ID: 920231784

View in Genome Browser
Species Human (GRCh38)
Location 1:204475510-204475532
Sequence ATGGGTGGTCAGGATGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920231777_920231784 11 Left 920231777 1:204475476-204475498 CCTTCTGGGAGGTGGGGAATTTT No data
Right 920231784 1:204475510-204475532 ATGGGTGGTCAGGATGTAGGTGG 0: 1
1: 0
2: 1
3: 25
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920231784 Original CRISPR ATGGGTGGTCAGGATGTAGG TGG Intronic
900698172 1:4025882-4025904 AAGGTTGGGCAGGATGTGGGAGG + Intergenic
900765295 1:4500938-4500960 AGGGGTGCTCAGGATGCTGGTGG - Intergenic
900969201 1:5980187-5980209 AGGGTTGGTCAGGAGGCAGGAGG - Intronic
902138179 1:14328932-14328954 ATAGGTGTTCAGGATGTAAAAGG + Intergenic
902542734 1:17166200-17166222 GTGGGTGGTGGGGATGTTGGTGG - Intergenic
904304671 1:29580421-29580443 AAGGCTGGTCAGGATGCAAGGGG - Intergenic
905241488 1:36584304-36584326 AGGGGTGGTCAGGATGGGAGAGG - Intergenic
906220165 1:44072046-44072068 TTGGGTGGTAATGATGGAGGTGG + Intergenic
909481101 1:76129595-76129617 ATGGGTGGTGTGAATGTGGGAGG + Intronic
912319067 1:108693100-108693122 AGGGGTGGGCAGGAGGTTGGGGG - Intronic
912822466 1:112878977-112878999 CTGGGTGGGCAGGAGTTAGGGGG - Intergenic
913487145 1:119341984-119342006 CTGGTTGGTCAGGATGGAGATGG + Intergenic
918739427 1:188108299-188108321 AAAGGTAGTCAGAATGTAGGAGG - Intergenic
920231784 1:204475510-204475532 ATGGGTGGTCAGGATGTAGGTGG + Intronic
920691788 1:208152867-208152889 AAGGATGGTTAGGATCTAGGAGG - Intronic
920987143 1:210901430-210901452 GTGGGTGGTCAGGTTGGATGGGG + Intronic
923274099 1:232381880-232381902 ATTGGTGGTGAGGATGTGGGAGG - Intergenic
1063040639 10:2333835-2333857 AGGGGTGGTCAGGAGGCAGAGGG - Intergenic
1065135140 10:22660116-22660138 GTGGGTGCTGGGGATGTAGGGGG - Intronic
1065287717 10:24201907-24201929 AGGGGTGATCAGGAGGTTGGGGG - Intronic
1066411355 10:35172714-35172736 ATGGGTCGTCAGGACGCAGCGGG - Intronic
1066698259 10:38097684-38097706 ATGGGTTGTTAGGATGTGGCAGG + Intronic
1066994255 10:42549478-42549500 ATGGGTTGTTAGGATGTGGCAGG - Intergenic
1067059002 10:43068186-43068208 ATGGGTGGGCAGGAGGGTGGGGG + Intergenic
1067163565 10:43846945-43846967 GTGGGTGGTGAGGAAGCAGGAGG + Intergenic
1071998156 10:91166969-91166991 ATAGGTGGTCAGGATGGGGGAGG + Intronic
1072897179 10:99376995-99377017 ATGGGTGGGGAGGAAGAAGGGGG - Intronic
1073250607 10:102118554-102118576 AGGGGTTGTCAGGCTGGAGGTGG - Intronic
1076990901 11:272986-273008 GTGGGGGGTCAGAATGTTGGGGG + Intergenic
1077502085 11:2913954-2913976 GTTGGTGGGCAGGATGCAGGTGG + Intronic
1079455789 11:20635154-20635176 GTGGGTGTTGATGATGTAGGGGG + Intronic
