ID: 920245094

View in Genome Browser
Species Human (GRCh38)
Location 1:204581948-204581970
Sequence GCACCATGCTTGTCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920245094_920245097 13 Left 920245094 1:204581948-204581970 CCTGTCTTTGACAAGCATGGTGC No data
Right 920245097 1:204581984-204582006 ATTTTGGACTAGATGGTTCCTGG No data
920245094_920245096 6 Left 920245094 1:204581948-204581970 CCTGTCTTTGACAAGCATGGTGC No data
Right 920245096 1:204581977-204581999 ACTTGACATTTTGGACTAGATGG No data
920245094_920245095 -3 Left 920245094 1:204581948-204581970 CCTGTCTTTGACAAGCATGGTGC No data
Right 920245095 1:204581968-204581990 TGCTTGTCAACTTGACATTTTGG No data
920245094_920245098 20 Left 920245094 1:204581948-204581970 CCTGTCTTTGACAAGCATGGTGC No data
Right 920245098 1:204581991-204582013 ACTAGATGGTTCCTGGTGTGAGG No data
920245094_920245100 22 Left 920245094 1:204581948-204581970 CCTGTCTTTGACAAGCATGGTGC No data
Right 920245100 1:204581993-204582015 TAGATGGTTCCTGGTGTGAGGGG No data
920245094_920245099 21 Left 920245094 1:204581948-204581970 CCTGTCTTTGACAAGCATGGTGC No data
Right 920245099 1:204581992-204582014 CTAGATGGTTCCTGGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920245094 Original CRISPR GCACCATGCTTGTCAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr