ID: 920241608

View in Genome Browser
Species Human (GRCh38)
Location 1:204555989-204556011
Sequence CCACATTTGCTACTGTTGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920241608_920241613 23 Left 920241608 1:204555989-204556011 CCTGTCAACAGTAGCAAATGTGG 0: 1
1: 0
2: 2
3: 11
4: 92
Right 920241613 1:204556035-204556057 GCATTTTAAAGTAACTTTTTGGG 0: 1
1: 0
2: 6
3: 61
4: 664
920241608_920241612 22 Left 920241608 1:204555989-204556011 CCTGTCAACAGTAGCAAATGTGG 0: 1
1: 0
2: 2
3: 11
4: 92
Right 920241612 1:204556034-204556056 AGCATTTTAAAGTAACTTTTTGG 0: 1
1: 1
2: 9
3: 61
4: 705
920241608_920241610 -10 Left 920241608 1:204555989-204556011 CCTGTCAACAGTAGCAAATGTGG 0: 1
1: 0
2: 2
3: 11
4: 92
Right 920241610 1:204556002-204556024 GCAAATGTGGTTTCATAAAGTGG 0: 1
1: 1
2: 1
3: 24
4: 218
920241608_920241611 -9 Left 920241608 1:204555989-204556011 CCTGTCAACAGTAGCAAATGTGG 0: 1
1: 0
2: 2
3: 11
4: 92
Right 920241611 1:204556003-204556025 CAAATGTGGTTTCATAAAGTGGG 0: 1
1: 1
2: 2
3: 29
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920241608 Original CRISPR CCACATTTGCTACTGTTGAC AGG (reversed) Exonic
900460368 1:2799751-2799773 GCACATTTGCTTCTGCTGCCTGG + Intronic
900666753 1:3820727-3820749 CCACATCTGCCACTGGTGACGGG - Intronic
903419872 1:23211005-23211027 CCAAATTTGTTAGTGTTTACAGG + Intergenic
908714485 1:67054627-67054649 CCACATCTGATACTTTTGAAGGG - Intergenic
912785084 1:112595052-112595074 CAACATTTACTACTGTTAAAGGG + Intronic
916487000 1:165268749-165268771 CCTTATTTGCTGCTGATGACTGG - Intronic
917697400 1:177540162-177540184 CCACATTTTCTACCATTGATAGG - Intergenic
918310197 1:183280149-183280171 CCACACTTGGTATTGCTGACAGG + Intronic
920241608 1:204555989-204556011 CCACATTTGCTACTGTTGACAGG - Exonic
920303257 1:205002499-205002521 CCACACTTTCTACCTTTGACAGG + Intronic
921914697 1:220594101-220594123 CTACATTTCCTACTGTCCACAGG + Intronic
923348923 1:233084851-233084873 CTGCATTTGCTATTGTTGCCTGG + Intronic
1065275102 10:24077799-24077821 ACACATTTCCTGCTGTTGATGGG - Intronic
1065472123 10:26092816-26092838 CCACACTTGCTAATGTTTTCAGG - Intronic
1068843705 10:61646728-61646750 CCATGCTTGCTACTGTTGAAGGG + Intergenic
1069738251 10:70671819-70671841 CCACAGTTGCTACTGGTGTCAGG + Intergenic
1077945130 11:6888958-6888980 CCACATTTCCTGCTATTGATGGG - Intergenic
1080972636 11:37297046-37297068 ACTGATATGCTACTGTTGACTGG + Intergenic
1081548470 11:44090270-44090292 TCTCATTTGATATTGTTGACTGG + Intergenic
1084290954 11:68167107-68167129 CCATATTTGCTATTGATAACAGG + Exonic
1084481931 11:69426784-69426806 CCACCTTTGCTAATTTTAACTGG + Intergenic
1089851669 11:121502549-121502571 CAACATTTGCTACTGTTTTTTGG + Intronic
1093651613 12:21652336-21652358 CCACATGTGAGACTGTGGACAGG + Intronic
1097719727 12:63007048-63007070 ACACATTTCCTTTTGTTGACAGG + Intergenic
1098266130 12:68721924-68721946 CCAGAGTTGCTACTGATGTCTGG - Exonic