1080693417 11:34579595-34579617 TTGGGTGGTGAGGGTGAAGGAGG - Intergenic
1081293818 11:41360541-41360563 ATTGGGGGCCAGGATGAAGGAGG + Intronic
1081858842 11:46320569-46320591 AAGGGTGGGCAGGAGGCAGGTGG - Intronic
1083612178 11:64009576-64009598 ATGGGTAGTAAGGGAGTAGGGGG + Intronic
1085699014 11:78729724-78729746 CTGGGTGTTCAGGAGGTAGAGGG + Intronic
1087562774 11:99812754-99812776 ATGCGTGGCCAAGATGGAGGAGG + Intronic
1090748439 11:129725792-129725814 ATGGGTGGGCAGGAGGATGGTGG - Intergenic
1090804442 11:130194169-130194191 GTGGAAGGTCAGGTTGTAGGAGG - Exonic
1091152850 11:133344794-133344816 AGGGGTTGTCATGATGGAGGTGG - Intronic
1092890540 12:12965440-12965462 TTGGGAGGTCAGTATGGAGGCGG - Intergenic
1093101046 12:15029746-15029768 ATGACTGGTCAGGTTGAAGGTGG + Intergenic
1097152234 12:56987501-56987523 ACTGGTGGGCAGGATGTAGAGGG + Intergenic
1098047079 12:66411087-66411109 CTGGGTGGTCTGGATGAGGGTGG + Intronic
1100554139 12:95675396-95675418 ATGGGTGGATAGAATTTAGGTGG + Intronic
1100658199 12:96669491-96669513 TTGGGTGGTCAGCATAGAGGAGG + Intronic
1101752385 12:107592855-107592877 TTGGATGGTCAGCGTGTAGGTGG + Intronic
1103036150 12:117658356-117658378 AAGGGTGGTGATGATGGAGGAGG + Intronic
1103460721 12:121102650-121102672 ATGGGTTGTCTTGAAGTAGGAGG - Intergenic
1104921176 12:132291586-132291608 GTGGGTGGTGTGGATGTGGGCGG - Intronic
1105299639 13:19119892-19119914 ATGGGTGGTGAGGGGGGAGGGGG + Intergenic
1105738808 13:23300468-23300490 ATGGGAGGTCAGGATTTCGGAGG - Intronic
1108514960 13:51192412-51192434 ATTGGTGTTCAGGGTGTTGGAGG - Intergenic
1111996174 13:95168111-95168133 TTGGGAGGTCAGGGTGTCGGGGG - Intronic
1112415712 13:99201553-99201575 AGCGGTGGTCAGCAGGTAGGGGG + Intronic
1112709479 13:102111059-102111081 AGGGGTGGGCAGGACTTAGGTGG - Intronic
1113109020 13:106802256-106802278 AGGAGTGGGCTGGATGTAGGCGG + Intergenic
1118050469 14:62020861-62020883 ATGGCTTCTCAGGATGCAGGTGG + Intronic
1118867778 14:69717016-69717038 ATAGGTGTTCAGGATGCAGAGGG - Intergenic
1119158186 14:72430793-72430815 ATGGGTGATCAGCATTTGGGAGG - Intronic
1119163379 14:72471702-72471724 CTGGGTGGTCAGGAGGTGGCTGG - Intronic
1121447544 14:93988267-93988289 ATGGGAGGAAAGGATGGAGGAGG + Intergenic
1122853230 14:104547819-104547841 ATGGGTGGTCTGGAGGCTGGTGG + Intronic
1122979731 14:105186022-105186044 ATGGGGGGTCAGGAGGTCGGGGG + Intergenic
1124432497 15:29619499-29619521 ATGGCTGGTCATGGTGTAGCTGG + Intergenic
1124991350 15:34677105-34677127 ATGGGTGGGGTGGAAGTAGGCGG + Intergenic
1125170142 15:36757595-36757617 ATGAGTGGGCAGGATGGAGCGGG - Intronic
