ID: 920250855

View in Genome Browser
Species Human (GRCh38)
Location 1:204621353-204621375
Sequence AAGAACAAGTAGGAGTTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920250855 Original CRISPR AAGAACAAGTAGGAGTTGTC TGG (reversed) Exonic
902552491 1:17227598-17227620 AAAAACAAGTAAGAGCAGTCCGG - Intronic
904558222 1:31379494-31379516 AAAAATGAGTAGGAGTTGGCCGG - Intergenic
905774461 1:40659746-40659768 AAGGATAAGTAGGAGTTAGCAGG + Intronic
906318434 1:44802630-44802652 CAGGACAAGCAGGAGTTCTCTGG + Intronic
906825811 1:48978572-48978594 AGGAACAAGTGGGAGTTATCAGG - Intronic
907009217 1:50947358-50947380 AGGAAGAAGGAGGAGTTTTCAGG - Intronic
907476298 1:54708101-54708123 AAGGACAAATAGGAATTGCCAGG + Intronic
908029614 1:59985856-59985878 AAGAACAAGCTGGAGCTGTCTGG + Intergenic
908419016 1:63941389-63941411 AAGGATATATAGGAGTTGTCTGG + Intronic
908781636 1:67696077-67696099 AAGAACAAGTAGGAGTTTGTTGG - Intergenic
908889479 1:68827450-68827472 AAGAATGTGTAGGAGTTCTCGGG + Intergenic
909224045 1:72993596-72993618 AAGTAAAGGTAGGAATTGTCAGG - Intergenic
909658417 1:78055988-78056010 CAGCACAAGTAGGAGTTAACAGG - Intronic
911018899 1:93366705-93366727 AAAAACAAGTAAGAATTGGCTGG + Exonic
911053208 1:93689591-93689613 AAGAAGAGGGAGGAGTTGTAGGG + Intronic
911320123 1:96403782-96403804 GAGATTAAGTAGCAGTTGTCCGG + Intergenic
913538170 1:119794174-119794196 AAAAACAAGCAGGAGTTGAGTGG + Exonic
915584715 1:156838167-156838189 GAGAACAGGTTGGAGTTCTCTGG - Intronic
916849960 1:168693776-168693798 AAGGACAAGTAGGACTTCTGAGG - Intergenic
917625686 1:176843691-176843713 AAGAACAGGCAAGAGCTGTCAGG + Exonic
918926312 1:190791478-190791500 AACAACAAGTTGGAGCTGTTGGG - Intergenic
919103773 1:193123988-193124010 AAGAATAGGTAGGAATTCTCTGG + Intronic
919515552 1:198517531-198517553 AAAAACTAGTAGGGTTTGTCAGG + Intergenic
920137074 1:203778593-203778615 AAGAAAAAGTTAGAGTTTTCTGG - Intergenic
920250855 1:204621353-204621375 AAGAACAAGTAGGAGTTGTCTGG - Exonic
920663399 1:207939287-207939309 AGGAACAAGTAGGAGGTGGGTGG + Intergenic
920785014 1:209033065-209033087 AAGGACAATTAGGAGTAATCAGG + Intergenic
921377480 1:214489491-214489513 AAAGACAAATAGGAGTTGACTGG - Intronic
923275621 1:232393230-232393252 ATGACCAAGTAGGAGTTGAGGGG + Intergenic
924411898 1:243814868-243814890 AAGGACAATTAGGAGGTGTGTGG + Intronic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1068870925 10:61943411-61943433 AAGAACAATGAGGAGTTGGAAGG - Intronic
1069144104 10:64867569-64867591 AAGGACAAGGTGGAGCTGTCAGG - Intergenic
1071213487 10:83371442-83371464 AAGAATAAGTAGGGGTTATATGG - Intergenic
1071863699 10:89702242-89702264 AAGGACCAGTAGGAGTAGTCTGG - Intronic
1072918323 10:99554294-99554316 AAGAAGGAGTAGGAGGTGGCTGG - Intergenic
