ID: 920232939

View in Genome Browser
Species Human (GRCh38)
Location 1:204482268-204482290
Sequence GAATAGCCAAGGCCAGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920232939_920232948 6 Left 920232939 1:204482268-204482290 CCAAACCCTGGCCTTGGCTATTC 0: 1
1: 0
2: 1
3: 31
4: 235
Right 920232948 1:204482297-204482319 CAGGTTGATCCAGGTGGCCACGG 0: 1
1: 0
2: 2
3: 14
4: 215
920232939_920232945 0 Left 920232939 1:204482268-204482290 CCAAACCCTGGCCTTGGCTATTC 0: 1
1: 0
2: 1
3: 31
4: 235
Right 920232945 1:204482291-204482313 TTAGCCCAGGTTGATCCAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 107
920232939_920232944 -3 Left 920232939 1:204482268-204482290 CCAAACCCTGGCCTTGGCTATTC 0: 1
1: 0
2: 1
3: 31
4: 235
Right 920232944 1:204482288-204482310 TTCTTAGCCCAGGTTGATCCAGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920232939 Original CRISPR GAATAGCCAAGGCCAGGGTT TGG (reversed) Intronic
900505184 1:3026781-3026803 GAAGGGCCAAGGCCAGGGGATGG + Intergenic
900561895 1:3311320-3311342 GACGAGCCAAGGCCAGAGTTGGG + Intronic
901936896 1:12633066-12633088 CATTTGCCAAGGGCAGGGTTGGG + Intergenic
902405486 1:16181213-16181235 GAATCTCCGAGGCCAGGGCTTGG + Intergenic
902840418 1:19070636-19070658 GAACAGCAAAGGGCAGGGGTTGG + Intergenic
903535426 1:24063407-24063429 CAATAGCCAAGGCCAGTGTTAGG + Intronic
904039873 1:27577548-27577570 GAACAGCCTAGGACAGGGCTTGG + Intronic
904625630 1:31800306-31800328 GAATAGCCAGAGGCAGGGTTCGG - Intronic
905041342 1:34961647-34961669 GAATATTCAAGGCCCAGGTTTGG + Intergenic
910237454 1:85049674-85049696 GAATAGATAAAGCCAGGTTTTGG + Intronic
911296206 1:96118349-96118371 CAAAAGCCAAGGCCTGGGTGAGG + Intergenic
912632460 1:111257465-111257487 AAAAAGCCAAGGCCAGGCTCTGG - Intergenic
913537236 1:119784721-119784743 GCGTAACCCAGGCCAGGGTTGGG + Intergenic
913957404 1:143318475-143318497 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
913958400 1:143322326-143322348 GCAATGCCAAGGCCAAGGTTGGG + Intergenic
913958610 1:143323139-143323161 CAAAAGCCAAGGGCAGGGTCAGG + Intergenic
914051718 1:144143839-144143861 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
914052715 1:144147701-144147723 GCAATGCCAAGGCCAAGGTTGGG + Intergenic
914052927 1:144148519-144148541 CAAAAGCCAAGGGCAGGGTCAGG + Intergenic
914126270 1:144818022-144818044 CAAAAGCCAAGGGCAGGGTCAGG - Intergenic
914126482 1:144818840-144818862 GCAATGCCAAGGCCAAGGTTGGG - Intergenic
914127479 1:144822702-144822724 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
914867417 1:151443059-151443081 TAATACCCAGGGCCAGGGTTAGG + Intronic
915175349 1:154010089-154010111 TAATGGCCAAGGCCTGGTTTGGG + Exonic
916298412 1:163246273-163246295 GAATAGCCAAGCACAGGGCCAGG + Intronic
917967270 1:180186616-180186638 GCATGGCCAGGGCCAGGGATCGG - Intronic
919589460 1:199482275-199482297 TAATAGCCAAGACCAAGGGTTGG + Intergenic
