATATTCAGAATCTATAAGG + Intergenic
979146169 4:117251457-117251479 CCTAAATTTCAGAGGGTGTATGG + Intergenic
979295735 4:119030916-119030938 TTCAAAATTCAGAAGGCAAACGG + Exonic
979712524 4:123796964-123796986 CCTAAAATCCAGAAGGGATTAGG - Intergenic
979874866 4:125875696-125875718 CCTATTTTTTAGAAGGTAAAAGG + Intergenic
979989813 4:127362494-127362516 CCTGGAATTCAGGAGGTATATGG + Intergenic
980185114 4:129451321-129451343 CCTAATATTCAGAATATACAAGG + Intergenic
980530351 4:134044977-134044999 CCTAATATTCAGTATGTTAATGG + Intergenic
980970822 4:139565476-139565498 TCTAAAATTAATAAAGTAAATGG - Intronic
981170790 4:141621061-141621083 TCTAAAATCCAAAAGGGAAATGG + Intergenic
981252093 4:142615655-142615677 CCTAAACTCCAAAAGGGAAAGGG + Intronic
981253577 4:142633668-142633690 AATAAAATTTAGAAAGTAAAAGG + Intronic
981426213 4:144606407-144606429 GCTAGAATTCAGAGGATAAATGG + Intergenic
981539241 4:145831765-145831787 CTTAAAATGCAGGAGGAAAAAGG + Intronic
981799342 4:148637434-148637456 CCTAGATTTCAGAAGATATATGG - Intergenic
981876989 4:149558838-149558860 TCCAAAATTCAGAAGGGAATTGG - Intergenic
981918702 4:150063131-150063153 CCTTAGATTAAGAAGGAAAATGG - Intergenic
982047855 4:151467091-151467113 TCTAATATTCAGAATCTAAAAGG + Intronic
982500185 4:156144501-156144523 CCTAAAATTCATATGTTGAAAGG - Intergenic
982502941 4:156181029-156181051 CTTATAAATCAGAAGGAAAAGGG + Intergenic
982714517 4:158792807-158792829 CTTAGAATGGAGAAGGTAAATGG + Intronic
983151990 4:164295585-164295607 CATAATATTCAGGAGGGAAATGG + Intronic
983157158 4:164363014-164363036 CCAACAACCCAGAAGGTAAAAGG + Intronic
983303931 4:165962187-165962209 CCTAATATTCAGAATGCACAAGG + Intronic
983423337 4:167549200-167549222 TCTAAAATGCAGACGGAAAAGGG + Intergenic
983778110 4:171633747-171633769 TCTAATATTCAGAAGCTATAAGG - Intergenic
983785916 4:171729302-171729324 CCTAGATTTCAGAAGGTATATGG + Intergenic
984774278 4:183467148-183467170 CCTAGATTTCAGAAGATATATGG + Intergenic
985022170 4:185703173-185703195 TCTAAAATTGAGAAGCTCAAGGG - Intronic
985176122 4:187203537-187203559 CCTAAAATTCAGTATGTATGAGG + Intergenic
985617090 5:929578-929600 CCTAGATTTCAGAAGATACATGG + Intergenic
985617760 5:934345-934367 CCTAGATTTCAGAAGATATATGG - Intergenic
986378119 5:7153916-7153938 CCTAATATCCAGAATGTACAAGG - Intergenic
986549511 5:8936735-8936757 CATAAAATTCAGAATCTAGATGG + Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
986656766 5:10020541-10020563 GCTAAAATTTAGGGGGTAAAAGG + Intergenic
986756751 5:10843935-10843957 CCTAAATTTCAGAAGATGTATGG - Intergenic
986935100 5:12874378-12874400 CCTAATATCCAGAATCTAAAAGG - Intergenic
987168221 5:15223165-15223187 TCTAAAACACAGAAAGTAAAAGG - Intergenic
987373494 5:17214663-17214685 TCTAAAATTCAGAACTTTAAAGG + Intronic
987531812 5:19130759-19130781 CCTAGATTTCAGAAGATATATGG - Intergenic
987655467 5:20800418-20800440 CCTAGATTTCAGAAGATAAATGG + Intergenic
987875561 5:23675981-23676003 TCTAATATTCAGAATCTAAAAGG - Intergenic
