ID: 920244686

View in Genome Browser
Species Human (GRCh38)
Location 1:204578759-204578781
Sequence TCAAATCCGTGTACATTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920244684_920244686 22 Left 920244684 1:204578714-204578736 CCATAAAAGGTGACTTCATATAC No data
Right 920244686 1:204578759-204578781 TCAAATCCGTGTACATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920244686 Original CRISPR TCAAATCCGTGTACATTTGC TGG Intergenic
No off target data available for this crispr