920232939 1:204482268-204482290 GAATAGCCAAGGCCAGGGTTTGG - Intronic
920306229 1:205019912-205019934 GGATTGTCGAGGCCAGGGTTCGG + Exonic
921781249 1:219167425-219167447 AACCAGCCAAGGCCAGGGTCAGG - Intergenic
923712802 1:236400427-236400449 GAGTAGCCGAGGTCAGGGTGAGG + Intronic
924429994 1:243988624-243988646 GAATAGCAAACTCCAGAGTTGGG + Intergenic
924720910 1:246622129-246622151 GATTAGCCAAGGCCAAGATGTGG - Intronic
1066357176 10:34695886-34695908 GCACCGCCAAGGCCACGGTTGGG + Intronic
1066961353 10:42230671-42230693 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1067187672 10:44044178-44044200 GAATGGCCAAGGGGAGGGTCAGG + Intergenic
1067776812 10:49170271-49170293 GAGAAACCAAGGCCAGGGCTGGG - Intronic
1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG + Exonic
1068869415 10:61927520-61927542 AAAGAGCCAAGGCCTGTGTTGGG - Intronic
1075701244 10:124470513-124470535 GAACAGCGAAGGCCAGGGCCAGG + Intronic
1076527086 10:131118681-131118703 TGATAGCCACGGTCAGGGTTGGG - Intronic
1076931617 10:133535458-133535480 AAAAAGCAAAGGCCAGGGATGGG - Intronic
1077722047 11:4639117-4639139 GAATTGCCAGGGCAAGGTTTTGG - Intergenic
1078000071 11:7486689-7486711 GAATAATCAATGCCAGGGTGTGG - Intronic
1079093185 11:17494754-17494776 GAAAAGTCAAGTCCAGGCTTGGG + Intronic
1079241921 11:18727593-18727615 GAGAAGCCAAGGCTAGGGTAAGG - Intergenic
1084381437 11:68815735-68815757 GAATGTCCAGGGCCAGGGTTGGG - Intronic
1084381499 11:68815930-68815952 GAATGTCCAGGGCCAGGGTTGGG - Intronic
1084511183 11:69605228-69605250 GAACAGCCAAGGAGAGGGCTCGG + Intergenic
1084993784 11:72955419-72955441 GAAAAACCCAGGACAGGGTTCGG - Intronic
1085200086 11:74696682-74696704 GAACTGCAAGGGCCAGGGTTTGG + Intronic
1087380539 11:97399311-97399333 GAATCGCCAATCCCAGGGGTTGG - Intergenic
1087450151 11:98310005-98310027 AAATAAACAAGGCCAGGGCTAGG + Intergenic
1088192306 11:107239685-107239707 GAATATTCAGGGTCAGGGTTGGG - Intergenic
1089356591 11:117857972-117857994 CCAAAGCCAAGGCCAGGGTTTGG - Intronic
1090319774 11:125832217-125832239 GGATAGCAAAGGCCAGGCTGAGG - Intergenic
1090718399 11:129451234-129451256 GAACAGCCAGGCCCAGGGTCAGG + Exonic
1090992048 11:131826632-131826654 GAAGAGCAAAGGCCAGGAGTGGG + Intronic
1091284241 11:134399248-134399270 GAATAGACCACGCCAGGATTTGG + Intronic
1091392417 12:133673-133695 GAACAGGCTAGGGCAGGGTTGGG + Intronic
1091392434 12:133772-133794 GAACAGGCTAGGGCAGGGTTGGG + Intronic
1091392451 12:133871-133893 GAACAGGCTAGGGCAGGGTTGGG + Intronic
1091543380 12:1482967-1482989 GAGTAGCCAAATCCAGAGTTGGG - Intronic
1092013215 12:5134223-5134245 GAGTAGCCAAGACCATCGTTTGG + Intergenic
1093856633 12:24112212-24112234 GAATCTCAAAGACCAGGGTTTGG + Intergenic
1095505524 12:42893659-42893681 GATTAGCCAAGGCACAGGTTGGG - Intergenic
1096470150 12:51870440-51870462 GCAAAGCCAAGGCCAGAGGTGGG - Intergenic
1098311162 12:69150533-69150555 TATTTGCCAAGGCCAGGGCTGGG - Intergenic
