ID: 920231873

View in Genome Browser
Species Human (GRCh38)
Location 1:204476013-204476035
Sequence GACCAAGAAGGCCACCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920231873 Original CRISPR GACCAAGAAGGCCACCCCCA AGG Intronic
900703853 1:4063754-4063776 GCCCCAGAAAGCCACCCTCAGGG + Intergenic
901082172 1:6589643-6589665 GCCCAACAAGGCCAGCCCCGTGG - Intergenic
901432209 1:9223239-9223261 GAAGAAGAAGGCCACACCTAGGG - Intergenic
903189390 1:21648291-21648313 CACCCAGAAGGCCCACCCCAGGG - Intronic
904576580 1:31508964-31508986 GACCCGGAAGGACACTCCCAGGG - Intergenic
904862022 1:33545693-33545715 GACCAAGACGGACACTGCCATGG - Intronic
906528893 1:46512077-46512099 GGCCCAGGAGGCCACCCCCTGGG - Exonic
910440169 1:87243608-87243630 GAGCAAGATGGCCACCCCACAGG + Intergenic
917444852 1:175098564-175098586 GAGCAAGAAGGCCGACACCAAGG + Exonic
920231873 1:204476013-204476035 GACCAAGAAGGCCACCCCCAAGG + Intronic
923523715 1:234756622-234756644 AATCAAGAAGCCCATCCCCAGGG + Intergenic
923834089 1:237590798-237590820 GCCCAAAAAGGCCAGCCCCAGGG - Exonic
1067038291 10:42934594-42934616 GGTAGAGAAGGCCACCCCCACGG - Intergenic
1067557270 10:47281700-47281722 CCCCAAGAAAGCCACACCCATGG - Intergenic
1069901924 10:71711266-71711288 GAGCAATAAGCCAACCCCCAAGG + Intronic
1073058561 10:100718434-100718456 GACCAACCAGGCCTCCCCTAAGG - Intergenic
1075728101 10:124620888-124620910 GACCAGCAAGCCCAGCCCCAGGG - Exonic
1076436602 10:130450276-130450298 GCCCAAGAGGACCACGCCCAAGG - Intergenic
1077057535 11:602151-602173 TACCAAGGAGGCCGCTCCCAGGG - Intronic
1077240672 11:1508846-1508868 GACCCGGAAGCCCACTCCCAGGG + Intergenic
1078104648 11:8351031-8351053 GACCAGGCAAGCCATCCCCAGGG - Intergenic
1083270150 11:61568056-61568078 GAACACAAAGGCCTCCCCCAGGG + Intronic
1083343061 11:61971393-61971415 AACCAAGCAGGCCTTCCCCAAGG - Intergenic
1083752468 11:64768078-64768100 GACCAAGAGAGCCAGCCCCCAGG + Intronic
1084660450 11:70543555-70543577 GCCCAGGCACGCCACCCCCAAGG - Intronic
1084872549 11:72108026-72108048 CAGTAAGAAGGCGACCCCCAGGG - Exonic
1085347728 11:75779074-75779096 GACCAGGAAGGCCACACCTCGGG - Intronic
1087006766 11:93479147-93479169 GCCCAAGAAGGAGACCTCCAAGG - Exonic
1091540639 12:1458156-1458178 GACCAAGAAGCCAGCCCACATGG + Intronic
1092016694 12:5165350-5165372 GACCATGAGGCCCACTCCCAGGG + Intergenic
1093185079 12:16010678-16010700 CACCTAGATGGCCAACCCCAGGG + Intronic
1093669609 12:21858151-21858173 GAGGAAGAAAGCCACACCCAGGG + Intronic
1102260585 12:111440827-111440849 GAGCAAGAAGGCCCCTCCCTGGG - Intronic
1105296273 13:19090092-19090114 TACCACGAAAGCCACACCCATGG + Intergenic
1107539810 13:41378011-41378033 GACTAAAAAGGCCTCTCCCAAGG - Intergenic
1107699139 13:43030297-43030319 AACCAAGATTGCCACCCTCAAGG + Intronic
1109596711 13:64565571-64565593 GACCAAGAACACCTCCCCCCTGG - Intergenic
1115071814 14:29332190-29332212 GACCAAGAAGTCCAACATCAAGG - Intergenic