1125478205 15:40061988-40062010 AGGGGTGGTCAGGGAGCAGGGGG + Intergenic
1126784243 15:52163668-52163690 CTGGGTGGTCTGGATGAGGGAGG + Intronic
1129451371 15:75652966-75652988 ATGGGTGGTGAGTGTGTGGGAGG + Intronic
1129884982 15:79031483-79031505 ATGGAGGGTCAGGATGTACCTGG + Exonic
1130202970 15:81850597-81850619 AGGGGTGGTCAGGAGGCAGAAGG + Intergenic
1130996564 15:88907583-88907605 AGGGGTGGTGAGGATGAGGGGGG + Intronic
1133083496 16:3343069-3343091 ATGTGAGGGCAGGAGGTAGGTGG + Intergenic
1133221427 16:4320703-4320725 ATGGGGGCTCTGGATGAAGGTGG - Intronic
1133872318 16:9700975-9700997 AGGGTTGGTCAGGATGCAGAGGG + Intergenic
1133996347 16:10751471-10751493 CTGGGTGCTGAGGAAGTAGGAGG + Intronic
1134895855 16:17886277-17886299 AGGGGTGGGTAGGATGTAGAGGG - Intergenic
1135106460 16:19653996-19654018 ATGGGAGATGAGGATGCAGGTGG - Intronic
1136071722 16:27791510-27791532 GTGGGTAGACAGGATGTGGGTGG - Intronic
1136512575 16:30748362-30748384 ATTGGCGGGCAGGATGGAGGCGG + Exonic
1138543760 16:57704536-57704558 ATGGGTGGTGAGGATTGAAGAGG + Intronic
1138644946 16:58417896-58417918 ATGGTTGGTCCGGAGGAAGGGGG + Intergenic
1139149647 16:64366160-64366182 ATGGGTGTTCAGTAAATAGGTGG + Intergenic
1139520419 16:67479791-67479813 AAGGGTGGCCAGGATGTGAGGGG - Intronic
1142325829 16:89413922-89413944 CTGGGTGGCCAGGTTGGAGGTGG - Intronic
1142436205 16:90059415-90059437 AATGGTGGGCAGGATGAAGGTGG - Intronic
1143704375 17:8687065-8687087 AGGGGTGGTCAGGATGAAGCTGG - Intergenic
1143885329 17:10060905-10060927 ATGGGTTGTCATGACGGAGGTGG + Intronic
1144089437 17:11841078-11841100 AAGGTTGGCCAGGATGTGGGAGG - Intronic
1146627021 17:34442617-34442639 AGGGGTTGTCAGCATGGAGGTGG - Intergenic
1147053939 17:37819431-37819453 AAGGGTGGGCAGGATTTAGAAGG + Intergenic
1148657474 17:49298556-49298578 GTGGGTGGTGAGGGTGTGGGTGG + Exonic
1148736934 17:49870173-49870195 ATGGGTGCTCACCAGGTAGGTGG + Intergenic
1149353832 17:55818880-55818902 AAGGGTGGCCAGGAGGGAGGAGG + Intronic
1149586406 17:57790574-57790596 ATGGGTGTTCAGGATGGGGAGGG - Intergenic
1150411138 17:64941326-64941348 ATGGGTGGGCAGTGTGTAGATGG + Intergenic
1151307594 17:73273175-73273197 AGGGAAGGTCAGGATGTTGGTGG - Intergenic
1152262753 17:79275759-79275781 ATGGATGGTCAGGAAGCAGGAGG + Intronic
1152586536 17:81191895-81191917 ATGGGTGGTGAGAATGTGTGTGG + Intronic
1153110374 18:1579237-1579259 ATGGTTGGACAGGAAGCAGGGGG + Intergenic
1154393250 18:13962414-13962436 AGGGCTTGTCAGGATGTGGGGGG - Intergenic
1155085475 18:22453911-22453933 CTGGGGAGTCAGGATTTAGGGGG + Intergenic
1156591365 18:38492726-38492748 ATTGTTGGTGAGGATGTGGGAGG + Intergenic
1157350209 18:46877465-46877487 ATGGGTGGTCAGGAGTGAAGAGG - Intronic