1103952329 12:124557968-124557990 GAAAAGCCCAGGCCAGGGCCTGG + Intronic
1105522989 13:21148058-21148080 GAAGAGCCAAGGACAAGGTCAGG + Exonic
1105631888 13:22177605-22177627 GAAGAGCCAAGGCCAAGATCTGG + Intergenic
1107981244 13:45736380-45736402 GAATTGCCCTTGCCAGGGTTGGG - Intergenic
1109247975 13:59980599-59980621 GAATAGGGAAGGTCAAGGTTGGG + Intronic
1111632913 13:90866199-90866221 GAAGAGTCCAGACCAGGGTTTGG + Intergenic
1113480541 13:110616510-110616532 GACCAGCCAAGGCCAGGGCAGGG - Intronic
1115290136 14:31761469-31761491 GAGTGGGCAAGGCCAGGGGTGGG - Intronic
1121609822 14:95270090-95270112 GAAGAGCCAGGGCCAGGACTCGG + Intronic
1122359858 14:101152822-101152844 GCAGAGCTAGGGCCAGGGTTGGG - Intergenic
1123421463 15:20140108-20140130 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1123443670 15:20306712-20306734 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1123530689 15:21146648-21146670 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1124199583 15:27667019-27667041 GAAGATCCATGGCTAGGGTTAGG - Intergenic
1125473307 15:40025438-40025460 AACTAGCCTAGGCCAAGGTTGGG + Intronic
1127481801 15:59384692-59384714 GAAAAACCAAGACCAGGGTCTGG + Intronic
1131091411 15:89627373-89627395 GACTTGCCAAGGTCATGGTTGGG - Exonic
1132063680 15:98713128-98713150 GAAAAGGCAAGGCTAGAGTTCGG - Intronic
1132104977 15:99056964-99056986 GAAGAGCCAAGGCAGGCGTTAGG + Intergenic
1132176719 15:99721708-99721730 GAATATCATAGGCCAGGGTCAGG - Intronic
1132603855 16:785571-785593 GAAGAGGCAGGGCCAGGTTTTGG - Exonic
1136470175 16:30474369-30474391 GACTAGCCCAGGCGAGGGTCGGG - Intronic
1136626943 16:31467050-31467072 GAGAAGCCAAGGCCAGGTTCTGG + Exonic
1136722540 16:32337179-32337201 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1136840864 16:33543172-33543194 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1137505712 16:49052095-49052117 GAATAGGCAAGGACTGGGATCGG + Intergenic
1140729406 16:77842618-77842640 GTATGGCCAAAGCCAGGGGTAGG + Intronic
1142319617 16:89372478-89372500 GAAGAGCGAAGGCCAAGGCTTGG + Intronic
1142419742 16:89963033-89963055 GAGTTGCCAAGGCCAGGGCTGGG + Intronic
1203003891 16_KI270728v1_random:180585-180607 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1203135499 16_KI270728v1_random:1716992-1717014 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1203151029 16_KI270728v1_random:1843469-1843491 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1142808852 17:2386025-2386047 CAAGAGCCAAGCCCAGGGCTGGG + Exonic
1142852328 17:2710315-2710337 GTCTAGACAAGGCCAAGGTTTGG - Intronic
1142992339 17:3739740-3739762 GAATTGCCCAGGCAAGCGTTCGG + Intronic
1143107524 17:4536985-4537007 GAAAGGGGAAGGCCAGGGTTAGG + Intronic
1143524112 17:7462574-7462596 GAATAGGCAATGACAGGGGTTGG + Exonic
1144126385 17:12206736-12206758 GAAAAGCCAAAAGCAGGGTTGGG - Intergenic
1144201482 17:12946251-12946273 AAATATCCAAGGCAGGGGTTTGG - Intronic
