ID: 920230497

View in Genome Browser
Species Human (GRCh38)
Location 1:204466803-204466825
Sequence AGACTCCCCCAGCCAGCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920230497_920230505 1 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230505 1:204466827-204466849 CCGGGCAGAGGCTGGCAGCAGGG 0: 1
1: 0
2: 7
3: 57
4: 1659
920230497_920230508 13 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230508 1:204466839-204466861 TGGCAGCAGGGGTATCAGGCTGG 0: 1
1: 1
2: 1
3: 26
4: 260
920230497_920230503 0 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230503 1:204466826-204466848 GCCGGGCAGAGGCTGGCAGCAGG 0: 1
1: 2
2: 4
3: 63
4: 648
920230497_920230502 -7 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230502 1:204466819-204466841 GGAGTCTGCCGGGCAGAGGCTGG 0: 1
1: 0
2: 1
3: 46
4: 482
920230497_920230506 2 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230506 1:204466828-204466850 CGGGCAGAGGCTGGCAGCAGGGG 0: 1
1: 0
2: 4
3: 84
4: 794
920230497_920230507 9 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230507 1:204466835-204466857 AGGCTGGCAGCAGGGGTATCAGG 0: 1
1: 0
2: 1
3: 19
4: 278
920230497_920230509 20 Left 920230497 1:204466803-204466825 CCCGATGCTGGCTGGGGGAGTCT 0: 1
1: 0
2: 2
3: 19
4: 183
Right 920230509 1:204466846-204466868 AGGGGTATCAGGCTGGCATTTGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920230497 Original CRISPR AGACTCCCCCAGCCAGCATC GGG (reversed) Intronic
900404427 1:2486239-2486261 AGAGTCCTCCAGCCGGCAACTGG + Intronic
900473763 1:2866822-2866844 TCACTCACCCAGCCGGCATCAGG + Intergenic
900990679 1:6096882-6096904 ATCATCCCCCAGCCAGCCTCGGG + Intronic
901104353 1:6743703-6743725 GGCCTCCCCCAGCCAGCTGCAGG - Intergenic
901696854 1:11013917-11013939 AGATTTCCCCAGCCAGCATCTGG - Exonic
901843270 1:11966569-11966591 AGACTCCCACAGCCTCCAGCAGG - Intronic
902043431 1:13508904-13508926 AGGCTCCCCCAGCAAGCCCCAGG + Intronic
902759453 1:18571727-18571749 AGACACCCCCAGCCCACCTCTGG + Intergenic
903944378 1:26952346-26952368 GGACACCCCCGCCCAGCATCTGG - Exonic
905416546 1:37808208-37808230 TGACGCTCCCAGCCAGCTTCCGG + Exonic
908246089 1:62228651-62228673 GGACTCCCTCAGACAGCAGCTGG + Intergenic
910194455 1:84625630-84625652 ACCCTCCCCCAGCCAGGGTCAGG + Intergenic
912431960 1:109632731-109632753 AGGCCTCCCCAGCCAGCAGCAGG - Intergenic
914841076 1:151249221-151249243 AGACACCCCCAGCCAGTTTCTGG + Intronic
915516228 1:156414129-156414151 AAACTCCCCCAACCAGCAGCAGG + Intronic
915585599 1:156842240-156842262 GGGCTCCCACAGCCAGCATTGGG - Exonic
918073982 1:181155308-181155330 AAACACCCTCAGCCAGCATGGGG - Intergenic
918303363 1:183224112-183224134 TGACTCCTCCAGGCAGAATCGGG - Intronic
919750514 1:201034811-201034833 AGATCCCCCCACCCAGCAGCTGG + Intergenic
920046251 1:203134503-203134525 AGCTTCCCCCAGCTGGCATCGGG + Intronic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
923330969 1:232924317-232924339 AGACTTCCCCACCCAGCACCTGG - Intergenic
1063984053 10:11482246-11482268 AGACTACCTCAGCCGGCATGAGG + Intronic
1066130685 10:32390548-32390570 AGGCTTCCCAAGCCAGCATGTGG + Intergenic