988163368 5:27550503-27550525 CCTAAAAGCCAGAAGGTATTGGG - Intergenic
988199920 5:28054685-28054707 CCTAGAGTTCAGAAGATACATGG - Intergenic
988647047 5:33105974-33105996 ACTTAAATTCAGAAGGTAAATGG - Intergenic
988649423 5:33131877-33131899 CCTAGATTTCAGAAGGTATATGG + Intergenic
988668936 5:33360313-33360335 CCTAGATTTCAGAAGATATATGG - Intergenic
988740101 5:34061534-34061556 CCTAGATTTCAGAAGATATATGG - Intronic
988768089 5:34403484-34403506 CCTAGATTTCAGAAGATAAATGG - Intergenic
988934997 5:36072914-36072936 ACTAATATTCAGAAGCTATAAGG - Intergenic
989499732 5:42151405-42151427 CCTAATATTCAGAATCTACAAGG - Intergenic
989556733 5:42805387-42805409 CCTAAAAATTAGAAGTTTAAAGG + Intronic
989641010 5:43583233-43583255 GCAAAACTTCAGAAGGCAAAGGG - Intergenic
990022941 5:51150713-51150735 CCTAATATTCAGAATATATAAGG + Intergenic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
992326507 5:75665381-75665403 CCTAAATGTCACAAGGGAAAGGG - Intronic
992666278 5:79012629-79012651 CCTAAATTTCAGAAGATGTATGG - Intronic
992739241 5:79756395-79756417 GCTAACATTCAGAAAGCAAAGGG - Intronic
992763635 5:79974097-79974119 CCCAAAACATAGAAGGTAAAAGG - Intergenic
993293813 5:86109139-86109161 CCTAGATTTCAGAAGATATATGG + Intergenic
993465159 5:88236251-88236273 ACTAGACTTCAGAAGATAAAGGG + Intronic
993703892 5:91148531-91148553 CCTATATTTCAGAGGGTATATGG + Intronic
993931145 5:93942017-93942039 CCAAAATTCCAGAAGGTAATTGG + Intronic
994315675 5:98330410-98330432 CCTAAAATACAGAAGGCATCCGG + Intergenic
994325990 5:98445715-98445737 TCTAAAAATCAGAAAATAAATGG + Intergenic
994400698 5:99275653-99275675 CCTAGATTTCAGAAGATATATGG + Intergenic
996010924 5:118480517-118480539 CCTAAAAGCCAGAAGGAAATGGG + Intergenic
996503590 5:124243613-124243635 CCTAAATTTCAGAGGATATACGG + Intergenic
996617401 5:125458017-125458039 CCTAGATTTCAGAAGATATATGG + Intergenic
996698716 5:126426997-126427019 CATAAAATTCAGAATGAAAAAGG - Intronic
996973609 5:129403301-129403323 CCTAAAGTACAGAAGAGAAATGG + Intergenic
997179129 5:131810031-131810053 GCTAAAATTCAGAAAGTTTAAGG + Intronic
997966727 5:138363091-138363113 CCTAACCCTCAGAAGGTAGAGGG + Intronic
998724172 5:144990257-144990279 CCTAAAATTAAGAACCAAAAAGG - Intergenic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999346090 5:150820710-150820732 CCTAGATTTCAGAAGATGAATGG - Intergenic
999473695 5:151878794-151878816 CCTAGATTTCAGAAGGTGTATGG + Intronic
999696843 5:154194679-154194701 GCTTAGATTCAGAAGGGAAAAGG + Intronic
1000226534 5:159266892-159266914 CCTAGATTTCAGAAGATATATGG + Intronic
1000531881 5:162432879-162432901 CCTAAAAATCAGTAGGAAAAAGG - Intergenic
1000630421 5:163584615-163584637 AGGAAAATTAAGAAGGTAAAAGG - Intergenic
1000893349 5:166825889-166825911 GCTAATATTCAGAAGGCACAGGG - Intergenic
1001966757 5:175914960-175914982 ACAAAAATTCAGAAGGCACAAGG - Intergenic
1002174336 5:177393120-177393142 CCTACAATTCAGAAGGCCACAGG - Intronic
1002250192 5:177924244-177924266 ACAAAAATTCAGAAGGTACAAGG + Intergenic
1002876172 6:1211730-1211752 CATAAAATTCAGCACTTAAAGGG + Intergenic
1003355721 6:5368159-5368181 CCTAAAATACAGAACTTAATTGG - Intronic
1004935557 6:20504799-20504821 CCAAAATTTCAGAAGGATAAAGG + Intergenic
1006344160 6:33466483-33466505 CCTAAATTTCAGAAGGTGTGTGG + Intergenic
1008084807 6:47233309-47233331 TTTAGAATTCAGAAGGTGAATGG + Intronic
1008449214 6:51630759-51630781 TATAAAATACAGAAGGTATAAGG + Intronic
1008586355 6:52954001-52954023 CCTGTAATTCTGAAGGTATATGG - Intergenic
1008894893 6:56541767-56541789 CCTAAAATCAACCAGGTAAAAGG - Intronic
1009025333 6:57992745-57992767 TATTAAATTCATAAGGTAAAAGG - Intergenic
1009046337 6:58241036-58241058 CCTAATATTCAGGGGGTAAGAGG + Intergenic
1009200900 6:60744193-60744215 TATTAAATTCATAAGGTAAAAGG - Intergenic
1009222152 6:60995353-60995375 CCTAATATTCAGGGGGTAAGAGG + Intergenic
1009362931 6:62836748-62836770 CCTAATATCCAGGAGGTAAGAGG + Intergenic
1009363514 6:62840661-62840683 CCTAACATCCAGAAGGGAAGAGG + Intergenic
1009365257 6:62852914-62852936 CCTAATATCCAGAAGGGAAAAGG + Intergenic
1009368575 6:62875111-62875133 CCTAATATTCAGAAGGGAAGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1009503161 6:64442799-64442821 CCTAGATTTCAGAAGATATATGG + Intronic
1009866643 6:69406288-69406310 CCTGAAGGTGAGAAGGTAAAGGG + Intergenic
1009935245 6:70226087-70226109 TCTAAAATTCAGAAACCAAAAGG + Intronic
1010317174 6:74465110-74465132 CCTAAAATTCAGAAGAGATTGGG - Intergenic
1010933232 6:81829204-81829226 CCTAAAACTCAGAAATTTAAGGG + Intergenic
1011955304 6:93018044-93018066 CATAGAATTCAGAATATAAAAGG + Intergenic
1012619614 6:101325888-101325910 ACTAAAATTAAGAAGGAAAGTGG - Intergenic
1013918823 6:115375224-115375246 CCTTCAAGTCAGAGGGTAAATGG + Intergenic
1013935373 6:115587459-115587481 CCTAGATTTCAGAAGATATATGG + Intergenic
1014004645 6:116404104-116404126 GCTAAGATTCATAAGGTATAGGG - Intronic
1014592628 6:123292473-123292495 CCTAAATTCCAAAAGGGAAAAGG - Intronic
1015397217 6:132748215-132748237 GCTAAAATCCAGTAGCTAAAAGG - Intronic
1015784453 6:136906961-136906983 ACTAAAATTAAAAAGGAAAACGG - Intronic
1016021205 6:139237843-139237865 TCTAAAATTCAGCAGGAAGAAGG + Intergenic
1016106426 6:140169993-140170015 AGTAAAATTCAGAAAGAAAAAGG - Intergenic
1016577123 6:145582481-145582503 CCTACAAGTCAGAAGATAATTGG - Intronic
1016621042 6:146109469-146109491 CCTAGATTTCAGAAGATATATGG + Intronic
1017248956 6:152259438-152259460 CCTAAAGTTCACTAGGTCAAAGG - Intronic
1018375386 6:163205823-163205845 CCTAAAATTCAGAATCTATAAGG + Intronic
1020345075 7:7153953-7153975 CCTAGATTTCAGAAGATATATGG + Intergenic
1020729684 7:11866064-11866086 CCTAGAATTCAGAAGATGTATGG + Intergenic
1020992763 7:15221172-15221194 CTCAATATCCAGAAGGTAAAAGG - Intronic
1021544797 7:21800992-21801014 CCTAAAATACGTATGGTAAAGGG + Intronic
1022141984 7:27500611-27500633 CCTAAAAAACAAAAGGGAAAGGG + Intergenic
1023239854 7:38132160-38132182 TCTTAAATCCAGAAAGTAAATGG + Intergenic