1145001237 17:19306197-19306219 GCAGAGCCAAGGCCAGGCTCAGG + Intronic
1146837418 17:36123425-36123447 GAATCTCCAAGGCTGGGGTTTGG - Intergenic
1147258416 17:39195488-39195510 GAATAGCGAAGGGAAGAGTTGGG - Intronic
1147310885 17:39595649-39595671 GAAGAGCAGAGGCCAGGGCTGGG + Intergenic
1147819348 17:43232358-43232380 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147819938 17:43235389-43235411 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147821251 17:43242787-43242809 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147822054 17:43247276-43247298 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147822972 17:43252716-43252738 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147825658 17:43268235-43268257 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147826789 17:43274702-43274724 TATTAGCCATGGCCAGGGTTAGG + Intergenic
1147827678 17:43279580-43279602 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147828785 17:43285741-43285763 TATTAGCCACGGCCAGGGTTAGG + Intergenic
1147829880 17:43291884-43291906 TATTAGCCATGGCCAGGGTTAGG + Intergenic
1147843619 17:43389724-43389746 TATTAGCCACGGCCAGGATTAGG + Intergenic
1148357019 17:46982270-46982292 GTATAGCAAAAGCCAGGGGTTGG - Intronic
1149005995 17:51805975-51805997 GCATAGCAAAGGCTAGGGCTTGG + Intronic
1149960565 17:61105240-61105262 GGAAAGCAAAGGCCAGGTTTTGG - Intronic
1151265832 17:72954342-72954364 GAAAGGCCAAGGCCAAGGTCAGG + Intronic
1154311064 18:13266447-13266469 GGAAAGCCAAGCCCAGGGTTGGG - Intronic
1156066564 18:33148918-33148940 GAATAGCCCATGCAGGGGTTGGG - Intronic
1156239659 18:35240888-35240910 GAATCTCCAAGGCCAGGGGAGGG - Intergenic
1159000204 18:62966883-62966905 GAGTTGCCAAGGACAGGGGTTGG - Intronic
1160783475 19:889021-889043 GAGTAGGCGTGGCCAGGGTTGGG - Intronic
1160783486 19:889056-889078 GAGTAGGCGTGGCCAGGGTTGGG - Intronic
1160783502 19:889121-889143 GAGTAGGCGTGGCCAGGGTTGGG - Intronic
1160783524 19:889190-889212 GAGTAGGCGTGGCCAGGGTTGGG - Intronic
1160911794 19:1477769-1477791 AAACAGCCAGGGGCAGGGTTTGG + Intronic
1161958517 19:7509476-7509498 GAATGGGGAAGGCCAGGGTGTGG + Intronic
1162928237 19:13941407-13941429 GAGTGGCCAAGGCCAGGAGTTGG + Intronic
1163260525 19:16186974-16186996 GAATCACCTAGACCAGGGTTAGG - Intronic
1165159156 19:33805733-33805755 GAGTAGCCAAGGGCTTGGTTTGG - Intronic
1165164712 19:33843915-33843937 GCAGAGCCAGGGCCAGGGCTGGG + Intergenic
1167642132 19:50687749-50687771 GAATAGCCATTGCCAGCGTGCGG + Intronic
1202691114 1_KI270712v1_random:96263-96285 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1202692112 1_KI270712v1_random:100125-100147 GCAATGCCAAGGCCAAGGTTGGG + Intergenic
1202692324 1_KI270712v1_random:100943-100965 CAAAAGCCAAGGGCAGGGTCAGG + Intergenic
925769804 2:7270746-7270768 AAATAGCCTAGGCCAGGGTCTGG - Intergenic
929028458 2:37628042-37628064 GAAAAGCAGAGGCCAGGGATGGG - Intergenic