1121193483 14:92049334-92049356 GACCAAGACAGGCACCCCCACGG + Exonic
1121265867 14:92602278-92602300 GCCCAAGAAGGCCTCACCAAGGG + Intronic
1121820061 14:96958848-96958870 GACCAAGCAGGCTGCCCCCAGGG - Intergenic
1122135975 14:99633242-99633264 AGCCCAGAAGGTCACCCCCAGGG + Intergenic
1122673018 14:103386111-103386133 GAGCACGAATGCCACCCCGAAGG - Intronic
1122792972 14:104192239-104192261 GACCAGGAAGGCCAGGTCCAGGG + Intergenic
1122848502 14:104513780-104513802 GACCCAAAGGGCCACCACCAGGG + Intronic
1125405532 15:39349367-39349389 GACCAAGAAGTCCAGCAGCAAGG + Intergenic
1130956080 15:88628424-88628446 CACCAGGGAGGCCACGCCCAGGG - Intronic
1131183037 15:90253481-90253503 GACAAGAAAGACCACCCCCAGGG + Intronic
1131298413 15:91172776-91172798 GACCAATAATTCCACCCCAAAGG + Intronic
1132397892 15:101488442-101488464 GAGCAAGCAGGCCACGCCCTGGG - Intronic
1132551776 16:556569-556591 GCCCAGGAAGGCCAGCCCCGGGG + Intergenic
1133947545 16:10361792-10361814 CACCAACAAGGTCAGCCCCAGGG + Intronic
1142270236 16:89085169-89085191 GCCCCAAACGGCCACCCCCAGGG - Intergenic
1142675530 17:1511094-1511116 GTCCATGAAGGCAACGCCCATGG + Intronic
1145029628 17:19494991-19495013 GTCCAAGAGGCCCACCCGCAGGG - Intergenic
1146371992 17:32270480-32270502 GACCAACAAGACCAACACCATGG - Intronic
1147546105 17:41402912-41402934 CACCGAGAAGGTCACCCCTAGGG + Intergenic
1147789798 17:43006689-43006711 GACCAAGAAGGCTCCTCCCAGGG + Intergenic
1151411498 17:73933307-73933329 GCCCTAGATGGCCTCCCCCACGG - Intergenic
1151555472 17:74844363-74844385 GACCAGCAGGGCCAGCCCCATGG + Exonic
1151890885 17:76949738-76949760 GTGCATGAAGGCCACCCCCCAGG - Exonic
1152676821 17:81645461-81645483 GCCCCAGAGGGCCACCACCAGGG - Exonic
1153974227 18:10253257-10253279 GACCAAAGAAGCCACCCACAAGG + Intergenic
1155052608 18:22161958-22161980 GTCCAAGAGGGCCAGGCCCAGGG - Intergenic
1156496004 18:37525411-37525433 AACCCAGAAGGCCACCCCGAAGG - Intronic
1156628129 18:38934339-38934361 GAGCAAGAAGGCCTAACCCAGGG + Intergenic
1163146243 19:15380576-15380598 GTCCAAGAAGTCCTCCCTCATGG - Exonic
1164599308 19:29549993-29550015 AAACAAGAAGGCAGCCCCCAAGG - Intronic
1164719546 19:30422516-30422538 AACACAGTAGGCCACCCCCATGG - Intronic
1168058502 19:53877142-53877164 GATCATGAAGGCCAGACCCAGGG - Intergenic
1168342774 19:55635250-55635272 ATCCAAGAAGCCCACCCTCAAGG - Intronic
925629882 2:5881237-5881259 GACCAAGAAGGCAACTTCAATGG + Intergenic
932233689 2:70103710-70103732 GGCCAAGAAGCCCACCCAGATGG - Intergenic
932492267 2:72130029-72130051 TACCAGGCTGGCCACCCCCAGGG + Exonic
932772258 2:74507210-74507232 GATGAAGGAGGCGACCCCCAAGG - Intronic
934553642 2:95276555-95276577 GACCAGGAAGGGCAGCCTCAGGG + Intronic
936526405 2:113244554-113244576 GCCCAAGGTGGCCACCCCCAAGG - Exonic
939884401 2:147665575-147665597 GATCATGAAGGCCATGCCCAAGG - Intergenic
947285590 2:228511024-228511046 GACCAAGATGTCCACTTCCAGGG - Intergenic