1072945198 10:99803759-99803781 AAGGATAAATAGGAGTTTTCTGG + Intronic
1073169260 10:101489242-101489264 AAGAAAAAAAAAGAGTTGTCTGG - Intronic
1074349452 10:112721750-112721772 ATGAACAAGTAGAAGTTATAGGG + Intronic
1074844667 10:117386958-117386980 AAGGCCAAGTAAGAGTTGTTTGG - Intergenic
1075237553 10:120744729-120744751 AAGACCGAGTAAGAGTTGCCCGG + Intergenic
1075834716 10:125443873-125443895 AATCCCAAGGAGGAGTTGTCTGG + Intergenic
1076091834 10:127693299-127693321 AAGAATGAGTAGGAGTGGGCGGG + Intergenic
1078921465 11:15834917-15834939 AAGAAGAAGAAGGAGAAGTCTGG - Intergenic
1080282563 11:30575221-30575243 TAAAACAAGTTGGACTTGTCAGG + Intronic
1080929343 11:36791789-36791811 AAGAACTAGTAGTAGTAGTAGGG - Intergenic
1082897213 11:58204734-58204756 AAGTACAAGTAGGAGCAATCAGG + Intergenic
1087055845 11:93935535-93935557 AAGATAAAGAAGGAGTTGGCTGG - Intergenic
1087673212 11:101129324-101129346 AAGAAAAAGTAGTAATTGTTAGG + Exonic
1088113403 11:106288149-106288171 AAGAAAAAGAAGGACTTCTCAGG + Intergenic
1088465042 11:110125994-110126016 AAGAACACGAAGGAGCTCTCAGG - Intronic
1088515954 11:110634068-110634090 AAGAAAAAGTAGTGGTGGTCAGG + Intronic
1089264882 11:117251613-117251635 AAGAAAAAGTAGCAGGGGTCAGG + Intronic
1090728026 11:129545024-129545046 AAGAACAAGGGGGAGATGGCAGG + Intergenic
1091478405 12:800268-800290 AAGCAAAAGTAGGATGTGTCTGG - Intronic
1091985098 12:4904467-4904489 TAGAACAAGTAGGACTTGAAAGG - Intergenic
1092352312 12:7765585-7765607 AAAAAGAAGTGGCAGTTGTCTGG + Intronic
1092694373 12:11152938-11152960 AAGTCTAGGTAGGAGTTGTCTGG + Intronic
1094625975 12:32124678-32124700 AAGAATAAGTAGGGATTTTCCGG + Intronic
1094731332 12:33179710-33179732 AAGGACAGGGAGGAGCTGTCAGG - Intergenic
1094823164 12:34243261-34243283 AATAACAAGTAAGATTGGTCCGG - Intergenic
1095820145 12:46469437-46469459 AAAAACAAGTAGGAGAATTCAGG + Intergenic
1095851406 12:46811381-46811403 AAGAACAAATAGAAGTTGGCAGG + Intronic
1096388176 12:51209011-51209033 AAGATCAAGGTGGTGTTGTCTGG - Intronic
1097032495 12:56099778-56099800 TAGAAAAAGGAGGAGTTGGCTGG + Intronic
1097996856 12:65897539-65897561 AAGGACAAAAAGGAGTGGTCAGG + Intronic
1098342770 12:69469482-69469504 AAGAAAGAGTAGGGGTTGGCCGG - Intergenic
1098680815 12:73351492-73351514 AAGAACAGCTAGGATTTGACAGG + Intergenic
1099463418 12:82952398-82952420 AATACAAAGTATGAGTTGTCTGG - Intronic
1099629615 12:85125435-85125457 AAGAACAAGAAGAAATTGACAGG - Intronic
1099805037 12:87507956-87507978 AAGAACAAGTGGAAGCTGACAGG - Intergenic
1099944857 12:89233078-89233100 AAGAACGAATAGGAGTTACCTGG - Intergenic
1102028186 12:109725392-109725414 AAGAGCAAGCAGGACTTGGCTGG - Intronic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103924481 12:124415931-124415953 AACAGCAAGTAAGAGTTGTGTGG + Intronic