929246377 2:39707792-39707814 CAAGAGTCCAGGCCAGGGTTTGG - Intronic
929727316 2:44444448-44444470 AAAAAGTCAAGGCCATGGTTAGG + Intronic
931388498 2:61818411-61818433 AAATGGCCAATGCCAGGGCTGGG + Intergenic
932739943 2:74283617-74283639 GAAGAGCCCAGGCCATGGTTGGG + Intronic
933954074 2:87353029-87353051 CAAAAGCCAAGGGCAGGGTCAGG - Intergenic
933954286 2:87353847-87353869 GCAATGCCAAGGCCAAGGTTGGG - Intergenic
933955279 2:87357688-87357710 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934238277 2:90249272-90249294 CAAAAGCCAAGGGCAGGGTCAGG - Intergenic
934239467 2:90253901-90253923 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934273718 2:91562797-91562819 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
934274711 2:91566643-91566665 GCAATGCCAAGGCCAAGGTTGGG + Intergenic
934274920 2:91567461-91567483 CAAAAGCCAAGGGCAGGGTCAGG + Intergenic
934322594 2:91982592-91982614 GCAAAGCCAAGGCCAAGGTTGGG - Intergenic
934323566 2:91986422-91986444 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
934461911 2:94217255-94217277 GCAAAGCCAAGGCCAGGGTAGGG - Intergenic
937995526 2:127691387-127691409 GGATAGTGAAGGCCAGGGTGAGG - Intergenic
943484802 2:188465618-188465640 GAATTGCCAATCCCAGTGTTTGG - Intronic
946390089 2:219409803-219409825 GAACAGCAAAGGCCAAGGTCTGG + Intergenic
1168883622 20:1226840-1226862 GAATAGCAAATCTCAGGGTTTGG + Intronic
1169275795 20:4232935-4232957 GAAGAGCTAAAGCCAGGGTGTGG - Intronic
1170872331 20:20217949-20217971 GAAAAGCCAGGGCAAGGATTTGG - Intronic
1171210195 20:23310707-23310729 GGATAGCCAGGGCCAGGGAAGGG - Intergenic
1172224534 20:33296503-33296525 GAACAGCTCAGGTCAGGGTTAGG + Intronic
1174737857 20:52982842-52982864 GACTAGCCAAGCACAGGGCTGGG + Intronic
1176592999 21:8660237-8660259 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1176674085 21:9760903-9760925 AAATAGCCAATTCCAGGGCTGGG - Intergenic
1177467707 21:21510356-21510378 GAATAGCAATGGCCTGGGTGAGG - Intronic
1178762317 21:35414965-35414987 GAATAGCTAATTCCAGGGCTTGG + Intronic
1178784878 21:35644182-35644204 TAGAAGCCAATGCCAGGGTTGGG - Intronic
1180275846 22:10637364-10637386 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1180550333 22:16532309-16532331 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1181354339 22:22289514-22289536 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1181556005 22:23672037-23672059 GAATAGCCAGGGTAAGGGCTTGG - Intergenic
1183586076 22:38753804-38753826 TAAGTGCCAAAGCCAGGGTTTGG + Intronic
1184730919 22:46370626-46370648 GCATAGCCTAGGCCAGGGTGGGG - Intronic
1184752331 22:46494284-46494306 GAATAGCCAAGGCCACTTTGAGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949855755 3:8459487-8459509 GAACAGCCAATGCAAGAGTTTGG - Intergenic
950206455 3:11084737-11084759 GAATCGCCCAGGCCAGGCTGTGG + Intergenic
951958042 3:28279255-28279277 GAAGAACCAAGGACAGGGTTTGG + Intronic
952287641 3:31983503-31983525 GAATAGTCAAGGCCAGGATGGGG + Intronic
