ID: 920254354

View in Genome Browser
Species Human (GRCh38)
Location 1:204644371-204644393
Sequence AGGGGTCTACCCTTTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920254354 Original CRISPR AGGGGTCTACCCTTTGAGAA AGG (reversed) Intronic
901878375 1:12180029-12180051 AGGGATCTACCCGCTGAGAACGG - Intronic
904460272 1:30672988-30673010 AGGACTATACCCTTTGTGAATGG + Intergenic
904709014 1:32414449-32414471 AAGCGTTTACCCTTAGAGAATGG - Intergenic
905067532 1:35195946-35195968 ATGGGTTTGCCCTTTGATAAGGG - Intergenic
905075924 1:35269944-35269966 AGGAGTCTTCCTTTTGGGAATGG + Intronic
911039913 1:93583334-93583356 TGGGATCCACCCTTTGAGAGTGG - Intronic
911822033 1:102435278-102435300 AAGCGTTTACCCTTAGAGAATGG - Intergenic
912282736 1:108333751-108333773 AGGAGTATAACCTTTGAAAAAGG - Intergenic
918031527 1:180817766-180817788 AGGAGTTTACCCTTGGGGAATGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920254354 1:204644371-204644393 AGGGGTCTACCCTTTGAGAAAGG - Intronic
1063380972 10:5585543-5585565 AGGGCTTTACCCCCTGAGAATGG + Intergenic
1063475796 10:6327986-6328008 AGGGCTCTGGCCTTGGAGAAGGG + Intergenic
1067511546 10:46898938-46898960 TGGGGGCTTCCCTTTGTGAAAGG + Intergenic
1067650699 10:48152901-48152923 TGGGGGCTTCCCTTTGTGAAAGG - Intergenic
1068755078 10:60643618-60643640 AGAGCTCTACCATGTGAGAAAGG - Intronic
1069766840 10:70868393-70868415 CGGGATCTGGCCTTTGAGAAGGG + Exonic
1072403926 10:95131881-95131903 AAGCGTTTACCCTTAGAGAATGG + Intergenic
1075355871 10:121774984-121775006 ATGTGTCTGCCTTTTGAGAAAGG - Intronic
1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG + Intronic
1084946597 11:72642154-72642176 AGGGGTCTCCTCCCTGAGAAGGG + Intronic
1089375357 11:117990015-117990037 AGGGGTCATCCCTTTGAAATGGG + Intronic
1090324722 11:125875021-125875043 AATGGTTTACCCTTAGAGAATGG - Intergenic
1096619226 12:52852161-52852183 AGGGGTTTTCCCATTGACAAGGG - Intergenic
1100045944 12:90380767-90380789 AGTGGTTTACCTTTTGGGAAGGG + Intergenic
1101860104 12:108475740-108475762 AGGGTTCTCCCATTTGAGATGGG - Intergenic
1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG + Intronic
1103838123 12:123840354-123840376 AGAAGCCTCCCCTTTGAGAAAGG - Intronic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1104450809 12:128866960-128866982 AAGGGGCTGCCATTTGAGAAGGG - Intronic
1106332218 13:28749635-28749657 AGGTGTACACCCTGTGAGAATGG + Intergenic
1120908434 14:89642480-89642502 AGGGTTGTACCCTTTTAGTACGG + Intronic
1133955996 16:10444327-10444349 ATGGGTCTACCCTTTCTTAACGG + Intronic
1137462630 16:48679419-48679441 AGGGTTCCACCCTTAGAGATGGG + Intergenic
1137814816 16:51388618-51388640 ATGGGTCCAGCCTTTCAGAATGG + Intergenic
1142711318 17:1725320-1725342 GGGGGCCTGCCCTTTGAGGACGG + Exonic
1144359892 17:14482043-14482065 TGTAGTCTACCCTTGGAGAATGG + Intergenic
1156211869 18:34953013-34953035 AGGGATCTGCCCTTGGAAAATGG - Intergenic
1158016668 18:52791786-52791808 AAGCATCTACCCTTAGAGAATGG + Intronic
1158849343 18:61479290-61479312 TGGGGTTTACCTTTTGAGATTGG - Intronic
1166256915 19:41613131-41613153 GGTGGTCTACCCCATGAGAAGGG - Intronic
925472252 2:4175179-4175201 AAGCGTTTACCCTTAGAGAATGG + Intergenic
929686901 2:44043219-44043241 AGGGGTCTACCCTTTGCTCCAGG + Intergenic
931478420 2:62614352-62614374 CGGTGCCTACCTTTTGAGAATGG - Intergenic
933153230 2:78940171-78940193 AGGGGTATAACCATTGACAAAGG + Intergenic
934560404 2:95310300-95310322 AGGGGTCCCCCCTCTGAGCAGGG + Intronic
935019632 2:99217175-99217197 TAGGGTCTACTCTTTTAGAAGGG - Intronic
935541512 2:104354237-104354259 AGGGGGCTATCCTCTGGGAAAGG + Intergenic
938368678 2:130755729-130755751 CAGGGTCTTCCCTTGGAGAAGGG - Intronic