947621334 2:231593110-231593132 CTTCAAGACGGCCACCCCCAGGG + Exonic
947835057 2:233169317-233169339 GAACATGAACGACACCCCCACGG - Exonic
947969124 2:234307104-234307126 CACGATCAAGGCCACCCCCAAGG - Intergenic
948830594 2:240596696-240596718 GGCCAAGAACACCACCCCCGGGG + Exonic
1170607776 20:17886698-17886720 CACCAAGAAGCCCAGCCCCAGGG + Intergenic
1171180260 20:23086177-23086199 GACCGGGATGGCCACCTCCATGG - Exonic
1171369096 20:24649122-24649144 GGCCAAGGAAGCCTCCCCCAGGG + Intronic
1172128826 20:32642433-32642455 GACCAAGAAGTCCACACCCCAGG + Intergenic
1173149278 20:40551644-40551666 GGCAAAGAAGGCCTCCCACAGGG + Intergenic
1175259351 20:57664808-57664830 GGCCAAGCAGGCCACACCCAAGG + Intronic
1175908817 20:62394966-62394988 GACCGAGAAGGCCGCGCACAGGG + Exonic
1179656697 21:42850358-42850380 GTCCCAGAAGGCGCCCCCCACGG - Intronic
1181277188 22:21694537-21694559 GCTCAAGGAGGGCACCCCCACGG - Intronic
1182827055 22:33274404-33274426 CACCAAGAAGCCCACCACTAGGG - Exonic
1184374101 22:44100668-44100690 GCCCAAGAAGGCCAGCACCATGG - Intronic
1185149098 22:49154128-49154150 GGCCAAGAAGGACCCCCGCAAGG - Intergenic
950467409 3:13163447-13163469 GACCAAGAAGGCCATGGTCATGG - Intergenic
953043045 3:39271947-39271969 CACCCTGAGGGCCACCCCCAAGG - Intronic
953110826 3:39936434-39936456 GACCACGAAGGCCAACTCCATGG + Intronic
953434138 3:42865263-42865285 CACGAAGAAGGCCACCACCAAGG - Exonic
954967869 3:54626772-54626794 GACCCAAAAGCCCACACCCATGG - Intronic
959776752 3:110173983-110174005 GAACTAGAAGGCTACTCCCAAGG + Intergenic
961328223 3:126124210-126124232 GACAAAGGAGGCCCCTCCCATGG - Intronic
963616058 3:147539545-147539567 GATCAAGAAGGCTTCCCCCTGGG - Intergenic
968471983 4:786596-786618 GCCCAAGAAGGCCATCCCGCCGG - Exonic
969633650 4:8352882-8352904 CACCAGGAAGGCCACCTCCAAGG + Intergenic
970403820 4:15743206-15743228 CACCAAGATGGTAACCCCCATGG + Intergenic
975749521 4:77508463-77508485 GACCAAGCAGGTCAGTCCCAGGG + Intergenic
978016799 4:103754348-103754370 GATAAATAAGGCCATCCCCAGGG - Intergenic
985618614 5:939719-939741 CCCCAAGCAGGCCACACCCATGG - Intergenic
985635190 5:1032416-1032438 GACCAAAAAGGCCTGTCCCATGG + Intronic
987316706 5:16730985-16731007 GAGCAGGGAGGCCACCTCCAAGG + Intronic
987454046 5:18121025-18121047 GCACAAGAAGGTCAACCCCAAGG + Intergenic
989187082 5:38636071-38636093 GACCCAGGTGGCCACCTCCAGGG - Intergenic
991720930 5:69493610-69493632 GACCAAAAGGGCTGCCCCCAGGG + Intronic
994464371 5:100108649-100108671 GGCCTAGGAGGCCAGCCCCAGGG + Intergenic
995272223 5:110234726-110234748 GACCAAAAAGACCTCTCCCAGGG - Intergenic
997816983 5:137028543-137028565 GAATATGAAGCCCACCCCCAGGG - Intronic
998159155 5:139803379-139803401 AACCAAGCTGGCTACCCCCAGGG - Intronic
998222996 5:140303058-140303080 CACCAAGATGGCCGCCCCCGTGG - Exonic
999197632 5:149793235-149793257 GACCAAGAAGAGCTGCCCCATGG - Intronic
999566985 5:152874945-152874967 GCACAAGAAGACCATCCCCAAGG + Intergenic