1157488617 18:48107186-48107208 AAGGGAGGTCAGGAGGGAGGAGG + Intronic
1158619126 18:59015672-59015694 ATGGTTGGCCAGGAGGCAGGAGG + Intergenic
1158889755 18:61862175-61862197 TAGGGGGGTCAGGATGGAGGAGG - Intronic
1160795326 19:942623-942645 GTGGGTGGGCAGGGAGTAGGTGG + Intronic
1160901359 19:1430279-1430301 AGGGGTGGACACGATGTAGGAGG - Exonic
1161871681 19:6875340-6875362 ATGGGGGGGGAGGATGGAGGAGG + Intergenic
1162159689 19:8702635-8702657 ATGGGTGGTCAGGAAGCAAAGGG - Intergenic
1163370138 19:16897068-16897090 AAGAGTGGTCAGGACGGAGGGGG - Intronic
1163604700 19:18267541-18267563 GGGGGTGGTCAGGGTGTAGCAGG + Intronic
1164561919 19:29298384-29298406 AAGGGTGGGGAGGATGGAGGGGG + Intergenic
1164621748 19:29700108-29700130 AGGGGTGGGCAGGCTGTGGGAGG + Intronic
1164862748 19:31575494-31575516 TTGGGTGGTCTGGAAGGAGGAGG + Intergenic
1165814464 19:38633140-38633162 ATGGGTAGCCAGGGTGTATGTGG + Intronic
1167794178 19:51698507-51698529 ATGAGAGGCCAGGATGTTGGAGG - Intergenic
1168137279 19:54360123-54360145 ATGGGGGCTCAGGGTGGAGGAGG - Intronic
1168160798 19:54508962-54508984 ATGGGGGCTCAGGGTGGAGGAGG + Intronic
925012998 2:500017-500039 ATTGATGCTCAGGATGTTGGCGG + Intergenic
926336180 2:11864461-11864483 ATATGTGGTCAGGAAGAAGGGGG - Intergenic
926759304 2:16263190-16263212 AGGGGTGGTCAGTAGTTAGGCGG + Intergenic
927268005 2:21174584-21174606 ATATATGGTCAGCATGTAGGAGG + Intergenic
927667849 2:25044584-25044606 AGGGGAGGTCAGGAGGTGGGAGG - Intronic
929436514 2:41932641-41932663 AGGGGTGGACAGGAATTAGGTGG - Intergenic
933612388 2:84450777-84450799 ATGTGAGGTCAGGACTTAGGTGG - Intronic
933815995 2:86069299-86069321 GTGGGTGGTGAGGGTGAAGGAGG + Intronic
933925905 2:87091044-87091066 ATGGGTGGAGAGGAGATAGGAGG - Intergenic
935056732 2:99573927-99573949 AACGGTGGGCAGGATGGAGGAGG + Intronic
936839385 2:116751698-116751720 ATGGGTGTTGAGGATGAAGCGGG - Intergenic
937081736 2:119145164-119145186 TTGGGAGGTCTGGATGTAGAAGG - Intergenic
937908447 2:127064084-127064106 AGGGGTGGGCAGGAGGTGGGAGG - Intronic
938842079 2:135173705-135173727 ATTGGTGGGCAGGATGTGGAAGG + Intronic
939997469 2:148933158-148933180 ATGGGTAGAGAGGATGTGGGCGG - Intronic
941406471 2:165095143-165095165 ATGGGTGGTGACTATGTAGTAGG + Intronic
942153855 2:173106840-173106862 ATTGGTGGTCAGCAAGTAGGGGG + Intronic
945185103 2:207132522-207132544 GTGGGTGGTGAGGATGTTGGAGG + Intronic
946184931 2:217975307-217975329 TTGGGGGGTCAGGATGTTGGGGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
947211205 2:227710204-227710226 AGGAGTGGGCAGGAAGTAGGTGG - Intronic
948539925 2:238683786-238683808 TTGGGTGGTTAGGTTGTGGGAGG - Intergenic