955073013 3:55587773-55587795 GAATAGCTTAGTCCAAGGTTTGG - Intronic
956719821 3:72107953-72107975 GAAGTGCCAAGGCCAGGGCCCGG + Intergenic
960132966 3:114076932-114076954 GACAAGCCAAGGCCAGTGTTCGG + Exonic
966836644 3:184054577-184054599 GACTCCCCAAGGCCATGGTTGGG - Intronic
966971238 3:185047427-185047449 TAATTGCTAAAGCCAGGGTTTGG + Intronic
972330210 4:38057264-38057286 GAATAGCCTGTGCCAGGGCTCGG - Intronic
974267649 4:59605463-59605485 GAATAGCCAAGGCCATGCTGAGG + Intergenic
978649957 4:110990089-110990111 GAATAGTGATTGCCAGGGTTTGG - Intergenic
979359057 4:119740516-119740538 GGATCGCCTAGCCCAGGGTTTGG - Intergenic
980646707 4:135652189-135652211 CAAAAGCCAAGGCCTGGGATTGG - Intergenic
980934230 4:139211085-139211107 GAAAAGCCATGCCCTGGGTTGGG - Intergenic
982074129 4:151721587-151721609 GAAGAGCAAAGCCCAGGGTCGGG - Intronic
982153141 4:152485706-152485728 AAATAGCCAAGTCCAGGTCTGGG + Intronic
985238079 4:187898628-187898650 GATTAGCCATTGCCAGGGCTGGG - Intergenic
985331893 4:188846278-188846300 GAATGGGAAAGGACAGGGTTGGG - Intergenic
987698630 5:21365837-21365859 GAAGACCCAAGACCAAGGTTTGG + Intergenic
988754023 5:34225692-34225714 GAAGACCCAAGACCAAGGTTTGG - Intergenic
989595583 5:43153243-43153265 GCCTGGCCAAAGCCAGGGTTAGG - Intronic
990481444 5:56215241-56215263 ATATTGCCAAGGCCAGGGCTTGG - Intronic
991821188 5:70561841-70561863 GAAGACCCAAGACCAAGGTTTGG - Intergenic
991885753 5:71265810-71265832 GAAGACCCAAGACCAAGGTTTGG - Intergenic
995971275 5:117974033-117974055 TAATAGCCAAGACAAGGGTAGGG - Intergenic
997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG + Intronic
998139965 5:139694177-139694199 GCTTGGCCAAGGCCAGGGTGAGG + Intergenic
1001893643 5:175360588-175360610 AAATAGCAACGGCCAGTGTTGGG + Intergenic
1002772647 6:302850-302872 GGAAAGCCAAGGGCAGGGTGAGG + Intronic
1005552204 6:26932532-26932554 GAAGACCCAAGACCAAGGTTTGG - Intergenic
1006438882 6:34041102-34041124 GATTATCCCAGGCCAGGCTTGGG - Intronic
1008024547 6:46619518-46619540 GAATCACCAAGGGCAGAGTTGGG + Intronic
1014053567 6:116986672-116986694 TAGTTGCCAGGGCCAGGGTTGGG + Intergenic
1017488420 6:154923461-154923483 GAATAGGAAAGGACAGGGTGAGG + Intronic
1019180884 6:170186775-170186797 GAATGTAAAAGGCCAGGGTTAGG + Intergenic
1019702916 7:2482735-2482757 GCAGAGGCAGGGCCAGGGTTAGG + Intergenic
1024596035 7:50938506-50938528 GCACAGCTCAGGCCAGGGTTTGG + Intergenic
1024956608 7:54927283-54927305 GAACAGCCAAGCCCAGCATTGGG - Intergenic
1026097236 7:67356189-67356211 AAAGAACCAAGGCCAGGGCTGGG + Intergenic
1026512024 7:71035334-71035356 GAATAGCCAAGGCTAAGGCAAGG + Intergenic
1026598713 7:71755163-71755185 TAAGAGGCAAGGCCAGGGCTTGG + Intergenic
1032027002 7:128450995-128451017 GAATAGGCAAATCCAGGGCTGGG - Intergenic
1032346941 7:131125026-131125048 TATGAGCCAAGACCAGGGTTGGG - Intronic
1033456748 7:141510210-141510232 GTATTGCCAAGGCCAGGGACTGG + Intergenic