1104169864 12:126269634-126269656 AAGAACAAGTAGAAGTTTACTGG + Intergenic
1106080849 13:26499283-26499305 AAGAAAAACTAGGAGCTGGCAGG + Intergenic
1108780715 13:53828096-53828118 AAAAAAAAGTAGGAGTTGAGGGG - Intergenic
1109421578 13:62118926-62118948 AAAAAGAAGTAGGAGTTTTTTGG + Intergenic
1111567935 13:90041245-90041267 AAGGAGAAATAGGAGTTGTTAGG + Intergenic
1114181550 14:20372275-20372297 CAGAATGAGTAGGAGTTTTCTGG - Intronic
1119112112 14:71984566-71984588 AAGAAAGGGTAGGAGTTGGCTGG + Intronic
1119369512 14:74127321-74127343 AAGAATGAGTAGGAGTTAACTGG + Intronic
1122569693 14:102687891-102687913 AAGAATGAGTAGGAGTTTGCTGG + Intronic
1122591931 14:102859773-102859795 AAGAAAATGTAGTAGTTGTAAGG + Intronic
1124387574 15:29223296-29223318 CAGAACCAGGAGGACTTGTCTGG - Intronic
1124876356 15:33598755-33598777 AAAAAAAAATAGGAGTTGGCTGG + Intronic
1128448677 15:67787663-67787685 AAGAATAAGTAGGATTTCCCTGG + Intronic
1129205345 15:74034173-74034195 CAGACCAGGTAGCAGTTGTCAGG + Intronic
1131793176 15:95987074-95987096 AAGGACAAGTGGGAGTTTTCTGG - Intergenic
1134773150 16:16828380-16828402 AAGAAAAAGTAGCAGATGTCAGG + Intergenic
1136078119 16:27830831-27830853 ATGAACAAGTAGGCTTTTTCTGG + Intronic
1136276834 16:29183787-29183809 AAGGATAAGTAGGAGTTCACTGG - Intergenic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136872019 16:33816272-33816294 GTGAACAAGTGGGAGTTCTCAGG + Intergenic
1137011041 16:35320424-35320446 GAGAACAAACAGGAGTTGTCCGG + Intergenic
1137029665 16:35510042-35510064 GAGAACAAACAGGAGGTGTCGGG - Intergenic
1139928215 16:70503888-70503910 AAGAGTAAGTAGGAGTTGGCCGG - Intronic
1140823888 16:78688388-78688410 CTGAAAAAGTAGGATTTGTCAGG - Intronic
1141582936 16:85012571-85012593 TTGAACAAGTAGGTATTGTCTGG - Intergenic
1141852129 16:86653629-86653651 AGAAACAAGTAGGAGGTGACTGG + Intergenic
1142081212 16:88149847-88149869 AAGGATAAGTAGGAGTTCACTGG - Intergenic
1203100153 16_KI270728v1_random:1299796-1299818 GTGAACAAGTGGGAGTTCTCAGG - Intergenic
1143620486 17:8077417-8077439 AAGAATAAGTGGGAGCTGCCAGG - Intronic
1144712266 17:17409616-17409638 AGGAAGAAGGAGGAGTTGGCCGG - Intergenic
1144993285 17:19248918-19248940 AAGGAAAAGTGGGAGTTCTCAGG + Intronic
1147643953 17:42022626-42022648 AAGGACAAGAAGGAGGTGTGTGG + Exonic
1147700739 17:42392810-42392832 AAGAATGAGTAAGAGTTCTCAGG - Intergenic
1148029825 17:44611850-44611872 GGGAAGAAGTAGAAGTTGTCAGG + Intergenic
1148252214 17:46093213-46093235 AAGAATAACTAGGAGGTGACTGG - Intronic
1148368913 17:47079448-47079470 AAGAATAACTAGGAGGTGACTGG - Intergenic
1148569437 17:48656335-48656357 AAGATTAAGGAGGAGTTGTGGGG + Intergenic