1023409270 7:39872504-39872526 CTTAAAATTCAGAAAAAAAAGGG - Intergenic
1023687361 7:42749975-42749997 CCTGAAAGTCACAAGGTAGAAGG - Intergenic
1024008193 7:45242755-45242777 CCTAAAGCTCAGAAGGTGAAGGG + Intergenic
1024696236 7:51859414-51859436 CCCAAAATTCAGACTGTAAAGGG + Intergenic
1024868698 7:53935305-53935327 AATAAAATACACAAGGTAAATGG + Intergenic
1024906059 7:54381802-54381824 CCTAAAATGTAGAAGTAAAAGGG + Intergenic
1025039006 7:55623204-55623226 CATAAACTTCAGAGGGTAAGGGG + Intergenic
1025043663 7:55671526-55671548 CTTAAAATTCAGAAAAAAAAGGG + Intergenic
1025136585 7:56420031-56420053 CTTAAAATTCAGAAAAAAAAGGG + Intergenic
1026062286 7:67037102-67037124 CCCAAAATTCAGGAGGAAGAGGG - Intronic
1026068123 7:67093468-67093490 CCTAAAACTCAGAAAGTGGAAGG - Intronic
1026581174 7:71618689-71618711 CCTAAAATCCAGAATCTATAGGG - Intronic
1026708798 7:72718839-72718861 CCTAAAACTCAGAAAGTGGAAGG + Intronic
1026716060 7:72790347-72790369 CCCAAAATTCAGGAGGAAGAGGG + Intronic
1027458599 7:78424334-78424356 CCTATATTTCAGAAGATATATGG + Intronic
1027925749 7:84461069-84461091 CTTAAAATTCATAGGGTATAAGG + Intronic
1028138353 7:87245812-87245834 CCTAGATTTCAGAAGATATATGG + Intergenic
1028401750 7:90432547-90432569 CCTACAATTCAGAAGGAATTGGG + Intronic
1029070490 7:97892071-97892093 CCTAGATTTCAGAAGGTGTATGG - Intergenic
1030919153 7:115358432-115358454 CATAAAATACAGAAAATAAATGG + Intergenic
1031175806 7:118347988-118348010 TATTAAATTCAGAAGGAAAATGG - Intergenic
1032318278 7:130861216-130861238 CCTAGATTTCAGAAGATGAATGG + Intergenic
1032340113 7:131063126-131063148 CCTAAAATTCATAAGAAAAAAGG + Intergenic
1032882668 7:136105860-136105882 CCTAATATTCAGAATCTATAAGG - Intergenic
1032916011 7:136491028-136491050 CATTATATTCAGAAGGTAACAGG - Intergenic
1033413110 7:141138359-141138381 CCTAAAATTCAAAATTTTAAGGG + Intronic
1033522746 7:142178237-142178259 CCTAAAATCCAGAATATATAAGG - Intronic
1034573054 7:151972770-151972792 CCTAGAATTCAGAGGATATATGG + Intronic
1035471223 7:159110139-159110161 CTTAAAATTCAGAAGGTACATGG - Intronic
1036248074 8:7137655-7137677 CCTAGACTTCAGAAGGTGTATGG + Intergenic
1036574113 8:10009478-10009500 ACAAAAAATGAGAAGGTAAAAGG + Intergenic
1036886174 8:12555343-12555365 CCTAGATTTCAGAAGGTGTATGG - Intergenic
1036893790 8:12614431-12614453 CCTAGATTTCAGAAGGTGTAAGG - Intergenic
1037014421 8:13884754-13884776 GCTGAAATTCAAAATGTAAATGG - Intergenic
1037048831 8:14343130-14343152 CCTAAATTTCAGAAGATGTATGG + Intronic
1037844786 8:22273419-22273441 TCTAAAATTCAGAGTGAAAATGG - Intergenic
1038519879 8:28221760-28221782 CCTAATATTCAGAATCTATAAGG - Intergenic
1040623949 8:49123597-49123619 ACTAATATTCAGAATTTAAAAGG - Intergenic
1041436085 8:57843336-57843358 TCCAACCTTCAGAAGGTAAAAGG - Intergenic
1041831250 8:62156794-62156816 GACAAAATTCAGAAGGCAAATGG - Intergenic
1041920443 8:63176977-63176999 CCTAAAATTCAGATTTTAATTGG + Intronic
1042425572 8:68644062-68644084 CCAAATGTTTAGAAGGTAAAGGG - Intronic