1035139112 7:156739032-156739054 CAATAGCCTAGGCCTGGTTTCGG - Intronic
1036943020 8:13069427-13069449 GACTGGCCAAGGCAAGGATTTGG - Intergenic
1038699568 8:29837052-29837074 GAGTATCCCAGGCCAGGGTATGG + Intergenic
1039720742 8:40161616-40161638 TAACAGCCAAGACCAGGGCTAGG - Intergenic
1043983397 8:86666399-86666421 GTAGAGGCAAGGCCTGGGTTAGG + Intronic
1044721914 8:95159349-95159371 AAATGGCCAATTCCAGGGTTGGG - Intergenic
1045578937 8:103457231-103457253 CAATAGACAAGGCCAGCCTTTGG + Intergenic
1045742139 8:105373923-105373945 GAATAGCCAACACCTGGGCTGGG + Intronic
1047458104 8:125034748-125034770 GAATTGCCAAGGCCTAGGTTAGG - Intronic
1047972505 8:130097407-130097429 GCATAGCCAGGGTCAGGGATGGG - Intronic
1048537446 8:135310829-135310851 GAATGGCCAAAGCAGGGGTTGGG - Intergenic
1050009642 9:1172546-1172568 GGACAGCAAAGTCCAGGGTTTGG + Intergenic
1050083850 9:1943298-1943320 TAATTGCCAATGCCAGGATTTGG + Intergenic
1050672789 9:8016722-8016744 GCAGAGCCAGGGCCAGGCTTGGG + Intergenic
1050700945 9:8338040-8338062 CAACAGCCAGGGCCAGGCTTTGG + Intronic
1053692394 9:40592939-40592961 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054272422 9:63044594-63044616 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1054303636 9:63393857-63393879 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054402414 9:64720367-64720389 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054436024 9:65204698-65204720 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic
1054494368 9:65816989-65817011 GCAAAGCCAAGGCCAGGGCAGGG + Intergenic
1057180784 9:93028948-93028970 GAAGAGCTGAGGCCAGGGTCAGG - Intronic
1060218378 9:121751888-121751910 GGACAGCCAAGGCCATGGCTAGG - Intronic
1060984753 9:127813599-127813621 CAGTAGCCAAGGCCCGGGGTTGG + Exonic
1061338893 9:129962797-129962819 GTAGAGCCAAGGACAGGGTTAGG + Intronic
1061517361 9:131097372-131097394 CAATAGCTAAGGCCAGGCGTGGG - Intronic
1061587265 9:131577142-131577164 CAATAACCAGGGCCAGGCTTAGG + Exonic
1061670339 9:132184969-132184991 GCAGAGCCAGGCCCAGGGTTTGG + Intronic
1187163983 X:16787439-16787461 AAAGACCCAAGGCCAGGGTCGGG - Intronic
1189473755 X:41333689-41333711 GAAGAGTGAAGGCCAGTGTTAGG + Exonic
1190308853 X:49102305-49102327 GCAGAGCCAGGGCCAGGGTCAGG + Intergenic
1190322913 X:49188872-49188894 GAGGAACCAAGGCCAGAGTTGGG + Exonic
1193434971 X:81461990-81462012 CAATAGTCAATGCCATGGTTTGG - Intergenic
1194303379 X:92214168-92214190 GAATAGGTGAGGCCAGAGTTGGG + Intronic
1194596467 X:95865013-95865035 GAATTCCCTTGGCCAGGGTTGGG + Intergenic
1197332229 X:125167860-125167882 TAATAATCATGGCCAGGGTTTGG - Intergenic
1198666506 X:139029874-139029896 CAATAGTCAAGACCAGGGTTTGG + Intronic
1199134393 X:144233648-144233670 GGACAGCGAAGGCCAGGGTGAGG + Intergenic
1199455183 X:148020337-148020359 CAACAGCCAAGGCCCGGGATTGG + Intronic
1201190979 Y:11441408-11441430 GCAAAGCCAAGGCCAGGGCAGGG - Intergenic