1148996981 17:51719261-51719283 AAGAACAAGGAGGAGCCATCTGG - Intronic
1150668915 17:67172149-67172171 AAAAACAGGTAAGATTTGTCAGG - Intronic
1150673708 17:67225363-67225385 TGGTAAAAGTAGGAGTTGTCGGG - Intronic
1150981549 17:70147973-70147995 AAGAGCAAGAAGGAGGTGCCGGG + Intergenic
1151887662 17:76932653-76932675 AAGCCCATGAAGGAGTTGTCGGG - Exonic
1152040011 17:77897044-77897066 AAGAGGCAGCAGGAGTTGTCTGG - Intergenic
1153299794 18:3582742-3582764 AATAACAAGGACGAGGTGTCTGG + Intronic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1155871147 18:31029965-31029987 AAGAACAAGTAAGTGCTATCTGG - Intronic
1157590829 18:48835747-48835769 AGGATCAAGTAGGACATGTCAGG + Intronic
1157713620 18:49866985-49867007 AAGAACAAGCAGGACTTGCCGGG + Intronic
1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG + Intergenic
1162701530 19:12518818-12518840 AAGAAAAAAAAGGAGTTGGCTGG + Intronic
1163488411 19:17603069-17603091 AAGGACGAATAGGAGTTCTCTGG + Exonic
1164906854 19:31974871-31974893 AAGAACAAGGAGGGTTTCTCAGG + Intergenic
926228488 2:10985135-10985157 AAGAAAAAGTGGGAGTGGGCAGG - Intergenic
927478550 2:23432811-23432833 AAGAAGAAGTTGAAGTTGGCTGG + Intronic
927585368 2:24298710-24298732 GAGAACAAGAAGAAATTGTCAGG - Exonic
928269578 2:29844150-29844172 AAGGATAAGAAGGAGTTGTCTGG + Intronic
930126749 2:47804381-47804403 AAGAAATAGTAGTAGTTGGCTGG + Intronic
930470079 2:51801366-51801388 GAGAAAAAGGAGGAGTTGCCAGG + Intergenic
931988204 2:67761522-67761544 AACAACACCAAGGAGTTGTCTGG - Intergenic
935426315 2:102921808-102921830 GAGAACACAAAGGAGTTGTCAGG - Intergenic
939354831 2:141087736-141087758 AAGGGCAAGTAGGAGTTTGCCGG + Intronic
940538906 2:154985152-154985174 AAGATAAAATAAGAGTTGTCAGG - Intergenic
944511183 2:200467941-200467963 AAGGACAAGTAGAATTTGACAGG + Intronic
946720600 2:222602197-222602219 GAGAACAGATAGTAGTTGTCTGG + Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1170005700 20:11666815-11666837 ATGAACAAAAAGGAGTTGCCAGG - Intergenic
1171966932 20:31537635-31537657 AAGACCAAGAAGCAGCTGTCAGG + Intronic
1172474086 20:35224482-35224504 AAGAAAAGGAAGGAGTTGGCTGG - Intergenic
1172564336 20:35917142-35917164 AAGAACATGTTAGAGTTGTCAGG + Intronic
1172774627 20:37399869-37399891 AAGAACCAGTAGCTGTTGTCGGG - Intronic
1173689906 20:44952617-44952639 AAGAATAAGTTGGAGTTAGCCGG - Intronic
1176929088 21:14786634-14786656 AGGAAAGAGTAGGAGTTTTCTGG - Intergenic
1178407174 21:32334402-32334424 AACAACAGGTAGCAGTTGTCAGG + Intronic
1179078508 21:38147378-38147400 GAGAACAAGTAGCAGATGTTGGG - Intronic
1179160942 21:38898459-38898481 AAGAACATGTAGGAATGGTCAGG + Intergenic
1182649571 22:31840241-31840263 AAGTACATGTAGGAGTTACCAGG + Intronic
1183052389 22:35274222-35274244 AAGGCCAAGTAGGAATTATCAGG + Intronic