1175831452 20:61967188-61967210 ATGAGTGCTCAGGACGGAGGCGG + Intronic
1178000810 21:28160226-28160248 ATGGATGGTCAGGATGGAATAGG + Intergenic
1178859159 21:36274685-36274707 GTGGGTGGTCAGGATGGTGAGGG + Intronic
1181279632 22:21709897-21709919 ATCGGTGGTCATGACGTATGAGG + Intronic
1182351917 22:29704279-29704301 CGGGGTGGTCAGGAGGTGGGAGG - Intergenic
1182351935 22:29704319-29704341 CGGGGTGGTCAGGAGGTGGGGGG - Intergenic
1183281683 22:36935780-36935802 TTGGGTGGTAGGGATGTAGGTGG + Intronic
1183466315 22:37982138-37982160 AGGAGTGGTCAGGAGGTTGGGGG - Intronic
1183546450 22:38456603-38456625 CAGGATGGTCAGGATGTAGCTGG - Intergenic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1183734714 22:39637381-39637403 ATGGGGGGACAGGGAGTAGGTGG + Intronic
1184959223 22:47917096-47917118 GTGGGTGCTCAGGCTGTGGGGGG - Intergenic
949232374 3:1766438-1766460 GTGGGGGGTCAGGAAGTGGGAGG + Intergenic
949406351 3:3718752-3718774 ATGGTTGGTCTAGATGTAGGTGG - Intronic
950915263 3:16638000-16638022 ATGGGTGGACAGGTTGAAGGCGG + Intronic
955307166 3:57845334-57845356 ATGGGTGCTCAGAAGGGAGGTGG + Intronic
955946918 3:64204235-64204257 ATGGGAGGTCAGGATGGGGAGGG + Intronic
956104132 3:65798897-65798919 ATGGGTGGTGAGGGTATACGGGG - Intronic
956116980 3:65928942-65928964 ATGGGTGGGCAGGACATAAGAGG + Intronic
957318277 3:78595656-78595678 GTGGGTGGTCAGGAAGCAGGCGG - Intergenic
959921830 3:111876722-111876744 ATGGCTTGTCAGGGTGTGGGGGG - Intronic
961844733 3:129752087-129752109 TTGGGAGGTCAGGATTAAGGTGG - Intronic
963273487 3:143308101-143308123 ATCAGTGGTCAGGGTGAAGGTGG - Intronic
964457636 3:156885788-156885810 CTGGATGGTCAGGATGTTGCAGG + Intronic
964974021 3:162598746-162598768 ACAGGTGGTGAGGATGTGGGGGG - Intergenic
966443667 3:179976167-179976189 AGGAGTGGTCACGATGCAGGTGG + Intronic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
969696351 4:8737311-8737333 AGGGGAGGTCAGGGTGCAGGAGG + Intergenic
971177400 4:24293368-24293390 AGGGGTGGTGAGGGGGTAGGAGG - Intergenic
971355520 4:25891360-25891382 CTGGGAGGTGAGGATGAAGGTGG - Intronic
976220756 4:82755114-82755136 ATGGGGGGTGAGGATGGGGGTGG + Intronic
977167758 4:93722631-93722653 ATGGGTGGTGAGAAAGTGGGAGG - Intronic
981602701 4:146508618-146508640 ATGGGTGAGGAGGATGTAGAAGG - Intronic
984363041 4:178761896-178761918 TTGGGTGAGCAGGATGTAGTTGG - Intergenic
984930298 4:184841361-184841383 ATGAGTGGTCAGGCAGAAGGAGG + Intergenic
985524985 5:397160-397182 ATGGATGGTCAGGAGCTACGTGG - Intronic
985525052 5:397429-397451 ATGGATGGTCAGGAGCTACGTGG - Intronic
985525093 5:397600-397622 ATGGATGGTCAGGAGCTACGTGG - Intronic