940476581 2:154169636-154169658 AGGGGGCAAGGCTTTGAGAAAGG + Intronic
940736099 2:157454001-157454023 AGGGGACTTGTCTTTGAGAATGG + Intronic
942850757 2:180482568-180482590 AGGGCTCCAGCCTTTGTGAATGG - Intergenic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
1169921644 20:10740539-10740561 AGGGGTCTTTCCTCTAAGAATGG + Intergenic
1172662310 20:36575601-36575623 AAGGGTCTACCCTTTCAGTCAGG - Intronic
1179568476 21:42263821-42263843 AGGGGTCTGTCCTGTCAGAAGGG + Intronic
1183235665 22:36615032-36615054 AGAGGTCTGCTCTTGGAGAACGG + Intronic
1185157395 22:49202372-49202394 CAGGGTCTATCCTGTGAGAAGGG - Intergenic
954069147 3:48130321-48130343 AGGGATTTACCCTAGGAGAAGGG - Intergenic
956501941 3:69896449-69896471 CGTGGTCTACCTTTTGAGAGAGG + Intronic
956632377 3:71329194-71329216 AGAGGTCTAGACTTTGTGAAAGG - Intronic
962891494 3:139676954-139676976 ATTGTTCTACCCATTGAGAATGG - Intronic
963068040 3:141279317-141279339 AGGTGTCAATCCTTTTAGAAGGG - Intronic
964935802 3:162085151-162085173 AGGGGTCCAGCTATTGAGAAGGG - Intergenic
965457889 3:168926846-168926868 AGGGTTTTACTCTTTGAAAATGG + Intergenic
966685516 3:182690247-182690269 TGGAGACTACACTTTGAGAACGG - Intergenic
969568082 4:7992047-7992069 AGGGGTCTCCCCATTGCGCAAGG - Intronic
970704975 4:18789887-18789909 AGTGGTCTACCCAGTGACAAAGG - Intergenic
977962591 4:103102950-103102972 AAGGCTCTACTCTTTGAGATGGG + Intergenic
978019130 4:103786562-103786584 AAGCGTTTACCCTTAGAGAATGG - Intergenic
978326337 4:107561332-107561354 AGGGGTCTAAAATTAGAGAAGGG - Intergenic
982184104 4:152779348-152779370 GGGGGTCTAGCCTTTCTGAAGGG + Intronic
983509049 4:168587979-168588001 AGGGGTTTAGCCCTGGAGAAAGG - Intronic
985592880 5:774532-774554 AGGGGTCTGCCCCTTGAGCCTGG + Intergenic
987485759 5:18523616-18523638 AGGCATCTACACTTTGAGAAGGG - Intergenic
995687351 5:114785090-114785112 CGGGGTCCATCCTTTGAGGATGG - Intergenic
995863431 5:116665002-116665024 AAGGGTCCATCCGTTGAGAAAGG + Intergenic
997273987 5:132567329-132567351 AGGGCTATATTCTTTGAGAAAGG + Intronic
1005181839 6:23115167-23115189 AAGTGTCTACCCTTTGAGAATGG + Intergenic
1006419970 6:33926766-33926788 AGGGGTCTACTCTTTGAATTTGG + Intergenic
1009657745 6:66568123-66568145 AAGTGTTTACCCTTAGAGAATGG + Intergenic
1010601007 6:77826504-77826526 AAGGCTGTACACTTTGAGAAGGG - Intronic
1014796705 6:125733376-125733398 AGGGATCTACCTTTTGCTAATGG - Intergenic
1022297745 7:29072200-29072222 AGAGGTCTAACTTTTGATAAGGG - Intronic
1030536391 7:110772212-110772234 TGGAGTCTACACATTGAGAATGG + Intronic
1033707815 7:143905681-143905703 AGGGGTTTTGCTTTTGAGAAAGG + Intergenic
1039183465 8:34891693-34891715 AAGTGTTTACCCTTAGAGAATGG - Intergenic
1041807085 8:61863439-61863461 AGGCATCTACCCTTGGGGAAAGG + Intergenic
1041883954 8:62786737-62786759 AAGCTTTTACCCTTTGAGAAAGG + Intronic
1044154995 8:88834858-88834880 AGGGATCTGCTCTTTGTGAATGG + Intergenic
1046211324 8:111080780-111080802 AGGGGTCTCCCCTCTGACACAGG + Intergenic
1051343330 9:16130634-16130656 AGAGGTCTATCCCTTAAGAAAGG - Intergenic
1053083015 9:35193256-35193278 AAGTGTTTACCCTTAGAGAATGG + Intronic
1060273482 9:122164661-122164683 TGGGGTCTAACCTCAGAGAAGGG + Intronic
1188433978 X:30139444-30139466 AGGGCTCTTCCCTTTATGAATGG - Intergenic
1189500950 X:41558109-41558131 AGGGGTCTACTCTTTAACCAAGG + Intronic
1191757456 X:64609211-64609233 AGGGTTTGACCCTTGGAGAATGG + Intergenic
1194002436 X:88448043-88448065 ACTGTTTTACCCTTTGAGAATGG - Intergenic
1196902863 X:120403043-120403065 AGGGGTCTACCCTTAAAACAGGG - Intergenic
1197029476 X:121796756-121796778 ATGGGTCTTACCTTTCAGAAGGG - Intergenic
1198228548 X:134668956-134668978 ATGGGTCTGGCCTTTGAAAATGG + Intronic