1183195599 22:36351560-36351582 AAGAACAACTAGGATTTACCTGG - Intronic
1184316598 22:43698084-43698106 ATGAACAAGCAGCAGTTTTCTGG - Intronic
950041819 3:9924493-9924515 AAGAATAAGCAGGAGTTCTGTGG - Intronic
950192959 3:10991113-10991135 AAGGATGAGTAGGAGCTGTCTGG - Intergenic
952256083 3:31696936-31696958 AAGAACACGTTGGAGATGTTGGG - Intronic
952577842 3:34795935-34795957 AAGTCCAAGTACTAGTTGTCAGG + Intergenic
952985466 3:38776719-38776741 AAGAATAAGTTGGAGTTCCCAGG + Intronic
953152676 3:40339401-40339423 AAAAAGAAGTAGGAGTTATATGG - Intergenic
954626804 3:52026279-52026301 AAGAGTAAGTAGGAGTTAGCAGG - Intergenic
955058730 3:55478262-55478284 GAGAACAAAAAAGAGTTGTCAGG - Intronic
955158701 3:56443550-56443572 CAGAACAAGTAGGAATTATGAGG - Intronic
955159355 3:56448777-56448799 AAAAACAAGTGGTAGTTGGCCGG + Intronic
956423333 3:69107892-69107914 AAGGACAGATTGGAGTTGTCTGG + Exonic
957826723 3:85456166-85456188 AACAAAAAGTCAGAGTTGTCTGG + Intronic
958899537 3:99869646-99869668 AAGAAAAGGAAGGAGTTGCCTGG - Intronic
962568698 3:136690531-136690553 AGGAACAAATAGGATTTGGCCGG - Intronic
963613193 3:147498848-147498870 AATAACAAGAAGGAGTTGGGGGG - Intronic
963767572 3:149353458-149353480 AAGAGCAAGTACTAGTAGTCAGG - Intergenic
964952571 3:162314452-162314474 AAAAACAAGTAGGCCTTGTACGG - Intergenic
965882707 3:173406090-173406112 AAGAACAAGTAAGATATGTATGG - Intronic
965944271 3:174220968-174220990 AAGAAAAAATAGGATTTATCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
970318854 4:14855951-14855973 GAGAACCAGGAGCAGTTGTCAGG + Intergenic
970879103 4:20906907-20906929 AAAGACAAGTAGGATTTGTAAGG + Intronic
971760263 4:30756295-30756317 AAGGACTAGTGGGAGGTGTCTGG - Intronic
973016019 4:45138245-45138267 AACAAGAAGTATGAGTTTTCAGG - Intergenic
973042992 4:45497374-45497396 AAAAATAACTATGAGTTGTCTGG - Intergenic
973303871 4:48621126-48621148 ATGAACACATAGGAGTTGCCAGG - Intronic
973666719 4:53167114-53167136 AAGAGTAAGTAGGAATTGTCCGG - Intronic
973771341 4:54209879-54209901 AAGAACAGGAAGGAGGGGTCAGG + Intronic
976104651 4:81603816-81603838 TAGAACAAGTAGGAATTCACAGG - Intronic
976164418 4:82238963-82238985 AAGAACAAGTTGGAGGTGAAGGG + Intergenic
976594006 4:86877344-86877366 AAGAACAAATAGGAGAGGACAGG + Intronic
978430849 4:108631688-108631710 AAAGATAAGTAGGTGTTGTCTGG + Intergenic
978879447 4:113683597-113683619 AAGAATAAATAGGCGTTTTCTGG + Intronic
978894481 4:113870783-113870805 TAGAATAACTGGGAGTTGTCTGG - Intergenic
979322486 4:119340772-119340794 AAAAACAAGTAAGAGTTAGCTGG - Intergenic
980764311 4:137279881-137279903 GAGAACAATTAGTAGTTGCCTGG + Intergenic
981006209 4:139878212-139878234 AAGAATGAGTAGGAGTTGGCGGG - Intronic