985525160 5:397886-397908 ATGGATGGTCAGGAGCTACGTGG - Intronic
985525191 5:398020-398042 ATGGATGGTCAGGAGCTACGTGG - Intronic
985525229 5:398212-398234 ATGGATGGTCAGGAGCTACGTGG - Intronic
987864821 5:23525332-23525354 AATGGTGGGCAGGATGAAGGTGG + Intronic
991568568 5:68030634-68030656 AGGAGTGGTCAGGATTTTGGCGG - Intergenic
996663203 5:126027797-126027819 ATGCGTGGTCATGTTGGAGGTGG - Intergenic
997089487 5:130840731-130840753 ATTGGTGGTCATGATGGTGGGGG - Intergenic
997715095 5:136036630-136036652 ATGGGTGGTCAGGTGGGAAGGGG + Intronic
997778645 5:136634749-136634771 GTGGGTATTCAGGATGGAGGGGG + Intergenic
998508436 5:142691011-142691033 ACGGGTGGTCAGGCTGCAGGTGG - Intronic
999812927 5:155144955-155144977 TTGAGTGATTAGGATGTAGGTGG + Intergenic
1000610398 5:163367367-163367389 GGGGGTGGTCAGGAAGTAGAGGG + Intergenic
1001909297 5:175502021-175502043 CTGGTTGGTCAGGTTGTAGATGG + Intronic
1002426655 5:179180771-179180793 AGGGGTGGTCAGGAGGCAGAGGG - Intronic
1002590545 5:180288810-180288832 ATGGGTGGTAAGGGTGCAAGTGG + Intronic
1004440713 6:15650184-15650206 ATGTGTGGTAAAGATGTATGTGG - Intronic
1004884280 6:20036791-20036813 ATGGGAGGACAGGTTGGAGGAGG - Intergenic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1006021812 6:31121746-31121768 AAGGGCGGTCAGGAGGTAGAGGG - Intronic
1006079166 6:31555170-31555192 ATGGGTGGTGGGGCTGTAGGTGG - Intronic
1006098069 6:31668617-31668639 ACGGTTGGTAAGGATGTAGCGGG - Exonic
1006267320 6:32936120-32936142 ATGGGAGATCTAGATGTAGGAGG - Intronic
1006947084 6:37791735-37791757 GAGGGTGGCCAGGGTGTAGGAGG - Intergenic
1007395020 6:41572773-41572795 CTGGCTGGGCAGGATGGAGGAGG - Intronic
1009194255 6:60665545-60665567 ATGGGTGATCAGGATGAGAGAGG - Intergenic
1010255013 6:73747801-73747823 ATGGGTGGTCAGGCAGCATGAGG - Intronic
1010419769 6:75659784-75659806 ATGGGTAGGCAGGAGGAAGGAGG - Intronic
1013580435 6:111528938-111528960 ATGGCTGGTCAGGATTTTGGAGG + Intergenic
1015787684 6:136934538-136934560 AGGGCTGGTCAGGATGAGGGAGG - Intergenic
1016894876 6:149041792-149041814 AAGGGTGGTCAGCATGGAGAGGG - Intronic
1019964879 7:4490683-4490705 GTGGGTGGTCAGGATGGAAAAGG - Intergenic
1022472767 7:30691856-30691878 ATGGGTGGGCAGGGAGGAGGAGG + Intronic
1022841056 7:34164165-34164187 GTGGGTGGTGAGGATGTGAGAGG + Intergenic
1023265273 7:38398546-38398568 AAGGGTAGTGAGGAAGTAGGGGG + Intronic
1023707802 7:42960609-42960631 ATTTGTGATCAGGATGGAGGAGG - Intergenic
1023723680 7:43120271-43120293 AAAGGGGGTCAGGATGCAGGTGG - Intronic
1026776105 7:73231939-73231961 ATGGGTGCTCTGGATGGAGAGGG - Intergenic
1027016962 7:74785310-74785332 ATGGGTGCTCTGGATGGAGAGGG - Intronic