1067658060 10:48212143-48212165 AGAGTCCCCCGGCCAGTGTCTGG - Intronic
1070421809 10:76244786-76244808 TGACTTCCCCAGCCTGCATTTGG - Intronic
1071455642 10:85849552-85849574 AACCTTCCCCAGCCAGCATTAGG - Intronic
1071576982 10:86734706-86734728 AGTCTCCCCCAGGGAGCATCAGG + Exonic
1073254498 10:102142034-102142056 AGAGTCCCCCAGCCAACTTGGGG - Intronic
1077113650 11:873094-873116 ACACACCCCCACCCAGCACCTGG - Intronic
1077412712 11:2410946-2410968 AGGCTGTCCCAGCCATCATCCGG - Intronic
1077454990 11:2673105-2673127 AGACCCCAGCAGGCAGCATCAGG + Intronic
1078647983 11:13159938-13159960 AGAATCCCCAAGGCAGCATCAGG + Intergenic
1079344800 11:19642475-19642497 AGAATCCTTCAGCCAGGATCAGG - Intronic
1080600821 11:33819449-33819471 AGACTCACCCACGCAGCACCCGG + Intergenic
1080686109 11:34516168-34516190 AGACTCACCCAGACAGCAAATGG - Intergenic
1088752765 11:112858642-112858664 AACCTTCCCCAGACAGCATCAGG + Intergenic
1089702505 11:120254070-120254092 AGACTCCCCCAGCCCCAAGCTGG + Intronic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1092771403 12:11900463-11900485 GGCCACCCCCTGCCAGCATCAGG + Intergenic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1093819863 12:23601125-23601147 ACACTCCCCAAGCCACCAACTGG + Intronic
1095961766 12:47839395-47839417 AGATTCCCCCTGCCAGCCACAGG + Intergenic
1096571822 12:52527742-52527764 GGACTGCCCCAGGAAGCATCTGG - Intergenic
1101415075 12:104501748-104501770 TGACTCCTTCACCCAGCATCTGG - Intronic
1103926860 12:124427933-124427955 AAACTTCCCCAGCCAGCCTGGGG - Intronic
1108600894 13:51993921-51993943 AGGCTCCCCTAGTCAGCTTCAGG + Intronic
1110423070 13:75335222-75335244 AGGCTCCCACACCCTGCATCGGG + Intronic
1113393511 13:109920673-109920695 GGACAGCCCCTGCCAGCATCAGG - Intergenic
1113584682 13:111457026-111457048 AGACACCCCAGGCCAGCGTCCGG - Intergenic
1113628667 13:111865119-111865141 AGGCTCTCCCAGACAGCATGGGG + Intergenic
1115284855 14:31705360-31705382 AGGCCACCCCAGCCAGCAGCCGG - Intronic
1115343494 14:32317711-32317733 AGTCTCTCCCAGGCACCATCTGG + Intergenic
1116671361 14:47846528-47846550 AGAATGTTCCAGCCAGCATCAGG + Intergenic
1117093720 14:52275536-52275558 GGGCTTCCCCAGCCACCATCGGG + Exonic
1118845102 14:69542034-69542056 AGACTCCCCCTGCAAGCACATGG - Intergenic
1119553214 14:75532323-75532345 ACTGTCCCCCAGCCATCATCAGG + Intronic
1119720064 14:76884555-76884577 AAACTCCCCCAGCAGGCAGCCGG + Intergenic
1121414011 14:93766438-93766460 AGCCTCCAAGAGCCAGCATCAGG + Intronic
1121519459 14:94576243-94576265 AGACTCCCCCAGGGAGCAGGAGG - Intronic
1121795020 14:96727655-96727677 AGCCTCCCCCATGCAGCAGCTGG - Intergenic
1122201144 14:100123537-100123559 AGGCCCCTCCAGCCAGCGTCAGG + Exonic
1122265951 14:100546942-100546964 AGACTCCTCCAGCCACCACCTGG - Intronic
1123058658 14:105584462-105584484 AGACTCCCCCAGGGAGGATGAGG + Intergenic
1123082987 14:105704688-105704710 AGACTCCCCCAGGGAGGATGAGG + Intergenic
1124267632 15:28251242-28251264 AGACCACCCCAGCCAACATGGGG + Intronic
1125574746 15:40747571-40747593 AGACTAACCCAGCCAGCCTTTGG + Intronic
1128224121 15:65989816-65989838 ACCCTCCCCAAGACAGCATCTGG + Intronic
1128562408 15:68677522-68677544 AGCATCCCCCCGCCACCATCTGG - Intronic