1042488093 8:69368684-69368706 AGTAAACTTCAGCAGGTAAAGGG + Intergenic
1042682410 8:71400408-71400430 TCTAATATCCAGAAGGTACAAGG + Intergenic
1043080606 8:75760794-75760816 CCTAGATTTCAGAAGGTGTATGG + Intergenic
1044445765 8:92273522-92273544 GCTAAAATTGAGAAGCAAAAGGG - Intergenic
1045814043 8:106258748-106258770 CAAAAAATACAGAAGATAAATGG - Intergenic
1045919309 8:107511180-107511202 CCTAGATTTCAGAAGATATATGG + Intergenic
1045925749 8:107577616-107577638 CCTAATATTCAGAAGGAAAGAGG + Intergenic
1046052888 8:109044655-109044677 CCTAGATTTCAGAAGATATATGG - Intergenic
1046119907 8:109832802-109832824 TCTAATATTCAGAATGTATAGGG + Intergenic
1046236165 8:111426417-111426439 CATAAAATTAAGAAGAAAAAAGG + Intergenic
1046358366 8:113117404-113117426 CCTAGATTTCAGAGGGTATATGG + Intronic
1046633575 8:116646603-116646625 ACTAAAATTCAAAGGGAAAATGG + Exonic
1046678154 8:117135459-117135481 CCTACAATTCAGAAGCAACAAGG - Intronic
1047628061 8:126677278-126677300 CCTAGATTTCAGAAGATATATGG + Intergenic
1048347904 8:133591798-133591820 CTTAAACTGCAGCAGGTAAAGGG - Intergenic
1048419344 8:134261677-134261699 CCTAGATTTCAGAAAGTTAATGG + Intergenic
1049985162 9:943604-943626 CCTTAAATTCTGAAGGTCATGGG + Intronic
1050714672 9:8509342-8509364 CCTAATATTCACATGATAAAAGG + Intronic
1050805392 9:9670805-9670827 CCTAGATTTCAGAAGATATATGG + Intronic
1050932926 9:11352565-11352587 CCTAAGATTGAGAATGAAAAAGG + Intergenic
1051354079 9:16224859-16224881 CCTGAAAGTGACAAGGTAAATGG + Intronic
1052070978 9:24081092-24081114 CCTAAATTTCAGAAGATGTATGG + Intergenic
1052333250 9:27293359-27293381 CCTAAAACTCTGAAGGCAAGGGG - Intronic
1052393086 9:27904214-27904236 CTTAAAATTCATAAGGAAACAGG + Intergenic
1052565791 9:30149382-30149404 CTTAAAACTCAGAACTTAAAAGG + Intergenic
1052572792 9:30249725-30249747 CCTGACATTCAGAAGCTAACTGG - Intergenic
1052931616 9:34060356-34060378 CTGAAAATTCAGTAGATAAATGG + Intergenic
1055001102 9:71449522-71449544 AATAAATTTCAAAAGGTAAATGG + Intergenic
1055341897 9:75293001-75293023 CCTAAATTTCAGAGGATATATGG - Intergenic
1055355989 9:75437386-75437408 CCTGAAATACAGAGAGTAAAAGG - Intergenic
1055789225 9:79903776-79903798 CCTAAAATGCAAAATGTAAAAGG - Intergenic
1055794069 9:79955342-79955364 CCTAGATTTCAGAAGATGAATGG + Intergenic
1055843280 9:80531478-80531500 CCTAGATTTCAGAAGATATATGG - Intergenic
1057418410 9:94886504-94886526 TTTAAAATTCAGAATATAAATGG + Intronic
1057488172 9:95502298-95502320 CCAAACATTCAGCAGGTACACGG - Intronic
1058124613 9:101177104-101177126 CCTAAAATTCCCATGGAAAAAGG - Intronic
1058169690 9:101665529-101665551 CCTAATATCCAGTAGATAAAAGG + Intronic
1058274571 9:103024101-103024123 CCTAGATTTCAGAAGATATATGG + Intergenic
1058519085 9:105801702-105801724 CCTAATATCCAGAAGGGAAGAGG - Intergenic
1060271031 9:122141735-122141757 TCTCAATTTCAGTAGGTAAAAGG - Intergenic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1185430785 X:10601-10623 CCTAAATTCCAGAAGGGAACTGG - Intergenic