981758080 4:148162806-148162828 GGGCCCAAGTAGGAGTTGTCAGG - Intronic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983240464 4:165226385-165226407 AAAAACAAGTAAGAGTTAGCTGG - Intronic
988550726 5:32198543-32198565 AGGAACAAGTGGGAGATGTCAGG - Intergenic
989189505 5:38656439-38656461 AAGAACACGTAGGAGGTAGCTGG + Intergenic
989664652 5:43839997-43840019 AAGAATAAGTAGGAGTTCTTTGG - Intergenic
993653919 5:90555307-90555329 AAGAAAAAGTAGTGATTGTCAGG - Intronic
994859123 5:105165578-105165600 AAGCAAAATTAGAAGTTGTCAGG - Intergenic
995278540 5:110307081-110307103 GGGAACAAGTAGCAGTAGTCTGG - Intronic
995762895 5:115582713-115582735 AAGAACAAGTAGAAATGCTCTGG - Intronic
997554751 5:134786142-134786164 AAGAACATGTAAGATTGGTCAGG - Intronic
997854065 5:137357568-137357590 AAGAACGAGTAGGAGTTGCCAGG + Intronic
998380685 5:141723116-141723138 AAGAAGAATGAGGAGTTGACAGG - Intergenic
1001164673 5:169352912-169352934 AAAAGCAAGTAGGATTTGGCCGG - Intergenic
1002167041 5:177354469-177354491 AAGAATGAGTAGGAGTTTTCCGG + Intergenic
1004356612 6:14934650-14934672 AAGAAAAAGTAGCAGTAGTGTGG + Intergenic
1005757470 6:28937876-28937898 AAGAACAAGTAGGCCTTGTGTGG - Intergenic
1007486502 6:42184384-42184406 AAGAAAAGGCAGGAGTTGCCGGG - Exonic
1008197441 6:48541593-48541615 AAGAACCTGTATGAGTTGACTGG - Intergenic
1008595328 6:53036016-53036038 AGGAAAGAGTGGGAGTTGTCTGG + Intronic
1008685734 6:53924673-53924695 AAGAACAAGTAGAACTTGCATGG + Intergenic
1010131913 6:72504137-72504159 GAGAAAAAGTAGGAATTTTCTGG - Intergenic
1010548761 6:77192783-77192805 AAGAACAAGTAGGTATTGGCTGG + Intergenic
1010734382 6:79427154-79427176 ATCAACAAGTAGCATTTGTCAGG + Intergenic
1012931875 6:105325962-105325984 AAGGAGAAGTAGGAGTAGTCAGG + Intronic
1013839881 6:114378663-114378685 AACAACGAGTAGGAGTTAACAGG - Intergenic
1014685725 6:124497732-124497754 AAAAAAAACTAGGAGTTGTCAGG + Intronic
1016757060 6:147698438-147698460 AAAAACAAGGAGGAGTTAGCTGG - Intronic
1019951085 7:4373292-4373314 AAGAAGAAGAAAGAGTAGTCAGG - Intergenic
1022891211 7:34701758-34701780 AAGAACTAATAGGCATTGTCAGG + Intronic
1023499891 7:40836631-40836653 AAGAACAATTAGTGGTTGACAGG - Intronic
1027222496 7:76223007-76223029 AAGCATAAGTAGGAGTTGGCGGG - Intronic
1029601473 7:101565947-101565969 GAGATTTAGTAGGAGTTGTCTGG + Intergenic
1034014498 7:147567256-147567278 AAGAACAAGTGGGTGTTATGCGG + Intronic
1034154018 7:148939405-148939427 AAAGACAAATAGGAGTTTTCAGG + Intergenic
1034654012 7:152714362-152714384 CACAAAAAGTAGGAATTGTCTGG - Intergenic
1034991759 7:155551910-155551932 AAGGACAAGCAGGAGTTGCCAGG + Intergenic
1035936618 8:3848195-3848217 AGGAACAATCAGAAGTTGTCAGG + Intronic
1037611670 8:20481280-20481302 AAGTAAAAGTATGAGTTGTAGGG + Intergenic
1038972028 8:32647016-32647038 AAGGACAAAGAGGAGTAGTCGGG + Intronic