1131122360 15:89830457-89830479 AGCCTCCACGAGCCATCATCGGG + Intergenic
1132157589 15:99507184-99507206 AGACTTTCTCAGTCAGCATCTGG + Intergenic
1132669286 16:1096094-1096116 AGACTCCCACAACCAGCCCCAGG + Intronic
1133034315 16:3026524-3026546 AGTCTCCCCCAGCCAGGATGAGG - Exonic
1135634199 16:24060187-24060209 AAAGTCCCACAGCCAGCATGTGG - Intronic
1135892866 16:26373253-26373275 CGACTCACCAAGCCAGCATTGGG - Intergenic
1136186036 16:28589522-28589544 AGACCCCCTCAGCCTGCATTAGG + Intronic
1136989075 16:35140941-35140963 AGACTCTCCCACACACCATCTGG - Intergenic
1137324611 16:47421826-47421848 ACAGTCCCCCACCCAGCAACAGG + Intronic
1138558348 16:57785856-57785878 ACACTTCCCCAGGCAGCATCTGG + Intronic
1140258816 16:73359568-73359590 AGACACAGCCAGCCAGCCTCTGG - Intergenic
1141615996 16:85209712-85209734 AGACTCTCCCTCCCAGCCTCGGG - Intergenic
1143332128 17:6145332-6145354 GGACTCCCCAAGCAGGCATCAGG + Intergenic
1146109426 17:30074849-30074871 CATCTCCCCAAGCCAGCATCTGG + Intronic
1147142762 17:38468566-38468588 TGGCTCCCCCAGCCAGCCTTCGG + Intronic
1147325012 17:39665926-39665948 GGACACCCCCATCCAGCTTCAGG + Exonic
1148115082 17:45170781-45170803 AGATACCACCAGCCAGCGTCAGG + Intergenic
1150230381 17:63546400-63546422 AGACTCTCCCACCCTGCACCAGG - Exonic
1152071973 17:78138504-78138526 AAACTGCCCCTGCCAGCCTCTGG - Intronic
1152198178 17:78929741-78929763 AGGGTCCCCCAGGCTGCATCTGG - Intergenic
1152606413 17:81293333-81293355 AGAGCCCCCCGGGCAGCATCTGG - Intronic
1153792341 18:8590062-8590084 AGACTACCTCATCCAGCATTAGG + Intergenic
1159946312 18:74447016-74447038 TGACCTCCCCAGCCACCATCAGG + Exonic
1160322146 18:77905828-77905850 AGACCCGCCCAGCCAGCCTGAGG - Intergenic
1161062030 19:2220002-2220024 GGCCTCCCCCAGCCAGCTGCAGG + Intronic
1161221844 19:3121545-3121567 AGCCCCCGCCAGCCAGCATGGGG + Exonic
1161319870 19:3636227-3636249 GGACACCCTCAGCCAGCAGCTGG + Intronic
1161517767 19:4706022-4706044 AGACGCCCTCAGCCTGCAGCTGG + Intronic
1163774959 19:19212410-19212432 AGAGTCCCCCATTCGGCATCTGG - Intronic
1164147144 19:22518967-22518989 AGCCTCCCCCAGCCACCACCAGG - Intronic
1164159488 19:22617362-22617384 AGCCTCCCCCAGCCACCACCAGG + Intergenic
1165600993 19:37055863-37055885 AGACTCACCCAAACACCATCCGG - Intronic
1166253383 19:41586152-41586174 AGATTCCCCTACCCAGCACCAGG + Intronic
1166326938 19:42056802-42056824 GGACTTCCCCATCCTGCATCTGG - Exonic
1167426806 19:49433858-49433880 TGACCCCCCCAGGCAGCTTCGGG - Exonic
1168191470 19:54741455-54741477 ATACTCCTCCAACCAGCACCAGG + Intronic
1168195796 19:54772821-54772843 ATACTCCTCCAACCAGCACCAGG + Intronic
928825096 2:35410635-35410657 AGGATCCCCCAGCCAGCAGGGGG - Intergenic
929930901 2:46254698-46254720 TGGATCACCCAGCCAGCATCTGG - Intergenic
930138344 2:47925377-47925399 AGACTAGCCCAGCCAACATAGGG + Intergenic
932703273 2:74004827-74004849 CAACTCCTCCAGCCAGCAGCGGG - Intronic
933490932 2:82985294-82985316 AGGCTGCCCAAGCCAGCAGCTGG - Intergenic
934197381 2:89850614-89850636 AGTCTCCCCCAGCCTGGATGTGG - Intergenic
934762748 2:96865405-96865427 GGACTCACCCAGCCTGCATGGGG + Intronic
935633876 2:105235015-105235037 AGAGTCTCCCAGCCACCAGCTGG + Intergenic