1185440051 X:222998-223020 CCTAAATTCCAGAAGGGAACTGG - Intergenic
1186116181 X:6307213-6307235 CCTAAAATTCAGAACCCCAAAGG + Intergenic
1186165298 X:6821017-6821039 CCTAGATTTCAGAAGATGAATGG - Intergenic
1186323987 X:8458966-8458988 CCTATATTTCAGAAGATATATGG - Intergenic
1186742613 X:12534251-12534273 CCTAGATTTCAGAAGATATATGG + Intronic
1187836546 X:23437332-23437354 CCTAGATTTCAGAGGATAAATGG + Intergenic
1187920156 X:24193999-24194021 CCTAAGAGACAGAAAGTAAAAGG - Intronic
1187992819 X:24894532-24894554 CGTAAATTTCAGAGGGAAAATGG - Intronic
1188629778 X:32340290-32340312 TCCAAAATTCAGAATGTGAAGGG - Intronic
1188970958 X:36614280-36614302 CATAGAATTCAGAATATAAATGG + Intergenic
1189011814 X:37053504-37053526 CCTAGAATTCAGAGGATGAATGG + Intergenic
1189192022 X:39118414-39118436 CCTACAAATCAAATGGTAAAAGG + Intergenic
1189815784 X:44823077-44823099 CCTAGATTTCAGAGGATAAATGG + Intergenic
1190137851 X:47813609-47813631 CCTAAGATTTAGAGGGTTAAAGG - Intergenic
1191811448 X:65193453-65193475 CCAATACTTCAGAAAGTAAAAGG - Intergenic
1191936882 X:66436483-66436505 CTTAAAATTCTCAAGGGAAAAGG + Intergenic
1193498394 X:82240914-82240936 CCTAGATTTCAGAAGGTGTATGG + Intergenic
1193513916 X:82439773-82439795 CTTAAAATACAGAACTTAAAAGG + Intergenic
1193558070 X:82981403-82981425 CCTATAATTCAGAAGCTACCAGG + Intergenic
1193614561 X:83671619-83671641 CCTAGATTTCAGAAGATATATGG + Intergenic
1193690973 X:84642154-84642176 CCTAATATTCAGAATCTATAAGG + Intergenic
1193778562 X:85674824-85674846 CCTAATATTCAGAATCTAGAGGG - Intergenic
1194076071 X:89395629-89395651 CCTAAAATTCATATGGCATATGG - Intergenic
1194089073 X:89563584-89563606 CCTAGATTTCAGAAGATGAATGG - Intergenic
1194325093 X:92505036-92505058 CCTAATATCCAGAATGTATAAGG - Intronic
1194675050 X:96784431-96784453 CCTAAAGTACTGAAGCTAAAGGG - Intronic
1194844756 X:98791357-98791379 TCTAATATTCAGAATCTAAAAGG + Intergenic
1195201906 X:102559940-102559962 CCTTAAATTTAGATGCTAAAAGG + Intergenic
1195822084 X:108956599-108956621 CCTAAATTTCAGAGGATATATGG + Intergenic
1195974153 X:110507710-110507732 CCAAAACTTCAGTAGGTGAATGG + Intergenic
1196325964 X:114402927-114402949 CAAAAAATTCAAAAGGGAAATGG + Intergenic
1196366187 X:114927030-114927052 CCGAAACTTCAGAGGGTGAAGGG - Intergenic
1197946987 X:131850091-131850113 ACTAATATTCAGAATATAAAAGG - Intergenic
1197994115 X:132353927-132353949 CTAAAAATTCAAAAGGTAGATGG - Intergenic
1199235493 X:145487859-145487881 CCTAAATTTCAGAGGATGAATGG - Intergenic
1199237772 X:145510541-145510563 CCTAGAATTCAGAAGATATATGG + Intergenic
1200374551 X:155766484-155766506 TATAAAATTGAGATGGTAAATGG - Intergenic
1200428711 Y:3051143-3051165 CCTAAAATTCATATGGCATATGG - Intergenic
1200441741 Y:3219634-3219656 CCTAGATTTCAGAAGATGAATGG - Intergenic
1200633827 Y:5624216-5624238 CCTAATATCCAGAATGTATAAGG - Intronic
1201380507 Y:13372140-13372162 CCTAAAATTCACATTGCAAAGGG + Intronic
1201521166 Y:14875281-14875303 GCTAAAATCCAGAATCTAAAAGG + Intergenic