1040549739 8:48428932-48428954 AAGGACAAGATGGAGTTGTGGGG - Intergenic
1041644633 8:60238873-60238895 GAGGACAGGTAGGATTTGTCTGG - Intronic
1042023103 8:64391946-64391968 AAGCACCAGTGTGAGTTGTCAGG - Intergenic
1042645631 8:70983247-70983269 AAGAACAAATAGGAATAGTCAGG - Intergenic
1045296249 8:100873899-100873921 AAGAGCCAGTAGGAGATGTAGGG + Intergenic
1046109232 8:109701908-109701930 AAGAAAGAGTAGGAGTTATATGG + Intergenic
1046235075 8:111413527-111413549 AAGATCTAGTAGGATTTGGCTGG + Intergenic
1046488891 8:114921071-114921093 AAGAACAATTTGGAGTTAACTGG - Intergenic
1046819429 8:118619858-118619880 AAGACCAAGTAGGAGTAACCAGG + Intronic
1047108905 8:121766766-121766788 AAGGACAAGTATGTGTTCTCTGG - Intergenic
1047810760 8:128406247-128406269 AAGAACCAGTAGCAGCTGCCTGG - Intergenic
1052994264 9:34541834-34541856 TTGAACATGTAGGAGTTGGCTGG + Intergenic
1055070518 9:72161233-72161255 GAGATCAAGTAAGAGTTGTAAGG - Intronic
1056459648 9:86797362-86797384 AAGAACAAGTAGAAGTTCAGAGG - Intergenic
1059179596 9:112199385-112199407 TAGAATAAGTAGGAGTAGGCTGG - Intergenic
1059285941 9:113171615-113171637 AAGAACAAGTCCCAGATGTCTGG - Exonic
1060489417 9:124071559-124071581 AAGAATAAGTAGGATTTATTAGG - Intergenic
1061277404 9:129577279-129577301 AAGAATGAGTGGGAGTTGCCTGG + Intergenic
1187912650 X:24125074-24125096 AAGAACAAGCAGGAACTCTCTGG - Intergenic
1188172350 X:26943212-26943234 TAGAACAAGTAGGATTTGTTGGG + Intergenic
1188740265 X:33769603-33769625 ATGAACAGGTATGAGTTTTCTGG - Intergenic
1190416458 X:50184777-50184799 AGGAACAACTAGGAGGTGACAGG - Intergenic
1192112951 X:68383734-68383756 AAGAACAAGTTGGAGCTCTCTGG - Intronic
1192421822 X:71039276-71039298 AAGAATGAGTAGGAGTTTCCTGG - Intergenic
1192448076 X:71225044-71225066 AAGGAAAAGGAGGAGGTGTCTGG + Exonic
1194345723 X:92761936-92761958 AAGGGCAAGTGGGAGTTGTTGGG + Intergenic
1194537090 X:95119072-95119094 AAGCACATGTAGGAGATGGCTGG + Intergenic
1194819039 X:98483258-98483280 AAGAGAAAGTATCAGTTGTCAGG + Intergenic
1194836208 X:98686103-98686125 AAAAGCAAGTAGGAGCTGTAGGG - Intergenic
1195842091 X:109185177-109185199 TAGACCAAGTAGGGCTTGTCAGG + Intergenic
1195949368 X:110251349-110251371 AAGGATAAGTAGGAGTTGACTGG + Intronic
1196303228 X:114070229-114070251 AAGCACAAAGAGGTGTTGTCAGG + Intergenic
1196373985 X:115011355-115011377 AGGAAAAAGAAGGAGTTGTTTGG + Intronic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1197944242 X:131821545-131821567 AACAAGAAGTATGGGTTGTCAGG + Intergenic
1198126129 X:133645696-133645718 AAGACCAAGTAGCATTTATCTGG - Intronic
1198521149 X:137453884-137453906 ACGAACAATTATGGGTTGTCTGG - Intergenic
1200654069 Y:5878587-5878609 AAGGGCAAGTGGGAGTTGTTGGG + Intergenic