935739090 2:106130817-106130839 AGAGTCTCCCAGCCTGCTTCAGG - Intronic
936526380 2:113244467-113244489 AGACGCCCTCAGCCAGGAGCCGG + Exonic
938134864 2:128748521-128748543 CGGCTCCCCCTGCCCGCATCTGG - Intergenic
942524940 2:176843064-176843086 AAACTCCTCCACCCAGTATCTGG + Intergenic
943514050 2:188862628-188862650 AGTCTGCCACAGCCAGCATGTGG - Intergenic
946663226 2:222022976-222022998 AGACTAGCCCAGCCAACATGGGG + Intergenic
948477876 2:238232070-238232092 GGATTTCTCCAGCCAGCATCGGG - Intergenic
948917442 2:241042019-241042041 AAACTGCCCCAGGCAGAATCTGG - Intronic
1169505131 20:6201981-6202003 AGATTTCCACAGTCAGCATCAGG + Intergenic
1169901082 20:10552140-10552162 CGAGTCCCCCAGCCAGGGTCTGG - Intronic
1171334434 20:24370817-24370839 AGAATCCCCCACCCAGCAGCTGG + Intergenic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1175183677 20:57165805-57165827 AGAGTCCCCCATCCAGGAGCAGG - Intergenic
1175552143 20:59824464-59824486 AGGCTCTCCCAGCCAGACTCTGG - Intronic
1175730524 20:61350685-61350707 TGCCTCTCCCACCCAGCATCAGG + Intronic
1176250508 20:64118054-64118076 AGACACCCCCCCCCAACATCAGG - Intergenic
1176250756 20:64118859-64118881 AGACACCCCCCCCCAACATCAGG - Intergenic
1176364734 21:6025913-6025935 AGCCACCCCCACCCAGCACCAGG - Intergenic
1177124708 21:17181835-17181857 AGAATTCCCCAGGCAGCATGAGG + Intergenic
1179758784 21:43512632-43512654 AGCCACCCCCACCCAGCACCAGG + Intergenic
1179882991 21:44301103-44301125 ACACACCCCCACCCAGCTTCAGG + Intronic
1180180939 21:46118458-46118480 AGCAGCCCCCAGCCAGCATCTGG + Intronic
1181492974 22:23272378-23272400 AGACTCCCACAACCAGCATAAGG - Intronic
1184420605 22:44380884-44380906 GGTCTCCCCCAGGCTGCATCTGG + Intergenic
1184596396 22:45516736-45516758 GGACTCCTCCTGCCAGCCTCGGG + Intronic
1185327347 22:50233417-50233439 GGACGCCCCCAGCAAGCAGCTGG + Exonic
950138839 3:10601455-10601477 AGACTCTCACAGCCAGCCTGGGG - Intronic
950460135 3:13116198-13116220 AGTTTCCCGCAGCCAGCACCTGG - Intergenic
951611399 3:24495351-24495373 AGACGCCCCCTGCCAGGCTCCGG + Intergenic
951991617 3:28681576-28681598 AGACTCACTCACCCAGCCTCTGG + Intergenic
953930489 3:47003451-47003473 AGACTCTCCCACTCACCATCTGG - Intronic
956879767 3:73498919-73498941 CGACCCGCACAGCCAGCATCTGG - Intronic
960668774 3:120136602-120136624 CGACTCCCCCCCCCAGCCTCTGG - Intergenic
964138229 3:153369326-153369348 AGGCTGCCCCAGCTAGCAGCTGG - Intergenic
968077131 3:195822182-195822204 TGATTCCCTCAGCCAGAATCAGG - Intergenic
969087937 4:4670384-4670406 ACACTCCCCCCCCCAGCACCAGG + Intergenic
969671340 4:8591991-8592013 TGACTGCCCCGGCCAGCCTCCGG - Intronic
970329526 4:14965245-14965267 AGACTCTTCTAGCCAACATCTGG - Intergenic
979881153 4:125961865-125961887 AGCCTGCCCCTGCCAGCATTTGG + Intergenic
982248041 4:153374611-153374633 AGTCTCCCCCAACCCCCATCTGG - Intronic
984139362 4:175983880-175983902 AGACTCCCCAGGGAAGCATCTGG + Intronic
984851407 4:184156231-184156253 AGCCTCCTCCTGCCAGCTTCCGG - Intronic
985493515 5:192423-192445 AGACTCACCCAAGCAGCGTCGGG - Exonic
986765694 5:10924087-10924109 AGACTGTCTCAGCAAGCATCAGG - Intergenic
997376576 5:133401781-133401803 AGACTCCCCCAGCCGCCCTGTGG + Intronic