1000261121 5:159589626-159589648 GACCAAGAGGGTCACTCCAATGG - Intergenic
1001960893 5:175879928-175879950 GCCCAAGAAGGCCATCCCTGCGG + Exonic
1002421632 5:179152168-179152190 GACCAAGAAGGGGCCCCCCTTGG - Exonic
1004168379 6:13276328-13276350 GCCCTTGAGGGCCACCCCCACGG - Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1011786309 6:90849169-90849191 GACCAAGAATCCCACTCCCTGGG - Intergenic
1012358768 6:98350122-98350144 GACAGAGAAGTCCACTCCCAAGG + Intergenic
1018717283 6:166543362-166543384 GACCAAGAAGGCCTTGCCCAGGG - Intronic
1019379577 7:713827-713849 AACCAAGCAGGCCACCCTCGGGG + Intronic
1023909437 7:44542746-44542768 GCCCAAGAAGGTCCCCTCCAAGG + Intergenic
1029923695 7:104293722-104293744 GACCAAGTAGGTCACCTTCAAGG + Intergenic
1031715580 7:125105092-125105114 GACCCAGAAAGCCCCCTCCATGG - Intergenic
1032060080 7:128716865-128716887 TACCGAGGAGGTCACCCCCAGGG - Exonic
1034452136 7:151142768-151142790 GAGCAGGAGGGGCACCCCCAAGG - Intronic
1034588812 7:152121054-152121076 GACTGAGAAGACCACCCCCAAGG - Intronic
1036287280 8:7454608-7454630 GACCCAGAAAGCAATCCCCACGG + Intronic
1036334200 8:7856917-7856939 GACCCAGAAAGCAATCCCCACGG - Intronic
1036789890 8:11710268-11710290 GAGCCAGACGGCCACCCCCAGGG + Intronic
1041633732 8:60118612-60118634 GTCAAAGAAGGCCAGCCACAAGG + Intergenic
1042877985 8:73457367-73457389 GGCCAACAAGGCTGCCCCCAGGG + Intronic
1045365984 8:101476655-101476677 GACCAACATGGCCAAGCCCATGG - Intergenic
1046717504 8:117583799-117583821 AACCAAGAAGGCAACACACAGGG + Intergenic
1046798378 8:118397305-118397327 AACCAACAAGGACACTCCCAAGG + Intronic
1048273784 8:133050475-133050497 GACCGGGAAGGCAGCCCCCAGGG - Intronic
1048342992 8:133555113-133555135 GAGGAAGCAGGCCACCCCCGCGG + Intronic
1048846450 8:138607253-138607275 GACTCAGAAGGCCACCTGCAAGG - Intronic
1049152127 8:141041762-141041784 GGCAAAGAAGGTCATCCCCAGGG - Intergenic
1049438773 8:142599737-142599759 GGCCAAGGAGGCAGCCCCCAAGG + Intergenic
1049749312 8:144275878-144275900 GACCATGCACGCCACGCCCAGGG + Intronic
1052947180 9:34178030-34178052 GACACAGAAGGCCAGCGCCATGG + Intergenic
1056126291 9:83538621-83538643 GACTGAGCAGGCCACCACCAGGG - Intergenic
1056698305 9:88879341-88879363 CACCAAGAAGGCCCCTCCCATGG + Intergenic
1057263482 9:93599095-93599117 TACCATGAAAGCCACACCCATGG - Intronic
1061317066 9:129803083-129803105 CACCAACATGGCCGCCCCCAAGG + Intergenic
1061762815 9:132862222-132862244 CAGCAAGGCGGCCACCCCCACGG - Intronic
1062203866 9:135324678-135324700 AACCATGAAGGGCACCCCGAGGG + Intergenic
1186910476 X:14159251-14159273 GACTAATTAGGCCAGCCCCAAGG + Intergenic
1189496876 X:41516529-41516551 GAACAAGAAAGCCACGCTCAGGG + Intronic
1190133483 X:47772592-47772614 TTCCAAGAAGGCAGCCCCCATGG - Intergenic
1192762411 X:74106981-74107003 GACCATGAAGTCCACCAACATGG - Intergenic
1194377650 X:93154617-93154639 GACCAAGCAGGCCAACTCCTGGG - Intergenic