1098799927 12:74942869-74942891 CAAGATTTGCCACTGTTGCCTGG + Intergenic
1106210875 13:27643816-27643838 CATCATTTGCTGCTGTTGACTGG - Intronic
1113258925 13:108538843-108538865 CCAAGTTTGCAACTGGTGACTGG - Intergenic
1115431935 14:33329395-33329417 ACAGATGTGCTACTTTTGACTGG + Intronic
1115721954 14:36171858-36171880 CCACATTTGCTAATATTCCCTGG - Intergenic
1125105904 15:35970890-35970912 CCACATTTCCAAGTGTTGATGGG - Intergenic
1127655217 15:61049067-61049089 CCACATCTGCTGAAGTTGACTGG + Intronic
1129616447 15:77102097-77102119 CCACATTTTCTACTGTAAACAGG + Exonic
1133169876 16:3975947-3975969 ACACATTTGCTACTGGTTTCAGG - Intronic
1134802437 16:17097692-17097714 CCACATTTGCTATTGCAGACTGG - Intergenic
1135719256 16:24801105-24801127 CCAGATTTTCGACTGTTTACTGG - Intronic
1147524422 17:41207130-41207152 ACATATATTCTACTGTTGACTGG + Intronic
1149648414 17:58257751-58257773 ACACATTTGGCACTGTTGGCAGG - Intronic
1153476850 18:5506405-5506427 CTACATTTGCTATTCTTGCCTGG + Intronic
1156346538 18:36261971-36261993 GCACAGGTGCTACTGTTGCCAGG - Intronic
1157044451 18:44082838-44082860 CCATATTTGTTACTGTTTTCTGG - Intergenic
1164256206 19:23530435-23530457 TTACATTTCCTACTGTGGACAGG + Intronic
1164283280 19:23788125-23788147 TCACATTTCCTACTGTGGACAGG - Intronic
1164294767 19:23900203-23900225 TCACATTTCCTACTGTGGACAGG - Intergenic
1165287086 19:34851426-34851448 GCACATGTGCTACTGTTGGAGGG - Intergenic
1165643592 19:37412739-37412761 CCACATTTACTACAGTCGAAGGG + Exonic
926631657 2:15142182-15142204 GTGCATTTGCAACTGTTGACAGG - Intergenic
935179012 2:100673930-100673952 CCAAAATAGCTCCTGTTGACAGG - Intergenic
936152385 2:110028838-110028860 CCACATTTGGTTCTGGTGCCGGG - Intergenic
936192294 2:110342574-110342596 CCACATTTGGTTCTGGTGCCGGG + Intergenic
937500337 2:122471608-122471630 CCACATTTTCAACTGTTTCCTGG - Intergenic
940834004 2:158500229-158500251 CCTCATTTGCTACTGTTCTGTGG - Intronic
942786034 2:179703889-179703911 CCACACCTGCTACTGTGGTCAGG - Intronic
1172361918 20:34318766-34318788 CCACATCTGCTTCTGGTGATTGG + Intergenic
1184997663 22:48221952-48221974 CAACATTTGCTACTTTTTATAGG - Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
953856687 3:46504706-46504728 CCACATTTGCTCCTTTAGAATGG - Intergenic
955804650 3:62721416-62721438 CCAACTTTCCTACTGTTGTCTGG - Intronic
957631830 3:82725786-82725808 AAATATTTGCTACTTTTGACAGG + Intergenic
964426473 3:156559478-156559500 ACACATATGCTACTGTTGACAGG + Intergenic
971412375 4:26387805-26387827 CCACTCTGGCTACTGTTAACAGG - Intronic
975348067 4:73316562-73316584 TCACCTTTGCTACTGTCTACTGG + Intergenic
975973032 4:80065265-80065287 CCAAATTCTCTACTGTTGAAAGG + Intronic
976373770 4:84320653-84320675 TAACATTTGCCACAGTTGACTGG + Intergenic
976482068 4:85556932-85556954 CCACCTCTGCTACTGCTCACTGG - Intronic