1002418295 5:179132230-179132252 AGACGCCACCAGCCACCATCTGG - Exonic
1002443147 5:179274659-179274681 AGAGGCTCCCAGCCAGCAACAGG - Intronic
1003654123 6:7989550-7989572 AGACACCCCCAGCCAGTTTCTGG + Intronic
1003821901 6:9907332-9907354 AGACTCCCACAGCTAACATGGGG - Intronic
1006437699 6:34034872-34034894 CGAGTCACCCAGCCAGCACCAGG + Intronic
1006640354 6:35486350-35486372 AGACTCGCCCGGCCAGCGGCTGG + Intronic
1006793444 6:36717955-36717977 AGACTGCCCCTGCCAGCAGCAGG + Intronic
1007471599 6:42094205-42094227 TCACACCCCCAGCCAGCAGCTGG - Intergenic
1009981034 6:70725958-70725980 AAAATCCCCCAGCCAGTATAAGG + Intronic
1015390722 6:132678463-132678485 AGACCCCCACCTCCAGCATCGGG + Intergenic
1019514496 7:1433767-1433789 CGACCCCCCCAGCCAGCAGGTGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019737126 7:2656163-2656185 GGACTGCCGCAGCCTGCATCTGG + Exonic
1029809512 7:103033791-103033813 AGGCTGCCCGAGCCAGCATTGGG - Intronic
1030720847 7:112868741-112868763 AGGCCCCCACAGCCAGAATCAGG + Intronic
1031077373 7:117225751-117225773 AGAGTTCCCAAGCCAGCAGCTGG - Intronic
1032013128 7:128359783-128359805 GGGCTCCCCCAGACAGCAGCAGG + Exonic
1032084625 7:128877447-128877469 AGCCTCCCCCAACCTGCAGCGGG + Intronic
1033030429 7:137820847-137820869 GGCCTCCCCCAGCCGGCATCAGG + Intronic
1034707462 7:153158430-153158452 AGAGGGCCCCAGCCAGCACCAGG - Intergenic
1034720695 7:153289952-153289974 AGAATCCCAGACCCAGCATCAGG - Intergenic
1035487174 7:159235011-159235033 AGACACCCTCAGCCAGTTTCTGG + Intergenic
1035642353 8:1193812-1193834 TGAGACCCCCAGACAGCATCCGG + Intergenic
1036598926 8:10240938-10240960 AGACTCCCCCAGCACCCACCAGG - Intronic
1036805120 8:11826312-11826334 GGCCTCCCCCAGGCAGCATAAGG + Intronic
1041915824 8:63137880-63137902 AGATTTCCCCAGCCAGCATCGGG + Intergenic
1044966491 8:97579069-97579091 GGACTCCCACACCCAGCACCAGG + Intergenic
1045645336 8:104292020-104292042 AGACTCACCCTGCCTGCACCCGG + Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1049483913 8:142841533-142841555 GGACTCACCCAGGCAGCATGGGG - Intronic
1049744645 8:144258120-144258142 AGACTCTCCCTGCCAGTTTCTGG + Intronic
1049749970 8:144278430-144278452 AGCCTCCCCTCCCCAGCATCAGG + Intronic
1056092671 9:83219558-83219580 AAAATCTCCCAGCCAGGATCCGG + Intergenic
1060295248 9:122338855-122338877 AGTGGCCCCCAGCCTGCATCAGG - Intergenic
1061284272 9:129613346-129613368 AGACCTCCCCACCCAGCAGCAGG - Intronic
1061434314 9:130551356-130551378 AGACTCCCACAGCCGGCCACCGG - Intergenic
1061452741 9:130677491-130677513 AGACACCCCCAGGCAACAGCTGG - Intronic
1062733474 9:138121702-138121724 AGACCCCCTCAGCCAGCCCCTGG + Exonic
1189135480 X:38544926-38544948 AGAGTCCCTTAGCCAGAATCAGG + Intronic
1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG + Intronic
1190054304 X:47173051-47173073 AGAGGCCTCCAGCCAGCCTCAGG + Intronic
1190060105 X:47205305-47205327 AGACTCCCCCAACCACCACCAGG - Intronic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1190879934 X:54484857-54484879 AGCCCCACCCAGCCAGCGTCTGG + Intronic
1193945442 X:87728151-87728173 AGTCTCCTCCTCCCAGCATCAGG - Intergenic
1198845255 X:140903301-140903323 AAACTCACCCAGCAGGCATCTGG - Intergenic