1027071065 7:75160626-75160648 ATGGGTGCTCTGGATGGAGAGGG + Intergenic
1029173441 7:98646787-98646809 CTGGGTGGTCAGCCTGGAGGAGG - Intergenic
1029927295 7:104330292-104330314 ATGGATGGTCTGGTTGTAGAAGG + Intronic
1031037545 7:116804503-116804525 ATGGGGAGTGAGGATGGAGGGGG - Intergenic
1032532406 7:132633104-132633126 AAGGGCAGTCAGTATGTAGGGGG + Intronic
1034077173 7:148243320-148243342 AGAGATGGTCAGGATGTTGGAGG - Intronic
1035564892 8:634997-635019 ACGGGTGGCCAGGCTGCAGGAGG - Intronic
1036727135 8:11230352-11230374 AGGGGTGCTCAGGATGCATGGGG + Intergenic
1038050451 8:23804922-23804944 ATGAGTGGTGAGGATGTAAGAGG + Intergenic
1040110582 8:43565528-43565550 ACAGGTGGCGAGGATGTAGGGGG - Intergenic
1042634908 8:70863361-70863383 ATAGGTGGTATGGATGTAGTAGG + Intergenic
1044429745 8:92095281-92095303 AGGGGTGGCCAGGAGGAAGGGGG - Intronic
1044693974 8:94904785-94904807 AGGGGTGGTCAGGAAGCAGAAGG - Intronic
1045702500 8:104882649-104882671 TTTGGTGGTCAGGTTATAGGTGG + Intronic
1047717592 8:127609993-127610015 AAGGGTGGTCAGGAGGGAGAAGG - Intergenic
1048543864 8:135367742-135367764 AGGGTTGGTCAGGAAGTTGGTGG - Intergenic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1049365624 8:142235430-142235452 ATGGGGGGCCAGGGTGCAGGGGG - Intronic
1052030231 9:23620103-23620125 ATGGGGGCTCAGAGTGTAGGTGG + Intergenic
1053456598 9:38237865-38237887 ATGGGTGAACAGGATGGAAGAGG - Intergenic
1055168309 9:73223623-73223645 GTGGGTGGTCAGGCTGGAGGTGG - Intergenic
1057240506 9:93404130-93404152 ATGGTTGGTCAGGAAGGAGGTGG + Intergenic
1057983833 9:99689244-99689266 ATGGGTGGGATGGATGCAGGAGG + Intergenic
1059637508 9:116185297-116185319 ATGGCTGAGCAGGAAGTAGGAGG + Intronic
1060760097 9:126239758-126239780 TTGGGTGGACAGGATGGAGGTGG + Intergenic
1061753118 9:132794391-132794413 AAGGGTGTTCCGGATGGAGGAGG - Intronic
1062427097 9:136511097-136511119 ATGGGAGGTCAGGATGTCTGCGG - Intronic
1186753889 X:12649792-12649814 AGGGATGGTCAGGATCTATGGGG - Intronic
1186761365 X:12726196-12726218 ATGGGTGGCCAGGGTATAGGTGG - Intergenic
1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG + Exonic
1189917667 X:45872697-45872719 ATGAGTGGTGAGGATGCAGGTGG + Intergenic
1192446914 X:71217802-71217824 AGGGGTGGCCAGGATGTCTGTGG + Intronic
1192458583 X:71298502-71298524 ATGGGAGGTAAGGACTTAGGAGG + Exonic
1192713352 X:73615370-73615392 TTGGGTGGACAGGATCTTGGGGG + Intronic
1194382587 X:93213576-93213598 AGGGGTGGGCAGAATGGAGGAGG - Intergenic
1195054834 X:101134226-101134248 ATGGGTGGTTAGGAATTGGGAGG + Intronic
1198295716 X:135284399-135284421 ATGAGTAGTCAGGATGCACGGGG + Intronic