978196153 4:105974397-105974419 CCACATTTCCAACTGTTTACTGG + Intronic
980694417 4:136337172-136337194 CCACCCATGCTACTTTTGACTGG + Intergenic
980812633 4:137902591-137902613 TCTCATTTGCTATTGTTGAATGG - Intergenic
985809001 5:2069416-2069438 CCAGAGTTTCTACTTTTGACCGG - Intergenic
991502705 5:67293033-67293055 CCACATGTGTTCCTGTTGATAGG - Intergenic
991602329 5:68366100-68366122 TCTCAGATGCTACTGTTGACTGG - Intergenic
1000078863 5:157824326-157824348 GTACATTTGATACTGTTCACAGG - Intronic
1000146334 5:158456821-158456843 CCACTTTTGCTGCTGTTTGCTGG - Intergenic
1003534048 6:6960657-6960679 CCACAATTACTACGTTTGACTGG + Intergenic
1008805242 6:55418645-55418667 CCACATTTGATTCTATTGGCTGG + Intergenic
1010491452 6:76481176-76481198 CCACAGTTGCAACTGTTTACTGG - Intergenic
1012240874 6:96870192-96870214 CCACATTTGCCAGTATTGTCAGG - Intergenic
1013416092 6:109925946-109925968 CCAAATTTGCTAGTGTTGATTGG - Intergenic
1015288455 6:131510949-131510971 GCACCTTTGCTATTGTTGGCTGG + Intergenic
1019903381 7:4042106-4042128 AAACATTTGCAACTGTTGGCCGG - Intronic
1021279269 7:18697164-18697186 CCAGATTTACTACTGCTGAAGGG - Intronic
1021561248 7:21970683-21970705 CCATGTTTTCTATTGTTGACTGG - Intergenic
1021800178 7:24297011-24297033 CCACATGTGCTACTGATGACAGG + Intergenic
1022129229 7:27388835-27388857 CCACTTTTTCTTCTGTTAACTGG - Intergenic
1024797862 7:53038950-53038972 CTTCCTTTGCTACTGTTCACAGG - Intergenic
1026829854 7:73603815-73603837 CCACATGTGCTTCTACTGACAGG + Intronic
1031965785 7:128027349-128027371 CCACATGGGGTACTGTTGAATGG - Exonic
1040375718 8:46822848-46822870 CCACATTGCCTCCTGTTGAAAGG - Intergenic
1044008377 8:86963934-86963956 CTACATTTGCAGCAGTTGACAGG + Intronic
1045167039 8:99618216-99618238 GTACATTTGCTACTGCTTACTGG - Intronic
1046776478 8:118169016-118169038 CCCCATTTCCTATTGTTGAGTGG - Intergenic
1048020891 8:130537984-130538006 GCACATTTGTTACAGTTGATGGG + Intergenic
1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG + Intergenic
1049619403 8:143591252-143591274 CCCCACTTGCTACTGTGGCCTGG + Intronic
1051428289 9:16956912-16956934 CAATATTTGCTACAGTTGCCAGG - Intergenic
1057361419 9:94376795-94376817 TCCCATTTCCTAGTGTTGACAGG + Intronic
1057661942 9:97011375-97011397 TCCCATTTCCTAGTGTTGACAGG - Intronic
1061738312 9:132678727-132678749 ACACATTTGATACTGTGCACAGG - Exonic
1187566873 X:20459489-20459511 CCACATTTGGTACTTTTTATGGG - Intergenic
1189006290 X:36998936-36998958 CCACATCTGCCAAGGTTGACAGG + Intergenic
1189042304 X:37554869-37554891 CCACATCTGCCAAGGTTGACAGG - Intronic
1192433671 X:71129236-71129258 CCACACTTTCTACTGTTGGCTGG - Intronic
1194062624 X:89223071-89223093 CCGCATATGCTTCTGTTGAGTGG - Intergenic
1194947094 X:100082101-100082123 ACACATTTGCTATTCTTGCCTGG - Intergenic
1198296385 X:135291878-135291900 CCACATTACCTACTGTACACTGG - Intronic
1198446932 X:136726646-136726668 CCACATTTTCTACTGCAGGCAGG + Intronic